Harveyi's vibrio fliq gene knockout mutant strain, preparation method and application thereof

By constructing the Vibrio harveyi fliQ gene knockout mutant strain V.harveyi LcV6△fliQ, the problem of high pathogenicity of Vibrio harveyi to large yellow croaker was solved, enabling the application of attenuated live vaccines and inhibitors, and improving the immune protection of large yellow croaker.

CN119842577BActive Publication Date: 2025-11-25NINGBO UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411755188.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-03
Publication Date
2025-11-25
Estimated Expiration
2044-12-03

AI Technical Summary

Technical Problem

In the existing technology, Vibrio harveyi causes a high incidence of rotting disease in large yellow croaker, and there is not much research on the regulation of the virulence of Vibrio harveyi on large yellow croaker by the fliQ gene, and there is a lack of effective immune protection measures.

Method used

A knockout mutant strain of Vibrio harveyi, V. harveyi LcV6△fliQ, was constructed. This strain was prepared by homologous recombination to explore the effect of the fliQ gene on virulence, providing a new option for attenuated Vibrio harveyi vaccines.

Benefits of technology

It significantly reduced the virulence of Vibrio harveyi, provided an opportunity for the application of attenuated live vaccines and inhibitors, and improved the immune protection effect of large yellow croaker.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842577B_ABST
    Figure CN119842577B_ABST
Patent Text Reader

Abstract

The application discloses a Vibrio harveyi fliQ gene knockout mutant strain and a preparation method and application thereof, and has the characteristics that the strain has a preservation number of CGMCC No.32132, the preparation method comprises the following steps: amplifying an upper and lower fliQ fusion fragment by using an overlap PCR technology, connecting the fliQ-UD-T recombination plasmid into a T1 carrier and transforming the fliQ-UD-T recombination plasmid into a CC118 competent state; carrying out enzyme cutting and then connecting and transforming the fliQ-UD-T recombination plasmid and the pRE112 carrier, screening positive bacteria as donor bacteria after culture, taking Vibrio harveyi with a preservation number of CGMCC No.32133 as receptor bacteria, carrying out a conjugation and transfer experiment, and then carrying out sucrose induction double exchange to obtain the Vibrio harveyi fliQ gene knockout mutant strain, and the Vibrio harveyi fliQ gene knockout mutant strain has applications in preparation of attenuated live vaccine preparations, Vibrio harveyi inhibitors and large yellow croaker immune protection agents, and has the advantages that the Vibrio harveyi fliQ gene knockout mutant strain has an immune protection effect on the large yellow croaker.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a knockout mutant strain of Vibrio harveyi from large yellow croaker and its application. Background Technology

[0002] In recent years, as the large yellow croaker farming industry has gradually developed towards intensification and industrialization, large-scale, high-density farming and water pollution have led to increasingly serious aquatic diseases, which have severely threatened the sustainable development of the large yellow croaker farming industry. Body rot disease caused by Vibrio harveyi is characterized by recurrent outbreaks, high morbidity, and severe harm.

[0003] Vibrio harveyi is a pathogenic vibrio found ubiquitously in marine and estuarine ecosystems, and is the most common pathogen affecting aquaculture animals in tropical and subtropical marine environments. Infected fish exhibit anal bleeding, bleeding at the base of the caudal and pectoral fins, and ulceration of the body. Dissection reveals ascites in the abdominal cavity, yellow fluid in the intestines, hepatic erosion, and numerous white nodules in the spleen, leading to mass mortality of juvenile fish and severe economic losses. Therefore, developing effective measures to prevent Vibrio harveyi infection in farmed fish and among fishery workers is of great importance.

[0004] The pathogenic process of Vibrio harveyi involves adhesion, invasion, and proliferation within the organism, exerting its effects by producing pathogenic factors that interfere with the normal metabolism of host cells. Host adhesion is a crucial step and initial stage of infection, in which flagella, as the primary organelle of locomotion, plays a significant role. fliQ, a flagellar biosynthetic protein, is believed to be located in the central pore of the MS loop of the bacterial flagellar type III protein exit organ, along with flhA, flhB, fliO, fliP, and fliR. It is one of the main virulence factors of Vibrio harveyi, but research on the role of fliQ in regulating the virulence of Vibrio harveyi against large yellow croaker is currently limited. Therefore, constructing a fliQ-deficient mutant strain not only helps to elucidate the functional mechanism of flagellar proteins but also provides possibilities for the development of attenuated live vaccines against Vibrio harveyi, offering new and important data for the control of Vibrio harveyi disease in large yellow croaker. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a Vibrio harveyi fliQ gene knockout mutant strain that has an immune protective effect on large yellow croaker, as well as its preparation method and application.

[0006] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: a Vibrio harveyi fliQ gene knockout mutant strain, the strain being V. harveyi LcV6△fliQ strain, classified and named Vibrio harveyi, with accession number CGMCCNo.32132.

[0007] This invention also provides a method for preparing the above-mentioned V. harvestyi LcV6△fliQ strain, comprising the following steps:

[0008] Step 1, Activation of strain: Streak culture of Vibrio harveyi LcV6 with preservation number CGMCC No.32133, then pick a single colony and inoculate it into LB liquid medium and activate it at 28℃ to obtain Vibrio harveyi bacterial suspension;

[0009] Step 2, amplification of upstream and downstream fragments of the fliQ gene: First, the location of the Vibrio harveyi gene fliQ in the genome is obtained, and the approximately 500bp portions at both ends are cloned as homologous arms. Primers for amplifying the upstream fragment of fliQ, fliQ-up-F / fliQ-up-R, and primers for amplifying the downstream fragment of fliQ, fliQ-down-F / fliQ-down-R, are designed for PCR amplification to obtain the upstream and downstream fragments of fliQ, respectively.

[0010] Step 3, Homologous arm construction: The upstream and downstream fusion fragments of fliQ were amplified using overlap PCR technology, and then the upstream and downstream fusion fragments of fliQ were inserted into the T1 vector and transformed into CC118 competent cells. Positive clones were screened to obtain the fliQ-UD-T recombinant plasmid.

[0011] Step 4: Construction of the recombinant knockout vector: The fliQ-UD-T recombinant plasmid and pRE112 vector obtained in step 3 were digested with enzymes and then ligated and transformed. After culturing, positive clones were screened to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112.

[0012] Step 5, Recombinant plasmid binding and transfer experiment: Using the X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 obtained in Step 4 as the donor bacteria, and Vibrio harveyi LcV6 with preservation number CGMCC No.32133 as the recipient bacteria, the binding and transfer experiment was carried out to obtain the identified positive strains.

[0013] Step 6, Sucrose-induced double exchange: Inoculate the positive strains into LB solid medium containing 10 wt% sucrose, select single clones and inoculate them into 96-well plates, perform bacterial PCR verification, and screen positive clones to obtain V. harvestyi LcV6△fliQ strain.

[0014] Furthermore, the nucleotide sequence of fliQ-up-F in step 2 is shown in SEQ ID NO.1: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3'; the nucleotide sequence of fliQ-up-R is shown in SEQ ID NO.2: 5'-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGT C-3'; the nucleotide sequence of fliQ-down-F is shown in SEQ ID NO.3: 5'-GACCAAGAATCAT GGACAAGCTGGCAGACAAGGTACCA-3'; and the nucleotide sequence of fliQ-down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

[0015] Furthermore, the overlapping PCR amplification system described in step 3 consists of 12.5 μL of 2×Taq PCR Master Mix, 1 μL of 10 μM fliQ-up-F containing XbaI restriction site, 1 μL of 10 μM fliQ-down-R containing SacI restriction site, 1 μL of fliQ upstream fragment template DNA, 1 μL of fliQ downstream fragment template DNA, and 8.5 μL of sterile water.

[0016] Further, step 4 specifically involves: constructing a recombinant knockout vector: digesting the fliQ-UD-T recombinant plasmid and pRE112 vector obtained in step 3 with enzymes and then ligating and transforming them. After the transformed competent cells are revived, they are cultured overnight. After single colonies grow, multiple single clones are picked and placed in LB liquid medium containing chloramphenicol and cultured at 150 rpm for 12 h in a shaker at 37°C. After culturing single-clone bacteria, bacterial DNA was extracted and used as a PCR template for verification. Validation primers pRE112-F / pRE112-R were designed based on the pRE112 vector. The nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3', and the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'. The PCR amplification system (25 μL) consisted of: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of 10 μM pRE112-F, and 10 μM pRE112-R. 1 μL of DNA template and 9.5 μL of sterile water were used. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles. The cells were stored at 4℃ to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112.

[0017] Further, step 5 specifically involves: mixing Vibrio harveyi bacterial suspension and X7213 positive bacterial suspension containing recombinant vector ΔfliQ-pRE112 at a volume ratio of 1:1, then dropping the mixture onto the center of a 2216E plate containing DAP and culturing to obtain a mixed bacterial culture. After washing the mixed bacterial culture, it is spread onto a 2216E plate containing chloramphenicol, and after culturing, single clones are picked and cultured in 2216E liquid medium containing chloramphenicol. The single clone bacterial suspension is used as a DNA template for bacterial suspension PCR verification to screen and identify positive strains.

[0018] Further, step 6 specifically involves: adding the identified positive strain to a test tube containing antibiotic-free 2216E medium, culturing the culture, diluting the bacterial solution and spreading it on a 10% sucrose plate for further culture, and after the growth of single colonies, picking several single clones from each colony, inoculating them into well plates, culturing at room temperature, extracting the bacterial solution as a template for the knockout strain DNA for bacterial PCR verification, and screening for positive clones to obtain the V. harvestyi LcV6△fliQ strain.

[0019] The present invention also provides the application of the above-mentioned V. harvestyi LcV6△fliQ strain in the preparation of attenuated live vaccine formulations.

[0020] The present invention also provides the application of the above-mentioned V. harvestyi LcV6△fliQ strain in the preparation of Vibrio harveyi inhibitors.

[0021] This invention also provides the application of the above-mentioned V. harvestyi LcV6△fliQ strain in the preparation of immunoprotective agents for large yellow croaker.

[0022] Compared with the prior art, the advantages of the present invention are as follows: The present invention discloses for the first time the fliQ gene knockout mutant strain of Vibrio harveyi, its preparation method and application, constructs the fliQ gene knockout strain using homologous recombination, explores the effect of the fliQ gene on virulence, and provides a new option for Vibrio harveyi attenuated vaccines.

[0023] The aforementioned Vibrio harveyi strain, LcV6, is classified and named Vibrio harveyi. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 32133, on September 30, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China.

[0024] The aforementioned Vibrio harveyi fliQ gene knockout mutant strain, strain V. harveyi LcV6△fliQ, is classified as Vibrio harveyi. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 32132, on September 30, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China. Attached Figure Description

[0025] Figure 1 The image shows an agarose gel electrophoresis diagram of the amplified upstream and downstream fragments of fliQ. M is a 2kPlus DNA Marker, lane 1 is the amplified upstream fragment of fliQ, and lane 2 is the amplified downstream fragment of fliQ.

[0026] Figure 2 This is an agarose gel electrophoresis image of the upstream and downstream fusion fragments of fliQ amplified by overlapping PCR. M is a 2kPlus DNA Marker, and lanes 1 and 2 are the amplified upstream and downstream fusion fragments of fliQ.

[0027] Figure 3 The image shows an agarose gel electrophoresis image of X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112. M is the 2k Plus DNA Marker, and lane 1 is the verified fliQ upstream and downstream fusion fragment linked to pRE112.

[0028] Figure 4The image shows an agarose gel electrophoresis image of the PCR amplification product after the first homologous recombination integration. M is the 2kPlus DNA Marker. The result is obtained by first exchanging the upstream homologous arm of the V. harvestyi LcV6 genome with the fusion fragment on the recombinant vector, and then exchanging it with the downstream homologous arm. Lanes 2 and 3 show the result of first exchanging the downstream homologous arm of the V. harvestyi LcV6 genome with the fusion fragment on the recombinant vector, and then exchanging it with the upstream homologous arm.

[0029] Figure 5 Agarose gel electrophoresis images of V. harveyi LcV6 and Vibrio harveyi fliQ gene knockout mutants. M is 2k Plus DNA Marker, lane 1 is V. harveyi LcV6, and lanes 2-4 are selected Vibrio harveyi fliQ gene knockout mutants.

[0030] Figure 6 Agarose gel electrophoresis images of V. harvestyi LcV6 and Vibrio harveyi fliQ gene knockout mutants, M is 2k Plus DNA Marker, lane 1 is V. harvestyi LcV6, lanes 2-8 are selected Vibrio harveyi fliQ gene knockout mutants.

[0031] Figure 7 To detect the motility of knockout and wild-type strains in LB semi-solid medium, where A represents the motility of ΔfliQ strain and V. harvestyi LcV6 strain in LB semi-solid medium, and B represents the statistical motility radius of the two strains.

[0032] Figure 8 The half-lethal concentration curves are for wild-type V. harveyi LcV6 and Vibrio harveyi fliQ gene knockout mutant, where A represents wild-type V. harveyi LcV6 and B represents Vibrio harveyi fliQ gene knockout mutant.

[0033] Figure 9 Results of the determination of the protective efficiency of Vibrio harveyi fliQ gene knockout mutant strain on large yellow croaker. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0035] Specific Example 1: Preparation of Vibrio harveyi fliQ gene knockout mutant strain.

[0036] Step 1: Activate the strain: Take out the Vibrio harveyi LcV6 (CGMCC No. 32133) bacterial culture from the -80℃ freezer, and immediately use a sterile pipette tip to dip a small amount of ice residue liquid for streaking culture; then pick a single colony and inoculate it into LB liquid medium (purchased from Dalian Meilun Biotechnology Co., Ltd., catalog number: MMT059) and activate it at 28℃ to obtain Vibrio harveyi bacterial culture.

[0037] Step 2: Amplification of upstream and downstream fragments of the fliQ gene: First, the location of the *Vibrio harveyi* gene *fliQ* in the genome is obtained. Approximately 500 bp segments from both ends are cloned as homologous arms. Primers for amplifying the upstream fragment of *fliQ* are designed as *fliQ-up-F / fliQ-up-R*, and primers for amplifying the downstream fragment as *fliQ-down-F / fliQ-down-R*.

[0038] The nucleotide sequence of fliQ-up-F is shown in SEQ ID NO.1: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3';

[0039] The nucleotide sequence of fliQ-up-R is shown in SEQ ID NO.2: 5'-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGTC-3';

[0040] The nucleotide sequence of fliQ-down-F is shown in SEQ ID NO.3: 5'-GACCAAGAATCATGGACAAGCTGGCAGACAAGGTACCA-3';

[0041] The nucleotide sequence of fliQ-down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

[0042] Using Vibrio harveyi bacterial culture as a sample, DNA was extracted using a bacterial genomic DNA extraction kit (purchased from Beijing Tiangen Biotech Co., Ltd.). The extracted Vibrio harveyi DNA was used as a template for PCR amplification of the upstream fragment of the fliQ gene. The PCR amplification system (25 μL) consisted of: 12.5 μL 2×Taq PCR Master Mix, 1 μL 10 μM fliQ-up-F, 1 μL 10 μM fliQ-up-R, 1 μL DNA template, and 9.5 μL sterile water. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for 35 cycles; stored at 4℃. After amplification, the PCR products were separated and verified by agarose gel electrophoresis, and then the amplified products were excised from the gel and sequenced. The results are as follows: Figure 1 As shown, lane 1 is the upstream fragment of fliQ (abbreviated as fliQ-up), and the nucleotide sequence of fliQ-up is shown in SEQ ID NO.5: 5'-AATGCCTTGAAGAGATAGAGCGGT AATAACCTGAGCCGACCGGCCAAACGACAAAGCTCTGAATAACAATGTCGATAACCAACAAATGTCCTTCAAGTGCAAGGAACAGCAAAGTAGAAAAAATCAGAAAAATACGTCCAAGAATGGCGACCGAAAGTCCGTTCACTGGGTCATTCATCATCGCCATACCTAAACCCATCTGCAGAGAGATGACTTGACCAAGCATGGTAAAGACATTGAATAGCATATGCAGAATCAAC CCAAACATCACGCCAGATTGCTTGCTCGAAAGCAAGAAACAGAGACGTCATAGAGAAGAGTTCGACTTCTGGCATGGGTGGCATCAGTGGAGCGGTGATCACCACAATAGAAAGGGCGAGCAAGCTGCGCACCCAAACAGGAATAAGCGCATCTCCGAAAAAAGGCATGGAGATAAACACCGCGCCCACACGGAAAAATGGCCACCAAAGTTGACCAAGAATCATGGAC-3'.

[0043] Further, the downstream fragment of fliQ was amplified by PCR. The PCR amplification system (25 μL) consisted of: 12.5 μL of 2×Taq PCR MasterMix, 1 μL of 10 μM fliQ-down-F, 1 μL of 10 μM fliQ-down-R, 1 μL of DNA template, and 9.5 μL of sterile water. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles; stored at 4℃. After amplification, the PCR products were separated and verified by agarose gel electrophoresis, and then the amplified products were excised from the gel and sequenced. The results are as follows: Figure 1 As shown, lane 2 is the downstream fragment of fliQ (abbreviated as fliQ-down), and the nucleotide sequence of fliQ-down is shown in SEQ ID NO. 6: 5'-AAGCTGGCAGACAAGGTACCAACCGTCATCGCCCAACCATCAACAAGAACAAA AATGACCAGTTTTAAAGGGTAGGGAGATGATCAGAGGTGACAACATCATCATACCCATTGCCATTAAGACACTAGCGACCACCAGATCGATGATCAAAAATGGAATAAACAACATGAAGCCAATTTGGAAAGCCGTTTTGAGTTCACTGATCACAAATGCTGGCAGTACAACAGCGAAAGAAATGTCTTCAACATTTTGATCTATTGGCTCATTCGC AATACGTAACATCTGCTCTAATGAGCTTTGGTGCGTCTGCGCTAACATAAAGCTTCTGACTGGCTTTTCAGCTACAGAAAACGCCTGAACCAAAGTAATTTCACCGTTGTCATAGGGCTTAAACGCATTGTCGTAAATGTCAGTCCAAACGGGACGCATAATTAGAATCGTCAGCGTCAAAGCAATACCCACCAACACTCGGTTTGGTGGGC-3'.

[0044] Step 3: Constructing Homologous Arms: The fusion fragment was obtained using overlap PCR technology. The upstream primer was fliQ-up-F containing an Xba I restriction site, and the downstream primer was fliQ-down-R containing a Sac I restriction site. The overlap PCR amplification system was 25 μL: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of 10 μM fliQ-up-F containing an Xba I restriction site, 1 μL of 10 μM fliQ-down-R containing a Sac I restriction site, 1 μL of fliQ upstream fragment template DNA, 1 μL of fliQ downstream fragment template DNA, and 8.5 μL of sterile water. The PCR amplification program was as follows: 94℃ for 5 min; 94℃ for 30 sec, 65℃ for 30 sec, 72℃ for 1 min, 10 cycles. After each thermal cycle, the annealing temperature was lowered by 1℃, and the cycle was restarted; 94℃ for 30 sec, 56℃ for 30 sec, 72℃ for 1 min, 25 cycles; stored at 4℃. After amplification, the PCR products were separated and verified by agarose gel electrophoresis. The results are as follows: Figure 2As shown, lanes 1 and 2 contain the amplified upstream and downstream fusion fragments of fliQ (abbreviated as fliQ-UD fragments). The fragments were then gel-cleaved, recovered, and sequenced. The nucleotide sequence of fliQ-UD is shown in SEQ ID NO.7: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATACCTGAGCCGACCGGCCAAACGACAAAGCTCTGAATAACAATGTCGATAACCAACAAATGTCCTTCAAGTGCAAGGAACAGCAAAGTAGAAAAAATCAGAAAAATACGTCCAAGAATGGCGACCGAAAGTCCGTTCACTGGGTCATTCATCATCGCCATACCTAAACCCATCTGCAGAGAGATGACTTGACCAAGCATGGTAAAGACATTGAATAGCATATGCAGAATCAACCCAAACATCACGCCCCAGATTGCTTGCTCGAAAGCAAGAAACAGAGACGTCATAGAGAAGAGTTCGACTTCTGGCATGGGTGGCATCAGTGGAGCGGTGATCACCACAATAGAAAGGGCGAGCAAGCTGCGCACCCAAACAGGAATAAGCGCATCTCCGAAAAAAGGCATGGAGATAAACACCGCGCCCACACGGAAAAATGGCCACCAAAGTTGACCAAGAATCATGGACAAGCTGGCAGACAAGGTACCAACCGTCATCGCCCAACCATCAACAAGAACAAAAATGACCAGTTTAAAGGGTAGGGAGATGATCAGAGGTGACAACATCATCATACCCATTGCCATTAAGACACTAGCGACCACCAGATCGATGATCAAAAATGGAATAAACAACATGAAGCCAATTTGGAAAGCCGTTTTGAGTTCACTGATCACAAATGCTGGCAGTACAACAGCGAAAGAAATGTCTTCAACATTTTGATCTATTGGCTCATTCGCAATACGTAACATCTGCTCTAATGAGCTTTGGTGCGTCTGCGCTAACATAAAGCTTCTGACTGGCTTTTCAGCTACAGAAAACGCCTGAACCAAAGTAATTTCACCGTTGTCATAGGGCTTAAACGCATTGTCGTAAATGTCAGTCCAAACGGGACGCATAATTAGAATCGTCAGCGTCAAAGCAATACCCACCAACACTCGGTTTGGTGGGCGAGCTCTTT-3'。

[0045] The fliQ-UD fragment was then inserted into the pEASY-T1 Simple cloning vector (Beijing TransGen T1 Simple Gene Cloning Kit) and transformed into CC118 competent cells. PCR amplification was then performed using universal primers M13-F / M13-R under the following conditions: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles; the cells were stored at 4℃. The PCR products were separated by agarose gel electrophoresis, and positive clones were screened to obtain the fliQ-UD-T recombinant plasmid.

[0046] Step 4: Construct the recombinant knockout vector: The fliQ-UD-T recombinant plasmid and pRE112 vector obtained in Step 3 are processed using the restriction endonuclease Xba. Double digestion with I and SacI was performed at 37°C for 1 hour. The digestion products were recovered and ligated overnight at 16°C using T4 ligase. The ligation products were then mixed with X7213 competent cells and placed on ice for 30 minutes. The cells were then heat-shocked at 42°C for 40-90 seconds and placed on ice again for 2 minutes. 50 μL of the transformed competent cells were added to 900 μL of LB liquid medium and placed in a constant temperature shaker. The competent cells were revived at 37°C and 150 rpm for 60 minutes. The cells were centrifuged at 5000 rpm for 2 minutes. Most of the supernatant was discarded, and the remaining small amount of liquid was resuspended by pipetting. The entire mixture was then spread onto LB solid medium containing chloramphenicol (LB agar was purchased from Qingdao Haibo Biotechnology Co., Ltd., product number: HB0129-2) and incubated overnight at 37°C. After single colonies grew, multiple single clones were picked and placed in LB liquid medium containing 34 μg / mL chloramphenicol. They were cultured at 150 rpm for 12 h in a shaker at 37 °C. The single-clone bacterial culture was used as a DNA template for bacterial culture PCR verification. The verification primers pRE112-F / pRE112-R were designed based on the pRE112 vector. The nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3', and the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'. The PCR amplification system (25 μL) consisted of: 12.5 μL of 2×TaqPCR Master Mix, 1 μL of 10 μM pRE112-F, 1 μL of 10 μM pRE112-R, 1 μL of DNA template, and 9.5 μL of sterile water. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles; stored at 4℃. The PCR products were separated and verified by agarose gel electrophoresis. The results are as follows: Figure 3As shown, lane 1 is the verified fliQ upstream and downstream fusion fragment connected to pRE112.

[0047] Collect 3 mL of successfully identified bacterial culture, extract plasmids according to the instructions of the plasmid mini-extraction kit (Guangdong Meiji Biotechnology Co., Ltd.), and send it to the company for sequencing to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112.

[0048] Step 5: Recombinant plasmid binding and transfer experiment (first homologous recombination).

[0049] Using the X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 obtained in step 4 as the donor bacteria, and Vibrio harveyi LcV6 with preservation number CGMCC No.32133 as the recipient bacteria, a binding transfer experiment was carried out.

[0050] Take a small amount (up to 5 mL) of 2216E medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) from V. harvestyi LcV6 stored in an ultra-low temperature freezer, activate it by shaking in a small shaker at 28°C, and then transfer it to 2216E medium at a volume percentage of 1%. Continue to culture at 28°C for 4-6 hours until the mid-to-late logarithmic stage to obtain Vibrio harvestyi bacterial suspension.

[0051] Simultaneously, a small amount of X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 was picked and added to LB liquid medium containing 34 μg / mL chloramphenicol and 50 μg / mL 2,6-diaminopimelic acid (DAP). The medium was then incubated in a 37°C constant temperature shaker for 12 h. Then, at a volume percentage of 1%, the bacteria were transferred to LB solid medium containing 34 μg / mL chloramphenicol and 50 μg / mL 2,6-diaminopimelic acid and incubated at 37°C for another 4-6 hours until the mid-to-late logarithmic phase to obtain the recombinant vector bacterial culture.

[0052] Take 1.5 mL of Vibrio harveyi bacterial suspension and recombinant vector bacterial suspension respectively, centrifuge, and wash twice with sterile ddH2O to remove antibiotics. Then resuspend the bacterial cells with 500 μL of sterile ddH2O. Take 100 μL of each and mix them in a 1:1 volume ratio. Take 100 μL of the mixed bacterial suspension and drop it into the center of a 2216E agar plate containing 50 μg / ml DAP (2216E agar was purchased from Qingdao Haibo Biotechnology Co., Ltd.). After drying, place it in an incubator at 28℃ and incubate for 12 h to obtain mixed bacteria.

[0053] The mixed bacteria were washed into centrifuge tubes with 400 μL of 2216E medium. The washed mixed bacterial solution was spread onto 2216E plates containing 10 μg / mL chloramphenicol and incubated at 28°C for 1-2 days. Then, 8 single clones were picked and transferred to 2216E liquid medium containing 34 μg / mL chloramphenicol and incubated at 28°C. Four single clones were used as DNA templates for bacterial PCR verification. Primers VH-F / VH-R were designed based on the V. harvestyi LcV6 gene, where the nucleotide sequence of VH-F is shown in SEQ ID NO.10: 5'-CTGCTCGGTTCATCACA-3', and the nucleotide sequence of VH-R is shown in SEQ ID NO.11: 5'-CCAGCGTTTATCCTCAT-3'.

[0054] The PCR system consisted of 25 μL: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of 10 μM pRE112-F, 1 μL of 10 μM VH-R, 1 μL of DNA template, and 9.5 μL of sterile water. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles; stored at 4℃. The PCR products were separated and verified by agarose gel electrophoresis, and the results are as follows: Figure 4 Lanes 1 and 4 are 1315bp, and lanes 2 and 3 are 1585bp. Because the fusion fragment on the recombinant vector has a different single exchange order with the upstream and downstream homologous arms on the V. harvestyi LcV6 genome, the integration of the vector into the genome will produce two results. Lanes 1 and 4 are the results obtained by the fusion fragment on the recombinant vector exchanging with the upstream homologous arm on the V. harvestyi LcV6 genome first, and then exchanging with the downstream homologous arm. Lanes 2 and 3 are the results obtained by the fusion fragment on the recombinant vector exchanging with the downstream homologous arm on the V. harvestyi LcV6 genome first, and then exchanging with the upstream homologous arm.

[0055] Step 6: Sucrose-induced double exchange (second homologous recombination).

[0056] Add the bacterial suspensions from both results in step 5 to test tubes containing antibiotic-free 2216E medium at a volume percentage of 0.1%, and incubate at 28°C for 15 hours. Dilute the bacterial suspensions 10... 1 10 2 10 3 10 4 10 5 and 10 6 Times, of which 10 times dilution 3 Up to 10 6Take 200 μL of each bacterial culture and spread it on a 10 wt% sucrose plate. Incubate at 28°C for 1-2 days. After single colonies grew, 48 single clones were picked from each well and inoculated into 96-well plates (each well containing 150 μL of 2216E medium). The plates were incubated at room temperature for 5 h. The bacterial culture was extracted and used as a DNA template for the knockout strain. Primers fliQ-F / fliQ-R were designed based on the fliQ gene (the nucleotide sequence of the fliQ gene is shown in SEQ ID NO.12: 5'-TTAGCCGATCATCCCCGGAATGTTGT GGAATAGGTAATCGAACAGCTCCATGATTTTTCGCAGCATCCAGTGACCTGCGAAAATCACCATAAGGAGTGTGACTAATAGACGCGGTAAGAAACTCAGTGTCTGTTCGTTAATCTGTGTTGCGGCTTGAAATACCGCAATACACAAACCAACAATCAAACCAGGTACAACAAGCACTGCCACCATCAAGATGATAAGCCATACTGCGTCAGAGAATAGAGTGACGGTTAATTCTGGTGTCAT-3'). The nucleotide sequence of fliQ-F is shown in SEQ ID NO.12. As shown in NO.13: 5'-GTGTTGCGGCTTGAAAT-3', the nucleotide sequence of fliQ-R is shown in SEQ ID NO.14: 5'-ATGGTGGCAGTGCTTGT-3'.

[0057] Strains were randomly selected from the two results to serve as DNA templates for bacterial culture PCR verification. The PCR system consisted of 25 μL: 12.5 μL 2×Taq PCR Master Mix, 1 μL 10 μM fliQ-F, 1 μL 10 μM VH-R, 1 μL DNA template, and 9.5 μL sterile water. The PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min, for 35 cycles; stored at 4℃. The PCR products were separated and verified by agarose gel electrophoresis. A control group was also set up: Vibrio harveyi bacterial culture was used as the DNA template for bacterial culture PCR verification. The PCR system and amplification program were the same as above, and the PCR products were separated and verified by agarose gel electrophoresis.

[0058] The results are as follows Figure 5 As shown, lane 1 is the wild-type V. harvestyi LcV6 strain, with a PCR product length of 721 bp (control group), and lanes 2-4 are the V. harvestyi LcV6 ΔfliQ knockout strains, with a PCR product length of 0 bp.

[0059] Further verification was performed using VH-F / VH-R primers. The PCR system was 25 μL: 12.5 μL of 2×Taq PCR MasterMix, 1 μL of 10 μM VH-F, 1 μL of 10 μM VH-R, 1 μL of DNA template, and 9.5 μL of sterile water. The PCR amplification program was the same as above. After amplification, the PCR products were separated and verified by agarose gel electrophoresis. The results are as follows. Figure 6 As shown, lane 1 contains the PCR product of the wild-type V. harveyi LcV6 strain with a length of 1473 bp, and lanes 2-8 contain the PCR product of the V. harveyi LcV6 ΔfliQ knockout strain with a length of 1162 bp. The PCR amplification products were sequenced for verification, and the verified colonies were stored at -80℃, which are the Vibrio harveyi fliQ gene knockout mutant strains.

[0060] This strain is currently deposited at the China General Microbiological Culture Collection Center (CGMCC), and is identified as V. harveyi LcV6△fliQ strain, classified as Vibrio harveyi, with accession number CGMCCNo.32132, deposited on September 30, 2024, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0061] Specific Example 2 and Specific Example 1: Determination of the motility of Vibrio harveyi fliQ gene knockout mutant strain.

[0062] The wild-type V. Harveyi LcV6 strain and the V. Harveyi LcV6 △fliQ knockout strain were cultured in LB solid medium until OD... 600 Approximately 0.5, then adjust OD using LB liquid medium. 600 =0.2, carefully drop 1 μL of bacterial culture onto LB semi-solid medium containing 0.3% agar (LB liquid medium with 0.3% agar by mass), and incubate at 28℃ for 48 h. Observe and photograph the motility of the strains, and record and compare colony diameters. Figure 7 As shown in A and B, under the same conditions, both strains can move in a sticky environment. However, the colony diameter formed by the V.harveyi LcV6△fliQ knockout strain is significantly smaller than that of the V.harveyi LcV6 wild strain (P<0.05), indicating that knocking out the fliQ gene affects the motility of the V.harveyi LcV6 wild strain.

[0063] Specific Example 3: Infection experiment and median lethal dose (LD50) of the Vibrio harveyi fliQ gene knockout mutant strain prepared in Specific Example 1. 50 The determination.

[0064] The experimental fish were healthy large yellow croakers purchased from a fish farm in Xiangshan, Zhejiang Province. They were 8-10 cm in length and weighed approximately 25-30 g. These fish were temporarily housed in the ecological recirculation aquaculture system at the pilot-scale testing base of the Ningbo University School of Marine Science and Technology for over a week without any abnormalities. The fish were randomly divided into groups of 30 each. The culture water temperature was 18℃, and the fish were not fed during the experiment.

[0065] Median lethal dose (LD50) determination: Healthy large yellow croakers were divided into groups of 30. A certain concentration of wild-type strain V. harvestyi LcV6 and knockout strain V. harvestyi LcV6△fliQ was diluted to 4 × 10⁻⁶. 8 4×10 7 4×10 6 CUF / mL. Bacterial suspension was injected intraperitoneally at 0.2 mL / fish. The control group was injected with sterile PBS buffer at 0.2 mL / fish. The LD50 for each group on large yellow croaker was then calculated. 50 .

[0066] The results are as follows Figure 8 As shown in Figures A and B, the LD is calculated using the Bliss method. 50 The median lethal concentration (LD50) of wild-type V. harvestyi LcV6 is 7.4 × 10⁻⁶. 5 CFU / mL, Vibrio harveyi fliQ knockout strain is 6.7 × 10⁻⁶. 6 CFU / mL. The toxicity was reduced by 9.1 times compared to the wild type.

[0067] Specific Example 4: Immunoprotective experiment on large yellow croaker using Vibrio harveyi fliQ gene knockout mutant strain prepared in Specific Example 1.

[0068] Large yellow croakers were randomly divided into groups of 30 each. They were immunized with the *Vibrio harveyi* fliQ gene knockout mutant strain prepared in Example 1 via intraperitoneal injection. The concentration of the prepared strain was adjusted to 2.4 × 10⁻⁶. 5 CUF / mL, 0.2 mL / tail, intraperitoneal injection. The control group received sterile PBS buffer, 0.2 mL / tail. After 14 days, booster immunization was performed by repeating the above dose. One week later, each group was challenged with live wild-type V. harvestyi LcV6 at a concentration of 10... 9 CUF / mL, 0.2mL / tail, intraperitoneal injection. Then observe the control group and the immunized group, record the number of deaths, and calculate the immunoprotective efficacy of each group according to the following formula: Immunoprotective efficacy % = (mortality rate of control group - mortality rate of immunized group) / mortality rate of control group × 100%.

[0069] The results are as follows Figure 9As shown, three weeks after inoculation, large yellow croakers in both the immunized and control groups were injected with the wild-type virus. Results indicated that mortality was observed in both the control and vaccine groups after wild-type stimulation. Compared to the immunized group, the mortality rate in the control group was significantly higher after challenge. The dead large yellow croakers exhibited ulceration on their tail fins and abdomens, pale yellow inflammatory mucus in their intestines, and numerous white spots on their spleens. Seventeen days after challenge, the mortality rates in the control and immunized groups were 100% and 56.7%, respectively, with a calculated RPS (Recovery Price Score) of 43.3%.

[0070] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A Vibrio harveyi fliQ gene knockout mutant strain, characterized in that: This strain is V. harveyi LcV6△ fliQ The strain was classified and named Vibrio harveyi ( Vibrio harveyi (The accession number is CGMCC No.32132).

2. A method for preparing the *Vibrio harveyi* fliQ gene knockout mutant strain according to claim 1, characterized in that... Includes the following steps: Step 1, Activate the strain: Use the strain with preservation number CGMCC No. 32133 V. harveyi LcV6 was streaked and cultured, and then single colonies were picked and inoculated into LB liquid medium and activated at 28°C to obtain Vibrio harveyi bacterial suspension; Step 2 fliQ Upstream and downstream gene fragment amplification: First, the Vibrio harveyi gene was obtained. fliQ Based on its location in the genome, approximately 500 bp from both ends were cloned as homologous arms, and a design was developed. fliQ upstream fragment amplification primers fliQ -up-F / fliQ -up-R, fliQ Downstream fragment amplification primers fliQ -down-F / fliQ -down-R, perform PCR amplification, and obtain the following results. fliQ Upstream segments and fliQ Downstream segments; Step 3, Homologous arm construction: Amplification was performed using overlap PCR technology. fliQ Upstream and downstream fusion segments, then fliQ The upstream and downstream fusion fragments were inserted into the T1 vector and transformed into CC118 competent cells. Positive clones were then screened to obtain... fliQ -UD-T recombinant plasmid; Step 4, Construction of the recombination knockout vector: The vector obtained in Step 3... fliQ -UD-T recombinant plasmid and pRE112 vector were digested with enzymes, then ligated and transformed. After culturing, positive clones were screened to obtain clones containing the recombinant vector Δ. fliQ X7213 positive bacteria of -pRE112; Step 5, Recombinant plasmid binding and transfer experiment: Using the recombinant vector Δ obtained in Step 4... fliQ X7213-positive bacteria of pRE112 were used as donor bacteria, with accession number CGMCC No. 32133. V. harveyi LcV6 was used as the recipient bacterium, and binding transfer experiments were conducted to obtain positive strains. Step 6: Sucrose-induced double crossover: Inoculate the identified positive strains into LB solid medium containing 10 wt% sucrose. Select single clones and inoculate them into 96-well plates for colony PCR verification. Screening for positive clones yields Vibrio harveyi. fliQ Gene knockout mutant strain.

3. The method for preparing the Vibrio harveyi fliQ gene knockout mutant strain according to claim 2, characterized in that: The steps described in step 2 fliQ The nucleotide sequence of -up-F is shown in SEQ ID NO.1: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3'; fliQ The nucleotide sequence of -up-R is shown in SEQ ID NO.2: 5'-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGTC-3'; fliQ The nucleotide sequence of -down-F is shown in SEQ ID NO.3: 5'-GACCAAGAATCATGGACAAGCTGGCAGACAAGGTACCA-3'; fliQ The nucleotide sequence of -down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

4. The method for preparing the Vibrio harveyi fliQ gene knockout mutant strain according to claim 2, characterized in that: The overlap PCR amplification system described in step 3 consists of 12.5 μL of 2 × Taq PCR Master Mix and 10 μM of [a specific reagent / container]. Xba I Enzyme cleavage sites fliQ -up-F 1 μL, 10 μM containing Sac I Enzyme cleavage sites fliQ -down-R 1 μL、 fliQ 1 μL of upstream fragment template DNA fliQ 1 μL of downstream fragment template DNA and 8.5 μL of sterile water.

5. The method for preparing the Vibrio harveyi fliQ gene knockout mutant strain according to claim 2, characterized in that... Step 4 specifically involves: constructing the recombination knockout vector: the vector obtained in step 3... fliQ The UD-T recombinant plasmid and pRE112 vector were digested with enzymes and then ligated for transformation. The transformed competent cells were revived and cultured overnight. After single colonies grew, multiple single colonies were picked and placed in LB broth containing chloramphenicol. They were cultured at 37°C and 150 rpm for 12 h in a shaker. Single colony culture was used as a DNA template for colony PCR verification. Primers pRE112-F / pRE112-R were designed based on the pRE112 vector. The nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3', and the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'. The PCR amplification system (25 μL) consisted of: 12.5 μL of 2×TaqPCR Master Mix, 1 μL of 10 μM pRE112-F, 1 μL of 10 μM pRE112-R, and 1 μL of DNA template. μL of sterile water and 9.5 μL of sterile water were used; the PCR amplification program was: 94℃ for 5 min; 94℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, for 35 cycles; the product was stored at 4℃ to obtain the product containing the recombinant vector Δ. fliQ -pRE112 is an X7213 positive bacterium.

6. The method for preparing the Vibrio harveyi fliQ gene knockout mutant strain according to claim 2, characterized in that... Step 5 is as follows: Vibrio harveyi bacterial suspension and X7213 positive bacterial suspension containing recombinant vector ΔfliQ-pRE112 are mixed at a volume ratio of 1:1 and dropped into the center of a 2216E plate containing DAP for culture to obtain mixed bacteria. The mixed bacteria are washed and spread on a 2216E plate containing chloramphenicol. After culture, single clones are picked and cultured in 2216E liquid medium containing chloramphenicol. The single clone bacterial suspension is used as a DNA template for bacterial suspension PCR verification to screen and identify positive strains.

7. The method for preparing the Vibrio harveyi fliQ gene knockout mutant strain according to claim 2, characterized in that... Step 6 specifically involves adding the identified positive strain to a test tube containing antibiotic-free 2216E medium. After culturing, the bacterial solution is diluted and spread onto 10% sucrose plates. After single colonies grow, several single clones are picked from each plate and inoculated into wells at room temperature. The bacterial solution is then extracted and used as a template for knockout DNA verification via PCR. Positive clones are selected to obtain Vibrio harveyi. fliQ Gene knockout mutant strain.

8. A Vibrio harveyi strain according to claim 1 fliQ Application of gene knockout mutants in the preparation of live attenuated vaccine formulations.