Catalyst for catalyzing steroid compound to biologically convert steroid medicine and preparation method of catalyst

Abstract

The invention provides a catalyst for catalyzing bioconversion of steroid drugs from steroids and a preparation method of the catalyst. According to the present invention, the C21 hydroxylase CsCYP21A or the combination of the C21 hydroxylase CsCYP21A and the cytochrome P450 reductase CPRCS is adopted as the catalyst, the recombinant expression vector is constructed, the pichia pastoris KM71H is adopted as the expression host, the heterologous expression of the C21 hydroxylase CsCYP21A is achieved, and the efficient hydroxylation conversion of a variety of different steroid compounds C21 is successfully achieved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a catalyst for catalyzing the bioconversion of steroid compounds into steroid drugs and a preparation method thereof. Background Art

[0002] Steroid drugs are the second largest class of drugs after antibiotics, of which corticosteroid derivatives account for a large proportion. Corticosteroids, including glucocorticoids and mineralocorticoids, are key hormones in the human body, known for their potent anti-inflammatory, immunosuppressive and anti-allergic properties (Peng, H.; Wang, Y.; Jiang, K.; Chen, X.; Zhang, W.; Zhang, Y.; Deng, Z.; Qu, X., A Dual Role Reductase from Phytosterols Catabolism Enables the Efficient Production of Valuable Steroid Precursors. Angewandte Chemie (Internationaled. in English) 2021, 60 (10), 5414-5420.). Their efficacy in treating asthma, rheumatoid arthritis and a range of autoimmune diseases highlights their indispensable role in contemporary medical practice. Hydroxylation at the C21 position of the steroid side chain is an essential step in the biosynthesis of endogenous corticosteroids, including aldosterone, hydrocortisone, and cortisone. Inborn errors of the steroid 21-hydroxylase CYP21A2 are associated with a variety of endocrine disorders. Notably, C21 hydroxylation is a key step in the synthesis of dozens of corticosteroid-based drugs.

[0003] In the field of steroid chemistry, the introduction of C21 hydroxyl is usually completed by a series of chemical reactions. The process first uses elemental iodine to iodinate C21, then uses potassium acetate for nucleophilic substitution to form an acetate intermediate, and finally hydrolyzes under alkaline conditions to obtain the final product (Herráiz, I., Chemical Pathways of Corticosteroids, Industrial Synthesis from Sapogenins. Methods in molecular biology (Clifton, NJ) 2017, 1645, 15-27.). In the industrial production process that mainly combines microbial biotransformation with chemical semi-synthesis, C21 hydroxylation still requires preliminary iodination and esterification. Subsequently, Absidia orchidis was used to introduce the C11β-OH group (Chen, J.; Fan, F.; Qu, G.; Tang, J.; Xi, Y.; Bi, C.; Sun, Z.; Zhang, X., Identification of Absidia orchidis steroid 11β-hydroxylation system and its application in engineering Saccharomyces cerevisiae for one-step biotransformation to produce hydrocortisone. Metabolic engineering 2020, 57, 31-42.). The toxicity and relatively high cost of elemental iodine have become limitations of this process, and a more environmentally friendly and convenient method needs to be developed.

[0004] At present, the production mode of steroids has undergone profound changes due to the successful application of enzyme-catalyzed reactions and microbial transformations in the industrial production of steroids. The currently characterized CYP21A enzymes are relatively limited, and most of them are from mammals such as humans, guinea pigs and cattle. In the microbial cell factory engineering of steroid C21 hydroxylation, these mammal-derived CYP21 enzymes are widely used. However, the expression of these animal native enzymes in microbial systems often fails to achieve the high catalytic efficiency required for industrial-scale applications. In recent years, significant progress in the field of directed enzyme evolution has prompted researchers to optimize microbial-derived CYP450 enzymes to develop more efficient C21 hydroxylases. Despite this, almost all existing C21 hydroxylases catalyze progesterone and convert 17-OH progesterone as a substrate. In the existing production process of corticosteroid drugs, in order to avoid side reactions caused by the highly reactive C21-hydroxyl group, the 21-hydroxylation step is usually placed at the end of the process. Therefore, the availability of existing C21 hydroxylases that process various industrial C21 steroid intermediates as substrates is still significantly insufficient. Summary of the invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a catalyst for catalyzing the bioconversion of steroid compounds into steroid drugs and a preparation method thereof, so as to solve the problem of low efficiency and few substrate types of C21 hydroxylase-catalyzed steroid C21-hydroxylation reaction in the prior art.

[0006] To achieve the above-mentioned object and other related objects, the present invention provides a steroid C21-hydroxylase CsCYP21A derived from Bufo bufogargarizans Cantor, wherein the C21-hydroxylase CsCYP21A is a protein as shown in any one of the following (A1)-(A4):

[0007] (A1) the amino acid sequence is shown in SEQ ID NO:7;

[0008] (A2) a protein having the same function as the amino acid sequence defined in (A1) by substitution and / or deletion and / or addition of one or more amino acid residues;

[0009] (A3) a protein having an amino acid sequence homology of more than 80% with that of (A1) or (A2) and having the same function;

[0010] (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

[0011] Furthermore, the present invention provides a catalyst composition, wherein the catalyst contains the C21-hydroxylase CsCYP21A and the cytochrome P450 reductase CPR as described above.CS , the cytochrome P450 reductase CPR CS A protein as shown in any one of (B1)-(B4) below:

[0012] (B1) a protein with an amino acid sequence as shown in SEQ ID NO.8;

[0013] (B2) a protein having the same function as the amino acid sequence defined in (B1) after one or more amino acid residues are substituted and / or deleted and / or added;

[0014] (B3) a protein having an amino acid sequence homology of more than 80% with that of (B1) or (B2) and having the same function;

[0015] (B4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (B1) to (B3).

[0016] Another aspect of the present invention provides a gene fragment encoding the steroid C21-hydroxylase CsCYP21A as described above. Further, the nucleotide sequence of the gene fragment is shown in SEQ ID NO:5.

[0017] Another aspect of the present invention provides a recombinant plasmid, wherein the recombinant plasmid contains a) the gene fragment as shown above, or b) the gene fragment as shown above and a gene encoding cytochrome P450 reductase CPR CS Preferably, the recombinant plasmid is obtained by transformation of pPICZA.

[0018] Furthermore, the encoding cytochrome P450 reductase CPR CS The nucleotide sequence of the gene fragment is shown in SEQ ID NO:6.

[0019] Another aspect of the present invention provides a bioengineering bacterium, wherein the bioengineering bacterium contains or integrates the above-mentioned recombinant plasmid. Preferably, the bioengineering bacterium is yeast, and the yeast strain includes but is not limited to Pichia pastoris.

[0020] Another aspect of the present invention provides a method for preparing the above-mentioned bioengineering bacteria, which is obtained by electroporating the above-mentioned recombinant plasmid into Pichia pastoris. Specifically, the method comprises the following steps:

[0021] S1. Using yeast expression vector pPICZA as template, construct yeast dual-purpose gene co-expression vector pPICZA-Duet;

[0022] S2. The steroid C21 hydroxylase CsCYP21A and cytochrome P450 reductase CPRCS genes from Bufo bufo gargarizans were inserted into pPICZA-Duet to obtain the recombinant expression vector pPICZA-Duet-CsCYP21A-CPRCS;

[0023] S3. The recombinant expression vector is electroporated into Pichia pastoris, and positive recombinant Pichia pastoris engineered bacteria are obtained through screening.

[0024] The multifunctional steroid hydroxylase of the present invention includes but is not limited to being expressed in host cells such as Pichia pastoris.

[0025] Preferably, the Pichia pastoris strain in step S3 includes but is not limited to KM71H.

[0026] The present invention also provides the use of the above-mentioned recombinant Pichia pastoris in the preparation of hydroxylated steroids, comprising the following steps:

[0027] (1) inoculating the recombinant Pichia pastoris engineered bacteria transformant into a seed culture medium YPD liquid culture medium, and shaking and culturing at 30° C. and 260 rpm for 24 hours to obtain a primary seed solution;

[0028] (2) The first-level seed solution was inoculated into the seed culture medium YPD liquid medium at a transfer rate of 2.5%, and cultured at 30° C. and 260 rpm with shaking until the OD600 value was 6-7 to obtain the second-level seed solution.

[0029] (3) The secondary seed liquid was transferred to the glycerol medium MGYH medium at a transfer volume of 10% for fermentation at 30° C. and 260 rpm for 24 h.

[0030] (4) The fermentation broth in (3) was centrifuged, and the bacteria were resuspended in methanol culture medium (MMH medium). The substrate steroid compound was dissolved in 1% methanol and added to the bacterial solution. The culture was shaken at 30°C and 260 rpm. 0.5% methanol was added every 24 hours. The transformation was carried out for 3 days to obtain steroid hydroxylation products.

[0031] Another aspect of the present invention provides the use of the above-mentioned C21-hydroxylase CsCYP21A, catalyst composition, gene fragment, plasmid or bioengineering bacteria for catalyzing steroid compounds to produce hydroxylated steroids.

[0032] Furthermore, the steroid compound is a compound having the following structural formula:

[0033]

[0034] Among them, R 1 -H or -CH 3 ; R 2 -H or -F; R3 is -H, -OH or keto; R 4 -H or -CH 3 ; R 5 It is -OH, keto, alkyl, substituted alkyl, or oxomethyl.

[0035] Furthermore, steroidal compounds are steroidal compounds whose backbone A, B, C and D rings are modified by other means.

[0036] Furthermore, the substituents of the steroidal compound may be substituted by other groups besides the six-membered diene lactone ring, alkyl group and substituted alkyl group, and also include the steroidal skeleton A, B, C and D rings being modified by other groups at the same time.

[0037] Furthermore, the steroid compound generating the hydroxylated steroid is specifically any one of the following:

[0038] c) catalyzing the C21-hydroxylation of steroidal compounds to generate corresponding C21-hydroxylated products;

[0039] The steroid compound is any one of the following: progesterone, 17α-hydroxyprogesterone, 11β-hydroxyprogesterone, 11β,17α-dihydroxyprogesterone, 17α-hydroxypregnane-4-ene-3,11,20-trione, 17α-hydroxyprogesterone-1,4-diene-3,11,20-trione, diprotone, 11β,17α-dihydroxy-6-methylpregnane-1,4-diene-3,20-dione, 17α-hydroxypregnane-4,9(11)-diene-3,20-dione, polybetasol, 21-dehydrodexamethasone, 16-dehydroprogesterone, 1,4-pregnanediene-3,20-dione, 11α,17α-dihydroxyprogesterone;

[0040] b) catalyzing the bioconversion of steroid compound 1 into compound 1a, 1b or 1c; or the bioconversion of compound 2 into compound 2a, 2b or 2c,

[0041]

[0042] c) Catalyze the biotransformation of the steroidal compound bufaline to generate 5β-hydroxybufaline

[0043]

[0044] In the above catalytic reaction, steroid compound 1 is catalyzed to produce 1a, 1b and 1c, of which 1b (21-hydroxyprogesterone) is the main product and 1a and 1c are by-products. Steroid compound 2 is catalyzed to produce 2a, 2b and 2c, of which 2b (17α-, 21-dihydroxyprogesterone) is the main product and 2a and 2c are by-products.

[0045] As described above, the catalyst for catalyzing the bioconversion of steroid compounds into steroid drugs and the preparation method thereof of the present invention have the following beneficial effects:

[0046] The present invention provides a steroid C21 hydroxylase CsCYP21A and a cytochrome P450 reductase CPRCS, and constructs a recombinant expression vector. Pichia pastoris KM71H is used as an expression host to achieve heterologous expression of the steroid C21 hydroxylase CsCYP21A, and successfully achieves efficient conversion of C21-hydroxylation of a variety of different steroid compounds, laying a foundation for further industrial application of steroid compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 a is the gel electrophoresis of PCR products of steroid C21 hydroxylase CsCYP21A and cytochrome P450 reductase CPRCS, b is the Western Blot map of steroid C21 hydroxylase CsCYP21A and cytochrome P450 reductase CPRCS, c is the gel electrophoresis of PCR products of steroid C21 hydroxylase CsCYP21A, d is the Western Blot map of steroid C21 hydroxylase CsCYP21A;

[0048] Figure 2 a is the map of the recombinant plasmid pPICZA-Duet-CsCYP21A-CPRCS, and b is the map of the recombinant plasmid pPICZA-Duet-CsCYP21A;

[0049] Figure 3 Where a is the structure of the substrate, and b is the structure of the product;

[0050] Figure 4 HPLC chart of 15 steroid compounds converted by pPICZA-Duet-CsCYP21A-CPRCS;

[0051] Figure 5 HPLC chart of 15 steroid compounds converted by pPICZA-Duet-CsCYP21A. DETAILED DESCRIPTION

[0052] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0053] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0054] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0055] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0056] The culture medium formula involved in the embodiment is as follows:

[0057] LB liquid medium: 5g yeast powder, 10g tryptone, 10g sodium chloride, ddH 2 O dissolved to 1L, sterilized at 121℃ for 20min.

[0058] YPD liquid medium: 10 g yeast powder, 20 g tryptone, 20 g glucose, ddH 2 Dissolve in 1 L of 0.5% O and sterilize at 115°C for 30 min.

[0059] MGY medium: 100 mL 10x Yeast Nitrogen Base (YNB), 20 mL 50x Glycerol, 2 mL 500x Biotin, ddH 2 O to make up to 1 L.

[0060] MMH medium: 100 mL 10x yeast nitrogen base (YNB), 5 mL 100x methanol, 2 mL 500x biotin, ddH 2 O to make up to 1 L.

[0061] 10x Yeast Nitrogen Base (YNB) recipe: 34 g YNB without amino acids or ammonium sulfate, 100 g ammonium sulfate, ddH 2Dissolve in 1 L of 0.5% O and sterilize at 115°C for 20 min.

[0062] 500x Biotin Formula: 50 mg Biotin, ddH 2 O dissolved to 250 mL, sterilized at 115°C for 30 min.

[0063] The present invention involves strains: Pichia pastoris KM71H and Escherichia coli DH5α.

[0064] Example 1: Construction of recombinant expression vectors pPICZA-Duet-CsCYP21A-CPRCS and pPICZA-Duet-CsCYP21A

[0065] Construction of yeast dual-purpose gene co-expression vector pPICZA-Duet: Using pPICZA (purchased from GenScript) as a template, GACCTTCGTTTGTGCGGCGGCCGCGATCTAACATCCAAAGACGAAAG (SEQ ID NO: 1) and TTAACACTAGTCATATGGGATCCATGGTGATGGTGATGATGACCCATGG (SEQ ID NO: 2) were used as primers to clone DNA fragment Fragment-1; ATATGACTAGTGTTAACCTGCAGTGAGTTTTAGCCTTAGACATGAC (SEQ ID NO: 3) and GCTATGGTGTGTGGGGGGTCTCACTTAATCTTCTGTAC (SEQ ID NO: 4) were used as primers to clone DNA fragment Fragment-2, pPICZA was digested with BamH I, and finally the dual-purpose gene co-expression vector pPICZA-Duet was recombined with the recombinase of Novazonics.

[0066] GenScript synthesized the recombinant expression vector pPICZA-Duet CsCYP21A-CPR CS ,refer to Figure 2 The recombinant expression vector contains the steroid C21 hydroxylase CsCYP21A gene (nucleotide sequence SEQ ID NO: 5) and cytochrome P450 reductase CPR from Bufo bufo gargarizans Cantor after Pichia pastoris preferred codon optimization. CS (Nucleotide sequence SEQ ID NO: 6) gene.

[0067] The recombinant expression vector pPICZA-Duet-CsCYP21A-CPR was synthesized by GenScriptCS As a template, CGACGGGCCCGGTACCATGGTTCCATTGTTGTTGTTG (SEQ ID NO: 9) and GGCTAAAACTCACTCGAGTTAAGAAGTTTCggaAGAGAT (SEQ ID NO: 10) were used as primers to clone the DNA fragment CsCYP21A. pPICZA-Duet was digested with KpnI and XhoI, and the recombinase of Novazonics was used to reconstruct the vector pPICZA-Duet-CsCYP21A. Figure 2 The recombinant expression vector contains the steroid C21 hydroxylase CsCYP21A gene from the Chinese toad Bufo bufo gargarizans Cantor (nucleotide sequence SEQ ID NO: 5) after Pichia pastoris-preferred codon optimization.

[0068] SEQ ID NO:5

[0069]

[0070]

[0071] SEQ ID NO:6

[0072]

[0073]

[0074] SEQ ID NO:7

[0075] Met Val Pro Leu Leu Leu Leu Ser Ile Leu Leu Leu Leu Phe Leu TyrVal Gly Arg Ser His Thr Lys Cys Arg Leu Ser Gly Leu Gly Gln Asn Gln His ProPro Arg Pro Thr Pro Leu Pro Phe Leu Gly Asn Leu Leu Asp Leu Gly Arg Ser AspLeu Pro Cys His Phe Met Arg Leu Ala Gln Lys Tyr Gly Pro Val Tyr Arg Leu SerLeu Trp Gly Gln Asp Ile Val Leu Asn Ala Ala Leu Ile Arg Glu Ala LeuIle Lys Lys Trp Ala Asp Phe Ala Gly Arg Pro Arg Ser Tyr Val Gly Asp Leu IleSer Leu Gly Gly Lys Asp Leu Ser Leu Gly Asp Tyr Thr Pro Val Trp Lys Val GlnArg Arg Leu Thr His Ser Ser Leu Gln Lys Arg Val Arg Arg Gly Leu Glu Thr MetLeu Ala Thr Glu Ala Arg Glu Leu Cys Gln Asp Phe Met Asn Arg Asn Gly Asp ProIle Asp Val Ala Glu Glu Phe Ser Arg Arg Thr Cys Lys Val Ile Ala Glu Leu ThrPhe Gly Thr Ser Tyr Glu Leu Ser Asp Pro Thr Phe Gln Asp Ile His Arg Cys IleVal Asn Ile Val Lys Leu Phe Glu Ala Pro Ala Val Asn Ile Leu Asp Phe Ile ProPhe Leu Arg Lys Phe Pro Asn Lys Ser Leu Thr Arg Leu Leu Lys Ala Ala Asp ArgArg Asp Asn Phe Val Arg Lys GlnLeu Glu Arg His Lys Val His Leu Pro Glu AspGlu Ser Gln Glu Asp Ile Leu His Glu Met Ile Arg Phe Leu Lys Glu Asn Thr LysVal Glu Gly Gly Asp Ala Ala Asp Leu Thr Glu His Leu His Met Ala Val ValAsp Leu Phe Ile Gly Thr Glu Thr Thr Ala Ser Val Leu Thr Trp Thr Val AlaPhe Leu Ile His Pro Glu Ala Gln Glu Lys Ile His Lys Glu Ile Ile Ser ValVal Gly Asp Arg Tyr Pro Thr Tyr Ser Asp Arg Thr Arg Met Pro Tyr Leu AsnAla Thr Ile Thr Glu Met Leu Arg Leu Arg Pro Val Val Pro Ile Ala Val Pro HisSer Ala Thr Arg Asp Thr Ser Ile Ala Gly Phe Val Ile Pro Lys Gly Ala Thr ValIle Pro Asn Ile Tyr Ala Ala His His Asp Glu Thr Val Trp Glu Asn Pro Glu GlnPhe Cys Pro Glu Arg Phe Leu Thr Ser Pro Glu Gly Asn Val Ser Ser Arg Ser LeuLeu Thr Phe Ser Met Gly Ala Arg Leu Cys Ile Gly Glu Ala Met Ala Arg Met GluIle Phe Phe Phe Leu Ser His Leu Leu Arg Asp Phe Val Phe Ser Pro Leu Ser ProThr Leu Leu Pro Asp Leu Gln Gly Ile Phe Gly Ile Asn Leu Lys Cys His Pro PheLeu Ile Arg Ser Leu Pro Arg Glu Val Pro Ala Ile Ser SerGlu Thr Ser

[0076] SEQ ID NO:8

[0077] Met Gly His His His His His His Gly Ser Met Ala Asp Ser Cys Val AsnGln Asp Glu Cys His Thr Glu Glu Gly Ser Ser Val Ala Glu Glu Ala Met Phe SerMet Ala Asp Met Phe Leu Leu Ser Leu Ile Val Gly Leu Leu Thr Tyr Trp Phe PhePhe Arg Lys Lys Lys Glu Glu Thr Ile Glu Phe Lys Val Gln Thr Pro Val Ala SerSer Ser Ser Arg Glu Ser Ser Phe Val Glu Lys Met Lys Lys Thr Gly Lys Asn IleVal Val Phe Tyr Gly Ser Gln Thr Gly Thr Gly Glu Glu Phe Ala Asn Arg Leu AlaLys Asp Ala His Arg Tyr Gly Met Arg Gly Met Ser Ala Asp Pro Glu Glu Phe GluMet Val Asp Leu Gly Arg Leu Lys Asp Ile Glu Asn Ser Leu Ala Val Phe Cys MetAla Thr Tyr Gly Glu Gly Asp Pro Thr Asp Asn Ala Gln Asp Phe Tyr Asp Trp LeuGln Glu Ala Asp Val Asp Leu Ser Gly Leu Lys Phe Ala Val Phe Gly Leu Gly AsnLys Thr Tyr Glu His Phe Asn Ala Met Gly Lys Tyr Leu Asp Lys Arg Leu Glu GluLeu Gly Ala Glu Arg Ile Phe Glu Leu Gly Met Gly Asp Asp Asp Gly Asn Leu GluGlu Asp Phe Ile Thr Trp Arg Glu Gln Phe Trp Pro Ala Val Cys Glu His Phe GlyVal Glu Ala Thr Gly Asp Glu SerSer Ile Arg Gln Tyr Glu Leu Val Val Phe ThrAsp Glu Asn Met Asn Lys Val Tyr Thr Gly Glu Met Gly Arg Leu Lys Ser Tyr GluIle Gln Lys Pro Pro Phe Asp Ala Lys Asn Pro Phe Leu Ser Asn Val Thr Ala AsnArg Lys Leu Asn Glu Gly Gly Glu Arg His Leu Met His Leu Glu Leu Asp Ile ThrGly Ser Lys Ile Arg Tyr Glu Ser Gly Asp His Val Ala Val Tyr Pro Ala Asn GluSer Ser Ile Val Asn Lys Leu Gly Glu Leu Leu Gly Val Asp Leu Asp Thr Val IleSer Leu Asn Asn Leu Asp Glu Glu Ser Asn Lys Lys His Pro Phe Pro Cys Pro ThrSer Tyr Arg Thr Ala Leu Thr Tyr Tyr Leu Asp Ile Thr Asn Pro Pro Arg Thr AsnVal Leu Tyr Glu Leu Ala Gln Tyr Ala Thr Asp Pro Lys Glu Gln Glu Asn Leu ArgLys Met Ala Ser Ser Ser Ser Asp Gly Lys Ala Leu Tyr Leu Asn Trp Val Leu GluAla Arg Arg Asn Ile Leu Ala Ile Leu Glu Asp Met Pro Ser Leu Arg Pro Pro LeuAsp His Leu Cys Glu Leu Leu Pro Arg Leu Gln Ala Arg Tyr Tyr Ser Ile Ala SerSer Ser Lys Val His Ser Asn Ser Ile His Ile Cys Ala Val Val Val Glu Tyr GluThr Lys Thr Gly Arg Phe Asn Lys Gly Val Thr Thr Asn TrpLeu Arg Asn Lys GlnPro Thr Asp Asn Gly His Lys Ser Ser Val Pro Met Tyr Val Arg Lys Ser Gln PheArg Leu Pro Phe Lys Pro Thr Thr Pro Val Ile Met Ile Gly Pro Gly Thr Gly IleAla Pro Phe Val Gly Phe Ile Gln Glu Arg Glu Trp Leu Lys Gln Gln Gly Lys GluVal Gly Glu Thr Val Leu Tyr Tyr Gly Cys Arg His Glu His Glu Asp Tyr Leu TyrLys Glu Glu Leu Ala Lys Phe His Lys Asp Gly Val Leu Thr Gln Leu His Val AlaPhe Ser Arg Asp Gln Lys Glu Lys Val Tyr Val Gln His Leu Leu Lys Lys Asn LysGlu Asn Ile Trp Lys Leu Ile Asn Glu Glu Asn Gly His Ile Tyr Val Cys Gly AspAla Arg Asn Met Ala Arg Asp Val His Asn Thr Phe Tyr Asp Ile Val Glu Glu TyrGly Lys Met Asp His Ser Gln Ala Val Asp Tyr Ile Lys Lys Leu Met Thr Lys GlyArg Tyr Ser Gln Asp Val Trp Ser

[0078] Example 2: Construction of multifunctional steroid hydroxylase recombinant yeast engineering bacteria

[0079] Construction of single-purpose gene engineered yeast

[0080] (1) Amplification of the recombinant expression vector pPICZA-Duet-CsCYP21A: The recombinant expression vector pPICZA-Duet-CsCYP21A was introduced into Escherichia coli DH5α according to the conventional heat shock transformation method, and the plasmid was subsequently extracted using the OMEGA plasmid extraction kit.

[0081] (2) Preparation of Pichia pastoris KM71H competent cells: Take out the Pichia pastoris KM71H glycerol stock stored at -80°C, streak it on a YPD plate without antibiotics, invert the plate at 30°C, and incubate it for 3 days to grow colonies; pick a single clone from the plate and inoculate it into 5 mL of YPD liquid medium without antibiotics, and incubate it at 30°C and 260 rpm for 24 hours; transfer 2 mL of the culture to 100 mL of YPD liquid medium without antibiotics, and incubate it at 30°C and 260 rpm until the OD reaches 0. 600 The value is 1.3-1.5; transfer 100mL of bacterial solution to a 50mL sterile centrifuge tube in the clean bench and precool on ice for 5 minutes; at the same time, add sterile ddH 2 O and sterile 1M sorbitol were placed on ice for precooling respectively; the precooled bacterial solution was centrifuged at 1500g at 4°C for 5 min, and the supernatant was discarded in a clean bench; 50mL precooled sterile ddHO 2 Resuspend the cells in 50 mL of ddHO (gently pipette with a 5 mL pipette), centrifuge at 1500 g, 4 °C for 5 min, and discard the supernatant in a clean bench; 2 Resuspend the cells in 10 mL of precooled sterile 1 M sorbitol (gently pipetted with a 5 mL pipette), centrifuge at 1500 g, 4 ° C for 5 min, and discard the supernatant in a clean bench; resuspend the cells in 0.4 mL of precooled sterile 1 M Sorbitol (gently pipetted with a 5 mL pipette), aliquot into 400 μL / tube, and store at -80 ° C.

[0082] (3) Electroporation of the recombinant expression vector into Pichia pastoris KM71H competent cells: 40 μL of the recombinant expression vector pPICZA-Duet-CsCYP21A (>300 ng / μL) was introduced into 400 μL of Pichia pastoris KM71H competent cells by conventional electroporation (2000 V, 5 ms), and cultured at 30°C for 3-5 days to obtain recombinant yeast engineering bacteria expressing steroid C21-hydroxylase.

[0083] Construction of dual-purpose genetic engineering yeast

[0084] (1) Recombinant expression vector pPICZA-Duet-CsCYP21A-CPR CS Amplification: The recombinant expression vector pPICZA-Duet-CsCYP21A-CPR CS The plasmid was introduced into Escherichia coli DH5α according to the conventional heat shock transformation method, and then the plasmid was extracted using the OMEGA plasmid extraction kit.

[0085] (2) Preparation of Pichia pastoris KM71H competent cells: Take out the Pichia pastoris KM71H glycerol stock stored at -80°C, streak it on a YPD plate without antibiotics, invert the plate at 30°C, and culture it for 4 days to grow colonies; pick a single clone from the plate and inoculate it into 5 mL of YPD liquid medium without antibiotics, and culture it at 30°C, 260 rpm for 24 hours; transfer 2 mL of the culture to 100 mL of YPD liquid medium without antibiotics, and culture it at 30°C, 260 rpm until the OD reaches 0. 600 The value is 1.3-1.5; transfer 100mL of bacterial solution to a 50mL sterile centrifuge tube in the clean bench and precool on ice for 5 minutes; at the same time, add sterile ddH 2 O and sterile 1M sorbitol were placed on ice for precooling respectively; the precooled bacterial solution was centrifuged at 1500g at 4°C for 5 min, and the supernatant was discarded in a clean bench; 50mL precooled sterile ddHO 2 Resuspend the cells in 50 mL of ddHO (gently pipette with a 5 mL pipette), centrifuge at 1500 g, 4 °C for 5 min, and discard the supernatant in a clean bench; 2 Resuspend the cells in 10 mL of precooled sterile 1 M sorbitol (gently pipetted with a 5 mL pipette), centrifuge at 1500 g, 4 ° C for 5 min, and discard the supernatant in a clean bench; resuspend the cells in 0.4 mL of precooled sterile 1 M Sorbitol (gently pipetted with a 5 mL pipette), aliquot into 400 μL / tube, and store at -80 ° C.

[0086] (3) Electrotransformation of the recombinant expression vector into Pichia pastoris KM71H competent cells: 40 μL of the recombinant expression vector pPICZA-Duet-CSCYP21A-CPR CS (>300ng / μL) was introduced into 400μL Pichia pastoris KM71H competent cells according to conventional electroporation method (2000V, 5ms), and cultured at 30°C for 3-5 days to obtain recombinant yeast engineering bacteria expressing steroid C21-hydroxylase.

[0087] Example 3: Screening experiment of positive clones of steroid C21 hydroxylase recombinant yeast engineering bacteria

[0088] Screening of single-target gene engineering yeast

[0089] Pick 10 yeast engineering strains and place them in 5 mL YPD liquid medium (containing 100 μg / mL Zeocin), culture at 30°C, 260 rpm for 24 h. Transfer 0.5 mL of the culture to 5 mL MGYH glycerol medium, culture at 30°C, 260 rpm for 24 h. Centrifuge at 4°C, 2500 g for 10 min, remove the supernatant, resuspend in 5 mL MMH methanol medium in a clean bench, culture at 30°C, 260 rpm, add 0.5% methanol every 24 h, and culture for 3 days.

[0090] Verify whether the target gene is integrated into the chromosome of yeast cells: Take 20 μL of the above-mentioned induced culture solution for 3 days in a 1.5 mL EP tube, add 100 μL Lysis Buffer for PCR (purchased from Acre Biotech) and 1 μL Proteinase K (purchased from Acre Biotech), mix well, react at 60°C for 5 minutes, then react at 98°C for 2 minutes, place on ice, centrifuge, take the supernatant and place on ice or at 4°C for later use. Take 1-4 μL of the supernatant as a template and use CsCYP21A-F / R:CCATGGTTCCATTGTTGTTGTTGTCTATC (SEQ ID NO: 11) / GAAGTTTCggaAGAGATAGCTGGAACTTCTC (SEQ ID NO: 12) (primers synthesized by Sangon Biotech (Shanghai)) as primers for PCR amplification to verify whether the target gene CsCYP21A is integrated into the chromosome of yeast cells (see Figure 1 ).

[0091] Verify whether the target protein is expressed and screen high-expressing positive clones: take 1mL of the above-mentioned induced culture for 3 days in a 2mL EP tube, centrifuge at 10000rpm for 5min, discard the supernatant, freeze quickly in liquid nitrogen, add 0.5mm diameter matching glass beads for grinding, break the bacteria with a grinder (specific grinding parameters are 60Hz, 1min×2 times), add 1mL lysis buffer (50mMTris-HCl, 200mM NaCl or KCl, pH 8.0) to dissolve, centrifuge at 10000rpm at 4℃ for 10min, take 50μL supernatant, add 50μL SDS loading buffer for sample preparation, and identify whether the target protein is expressed by Western Blot (see Figure 1 ).

[0092] Screening of dual-purpose genetic engineering yeast

[0093] Pick 10 yeast engineering strains and place them in 5mL YPD liquid medium (containing 100μg / mL Zeocin), culture at 30℃, 260rpm for 24h. Transfer 0.5mL of the culture to 5mL MGY glycerol medium, culture at 30℃, 260rpm for 24h. Centrifuge at 4℃, 2500g for 10min, remove the supernatant, resuspend in 5mL MMH methanol medium in a clean bench, culture at 30℃, 260rpm, add 0.5% methanol every 24h, and culture for 3 days.

[0094] Verify whether the target gene is integrated into the yeast cell chromosome: take 20 μL of the above-mentioned induced culture for 3 days into a 1.5 mL EP tube, add 100 μL Lysis Buffer for PCR (purchased from Acre Bio) and 1 μL Proteinase K (purchased from Acre Bio), mix well, react at 60°C for 5 min, then at 98°C for 2 min, place on ice, centrifuge, take the supernatant and place on ice or at 4°C for later use. 1-4 μL of supernatant was used as a template, and PCR amplification was performed using CsCYP21A-F / R: CCATGGTTCCATTGTTGTTGTTGTCTATC (SEQ ID NO: 9) / GAAGTTTCggaAGAGATAGCTGGAACTTCTC (SEQ ID NO: 10) and CPRCS-F / R: GGATCCATGGCTGATTCTTGTGTTAACC (SEQ ID NO: 11) / CACTAGTTTAACTCCAAACATCTTGAGAG (SEQ ID NO: 12) (primers were synthesized by Shenggong Biotechnology (Shanghai)) as primers to verify the target genes CsCYP21A and CPR CS Whether it is integrated into the yeast cell chromosome (see Figure 1 ).

[0095] Verify whether the target protein is expressed and screen high-expressing positive clones: take 1mL of the above-mentioned induced culture for 3 days in a 2mL EP tube, centrifuge at 10000rpm for 5min, discard the supernatant, freeze quickly in liquid nitrogen, add 0.5mm diameter matching glass beads for grinding, break the bacteria with a grinder (specific grinding parameters are 60Hz, 1min×2 times), add 1mL lysis buffer (50mMTris-HCl, 200mM NaCl or KCl, pH 8.0) to dissolve, centrifuge at 10000rpm, 4℃ for 10min, take 50μL supernatant, add 50μL SDS loading buffer for sample preparation, and identify whether the target protein is expressed by Western Blot (see Figure 1 ).

[0096] Example 4: Experiment on the cell transformation of progesterone by recombinant Pichia pastoris with steroid C21 hydroxylase

[0097] The positive clones screened in Example 3 were streaked on a YPD plate (containing 100 μg / mL Zeocin) and cultured at 30°C for 3 days. The transformants were selected and cultured in 5 mL YPD liquid medium (containing 100 μg / mL Zeocin) at 30°C, 260 rpm, and cultured for 24 h to obtain a primary seed solution. The 5 mL primary seed solution was transferred to 200 mL YPD liquid medium and cultured at 30°C, 260 rpm until OD 600 The value is 6-7, and the secondary seed liquid is obtained. The secondary seed liquid is transferred to 1LMGYH glycerol medium at a transfer volume of 10%, and cultured at 30℃, 260rpm for 24h. Centrifuge at 4℃, 2500g for 15min, discard the supernatant, resuspend the bacteria in 1L MMH methanol medium in a clean bench, add steroid compound progesterone (dissolved in 1% methanol, final concentration is 100mg / L), 30℃, 260rpm, add 0.5% methanol every 24h, transform for 3 days, take 500μL of bacterial solution and extract twice with equal volume of ethyl acetate, blow with nitrogen, re-dissolve with 500μL methanol, mix well and centrifuge at 10000rpm for 10min, take the supernatant to prepare liquid samples, and use Shimadzu 8040 for LCMS detection.

[0098] The test results of yeast engineered bacteria with dual target genes are as follows: Figure 4 When the steroidal substrate is progesterone (1), 21-hydroxyprogesterone (1b), 20α-hydroxy-3-oxo-4-pregnene-21-acid (1a), and 4-androsten-3-one-5-ene-17-carboxylic acid (1c) are generated. The HPLC spectrum is shown in Figure 4 The conversion rate and yield are shown in Table 5.

[0099] Detection results of yeast engineered bacteria with a single target gene added Figure 5 When the steroidal substrate is progesterone (1), 21-hydroxyprogesterone (1b), 20α-hydroxy-3-oxo-4-pregnene-21-acid (1a), and 4-androsten-3-one-5-ene-17-carboxylic acid (1c) are generated. The HPLC spectrum is shown in Figure 5 The conversion rate and yield are shown in Table 7.

[0100] The liquid phase conditions were as follows: 0-3 min, 30% B; 20-25 min, 100% B; 26 min-30 min, 30% B (mobile phase A: water + 0.1% formic acid, mobile phase B: acetonitrile + 0.1% formic acid); column temperature 40°C; flow rate: 1.0 mL / min; detection wavelength: 254 nm.

[0101] Example 5: Cellular transformation experiment of 17α-hydroxyprogesterone by recombinant Pichia pastoris engineered bacteria expressing steroid C21 hydroxylase

[0102] The experimental steps were the same as those in Example 4. The cells were resuspended in 1 L MMH methanol medium, and the steroid substrate 17α-hydroxyprogesterone (dissolved in 1% methanol, with a final concentration of 100 mg / L) was added. The culture was incubated at 30° C. and 260 rpm, with 0.5% methanol added every 24 h. The culture was transformed for 3 days. 500 μL of the bacterial solution was extracted twice with an equal volume of ethyl acetate, blown with nitrogen, and re-dissolved with 500 μL of methanol. After mixing evenly, the mixture was centrifuged at 10,000 rpm for 10 min. The supernatant was prepared for liquid samples, which were detected by LCMS using Shimadzu 8040.

[0103] The test results of yeast engineered bacteria with binocular genes are as follows: Figure 4 When the steroidal substrate is 17α-hydroxyprogesterone (2), 17α-,21-dihydroxyprogesterone (2a), 16β-hydroxyandrostenedione (2b) and 17α-hydroxy-3-oxoandrost-4-ene-17carboxylic acid (2c) are generated. The HPLC spectrum is shown in Figure 4 The conversion rate and yield are shown in Table 6.

[0104] The test results of yeast engineered bacteria with a single target gene added are as follows: Figure 5 When the steroidal substrate is 17α-hydroxyprogesterone (2), 17α-, 21-dihydroxyprogesterone (2a), 16β-hydroxyandrostenedione (2b) and 17α-hydroxy-3-oxoandrost-4-ene-17 carboxylic acid (2c) are generated. The HPLC spectrum is shown in Figure 5 The conversion rate and yield are shown in Table 8.

[0105] Example 6: Cell transformation experiment of 16-dehydroprogesterone by recombinant Pichia pastoris with steroid C21 hydroxylase

[0106] The experimental steps were the same as those in Example 4. The cells were resuspended in 1 L MMH methanol medium, and the steroid substrate 16-dehydroprogesterone (dissolved in 1% methanol, with a final concentration of 100 mg / L) was added. The culture was incubated at 30 ° C. and 260 rpm. 0.5% methanol was added every 24 h. The transformation was carried out for 3 days. 500 μL of the bacterial solution was extracted twice with an equal volume of ethyl acetate, purged with nitrogen, and re-dissolved with 500 μL of methanol. After mixing evenly, the mixture was centrifuged at 10000 rpm for 10 min. The supernatant was prepared for liquid samples, which were detected by LCMS using Shimadzu 8040.

[0107] The test results of yeast engineered bacteria with binocular gene added are as follows Figure 4 When the steroid substrate is 16-dehydroprogesterone (3), 21-hydroxy-16-dehydroprogesterone (3a) is generated, and the HPLC spectrum is shown in Figure 4 The conversion rate and yield are shown in Table 2.

[0108] The results of the test yeast engineering bacteria with a single target gene added are as follows Figure 5 When the steroid substrate is 16-dehydroprogesterone (3), 21-hydroxy-16-dehydroprogesterone (3a) is generated, and the HPLC spectrum is shown in Figure 5 The conversion rate and yield are shown in Table 4.

[0109] Example 7: Cellular transformation experiment of toad lactone compounds by recombinant Pichia pastoris engineered bacteria expressing steroid C21 hydroxylase

[0110] The experimental steps were the same as those in Example 4. The bacteria were resuspended in 1 L of MMH methanol medium, and toad lactone compounds (including but not limited to bufalotoxin, dissolved in 1% methanol, with a final concentration of 100 mg / L) were added. The mixture was stirred at 30 ° C and 260 rpm. 0.5% methanol was added every 24 h. The transformation was carried out for 3 days. 500 μL of the bacterial solution was extracted twice with an equal volume of ethyl acetate, blown with nitrogen, and re-dissolved in 500 μL of methanol. After mixing evenly, the mixture was centrifuged at 10000 rpm for 10 min. The supernatant was prepared for liquid samples, and LCMS detection was performed using Shimadzu 8040.

[0111] The test results of yeast engineered bacteria with binocular gene added are as follows Figure 4 When the steroidal substrate is bufalin (4), 5β-hydroxybufalin (4a) is generated, and the HPLC spectrum is shown in Figure 4 The conversion rate and yield are shown in Table 2.

[0112] The test results of the yeast engineering bacteria with a single target gene added are as follows Figure 5 When the steroidal substrate is bufalin (4), 5β-hydroxybufalin (4a) is generated, and the HPLC spectrum is shown in Figure 5 The conversion rate and yield are shown in Table 4.

[0113] Example 8: Cell transformation experiment of other steroid compounds by recombinant Pichia pastoris engineering bacteria expressing steroid C21 hydroxylase

[0114] The positive clones screened in Example 3 were streaked on a YPD plate (containing 100 μg / mL Zeocin) and cultured at 30°C for 3-5 days. The transformants were selected and cultured in 5 mL YPD liquid medium (containing 100 μg / mL Zeocin) at 30°C, 260 rpm, and cultured for 24 h to obtain a primary seed solution. The 5 mL primary seed solution was transferred to 200 mL YPD liquid medium and cultured at 30°C, 260 rpm until OD 600The value is 6-7, and the secondary seed liquid is obtained. Transfer the secondary seed liquid to 1L MGYH glycerol medium at a transfer volume of 10%, and culture at 30℃, 260rpm for 24h. Centrifuge at 4℃, 2500g for 15min, discard the supernatant, resuspend the bacteria in 1L MMH methanol medium in a clean bench, add 0.5% methanol every 24h, and induce protein expression for 60h. Centrifuge at 2500g for 15min, discard the supernatant, and resuspend the bacteria in 1L ddH 2 O resuspended the cells, added steroidal substrates (including but not limited to 11β-hydroxyprogesterone, 11β,17α-dihydroxyprogesterone, 17α-hydroxypregnane-4-ene-3,11,20-trione, 17α-hydroxyprogesterone-1,4-diene-3,11,20-trione, diprotone, 11β,17α-dihydroxy-6-methylpregnane-1,4-diene-3,20-dione, 17α-hydroxypregnane-4,9(11)-diene-3,20-dione, polybetasol, 21-dehydrodexamethasone, 1,4-pregnanediene-3,20-dione and 11α,17α-dihydroxyprogesterone, dissolved in 1% methanol, with a final concentration of 200 mg / L), 30°C, 260 rpm, and transformed for 3 days. 500 μL of bacterial solution was extracted twice with an equal volume of ethyl acetate, blown with nitrogen, re-dissolved with 500 μL of methanol, mixed evenly, and centrifuged at 10000 rpm for 10 min. The supernatant was taken to prepare the liquid sample, which was detected by LCMS using Shimadzu 8040.

[0115] The test results of yeast engineered bacteria with binocular genes are as follows: Figure 4When the steroidal substrate is 11β-hydroxyprogesterone (5), adrenaline (5a) is generated; when the steroidal substrate is 11β,17α-dihydroxyprogesterone (6), hydrocortisone (6a) is generated; when the steroidal substrate is 17α-hydroxypregnane-4-ene-3,11,20-trione (7), cortisone (7a) is generated; when the steroidal substrate is 17α-hydroxypregnane-1,4-diene-3,11,20-trione (8), prednisone (8a) is generated; when the steroidal substrate is diprolone (9), prednisolone (9a) is generated; when the steroidal substrate is 11β,17α-dihydroxy-6-methylpregnane-1,4-diene-3,20-dione (10 ), methylprednisolone (10a) is generated; when the steroidal substrate is 17α-hydroxypregnane-4,9(11)-diene-3,20-dione (11), anecortave acetate (11a) is generated; when the steroidal substrate is polybetasol (12), betamethasone (12a) is generated; when the steroidal substrate is 21-dehydrodexamethasone (13), dexamethasone (13a) is generated; when the steroidal substrate is 1,4-pregnane-3,20-dione (14), 21-hydroxypregnane-1,4-diene-3,20-dione (14a) is generated; when the steroidal substrate is 11α,17α-dihydroxyprogesterone (15), hydrocortisone (15a) is generated. HPLC spectrum is shown in Figure 4 The conversion rate and yield are shown in Table 2.

[0116] The test results of the yeast engineering bacteria with a single target gene added are as follows Figure 5When the steroidal substrate is 11β-hydroxyprogesterone (5), adrenaline (5a) is generated; when the steroidal substrate is 11β,17α-dihydroxyprogesterone (6), hydrocortisone (6a) is generated; when the steroidal substrate is 17α-hydroxypregnane-4-ene-3,11,20-trione (7), cortisone (7a) is generated; when the steroidal substrate is 17α-hydroxypregnane-1,4-diene-3,11,20-trione (8), prednisone (8a) is generated; when the steroidal substrate is diprolone (9), prednisolone (9a) is generated; when the steroidal substrate is 11β,17α-dihydroxy-6-methylpregnane-1,4-diene-3,20-dione (10 ), methylprednisolone (10a) is generated; when the steroidal substrate is 17α-hydroxypregnane-4,9(11)-diene-3,20-dione (11), anecortave acetate (11a) is generated; when the steroidal substrate is polybetasol (12), betamethasone (12a) is generated; when the steroidal substrate is 21-dehydrodexamethasone (13), dexamethasone (13a) is generated; when the steroidal substrate is 1,4-pregnane-3,20-dione (14), 21-hydroxypregnane-1,4-diene-3,20-dione (14a) is generated; when the steroidal substrate is 11α,17α-dihydroxyprogesterone (15), hydrocortisone (15a) is generated. HPLC spectrum is shown in Figure 5 The conversion rate and yield are shown in Table 4.

[0117] result:

[0118] We calculated the catalytic reaction of the above example and obtained the yield and conversion rate of the following substrates:

[0119] The calculation results of the engineered yeast with dual-purpose genes are shown in Tables 1 and 2, and the calculation results of the engineered yeast with single-purpose genes are shown in Tables 3 and 4:

[0120] Table 1 Substrate addition amount and yield

[0121]

[0122]

[0123] Note: The above is the mean value of the results of three parallel experiments.

[0124] Table 2 Conversion rate and yield

[0125]

[0126] Table 3 Substrate addition amount and yield

[0127]

[0128] Note: Calculate the mean of the results of three parallel experiments.

[0129] Table 4 Conversion rate and yield

[0130]

[0131]

[0132] At the same time, we also collected the yields of the byproducts (1a.1c) obtained when the dual-purpose genetically engineered yeast was added to catalyze progesterone in the above Examples 4 and 5, and the yields of the byproducts (2a.2c) obtained by catalyzing 17α-hydroxyprogesterone, as shown in Tables 5 and 6:

[0133] Table 5 Conversion rate of by-products produced by catalysis of progesterone

[0134]

[0135] Table 6 Conversion rate of by-products produced by catalysis of 17α-hydroxyprogesterone

[0136]

[0137] The yields of byproducts (1a.1c) obtained when progesterone is catalyzed by adding a single-purpose genetically engineered yeast, and the yields of byproducts (2a.2c) obtained by catalyzing 17α-hydroxyprogesterone are shown in Tables 7 and 8:

[0138] Table 7 Conversion rate of by-products produced by catalysis of progesterone

[0139]

[0140] Table 8 Catalytic 17α-hydroxyprogesterone to produce by-product conversion rate

[0141]

[0142]

[0143] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A steroid C21-hydroxylase CsCYP21A from Bufo bufo gargarizans, characterized in that: The steroid C21-hydroxylase CsCYP21A is a protein shown in any one of the following (A1)-(A4): (A1) the amino acid sequence is shown in SEQ ID NO:7; (A2) a protein having the same function as the amino acid sequence defined in (A1) by substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having more than 80% homology with the amino acid sequence defined in (A1) or (A2) and having the same function; (A4) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of any protein defined in (A1)-(A3).

2. A catalyst composition, characterized in that: Containing the steroid C21-hydroxylase CsCYP21A and cytochrome P450 reductase CPRCS as claimed in claim 1, wherein the cytochrome P450 reductase CPRCS is a protein shown in any one of the following (B1)-(B4): (B1) a protein with an amino acid sequence as shown in SEQ ID NO.8; (B2) a protein having the same function as the amino acid sequence defined in (B1) after one or more amino acid residues are substituted and / or deleted and / or added; (B3) a protein having an amino acid sequence homology of more than 80% with that of (B1) or (B2) and having the same function; (B4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (B1) to (B3).

3. A gene fragment, characterized in that: Encodes the steroid C21-hydroxylase CsCYP21A as described in claim 1.

4. A recombinant plasmid, characterized in that: The recombinant plasmid contains a) the gene fragment as claimed in claim 3, or b) the gene fragment as claimed in claim 3 and a gene fragment encoding cytochrome P450 reductase CPRCS.

5. A bioengineering bacterium, characterized in that: The bioengineering bacteria contains or integrates the recombinant plasmid as claimed in claim 4.

6. Use of the steroid C21-hydroxylase CsCYP21A as claimed in claim 1 or the catalyst composition as claimed in claim 2, the gene fragment as claimed in claim 3, the plasmid as claimed in claim 4, or the bioengineering bacteria as claimed in claim 5 for catalyzing steroid compounds to produce hydroxylated steroids.

7. The use according to claim 6, characterized in that The steroidal compound is a compound having the following structural formula: Among them, R1 is -H or -CH3; R2 is -H or -F; R3 is -H, -OH or keto; R4 is -H or -CH3; R5 is -OH, keto, alkyl, substituted alkyl, or oxomethyl.

8. The use according to claim 7, characterized in that: The steroid compound substrate is a steroid compound whose backbone A, B, C and D rings are modified by other means.

9. The use according to claim 8, characterized in that: The substituents of the steroidal compound exclude the six-membered diene lactone ring, the alkyl group, and the substituted alkyl group.

10. The use according to claim 6, characterized in that The steroid compound generating the hydroxylated steroid is specifically any one of the following: a) Catalyze the C21-hydroxylation of steroidal compounds to generate the corresponding C21-hydroxylated products: The steroid compound is any one of the following: progesterone, 17α-hydroxyprogesterone, 11β-hydroxyprogesterone, 11β,17α-dihydroxyprogesterone, 17α-hydroxypregnane-4-ene-3,11,20-trione, 17α-hydroxyprogesterone-1,4-diene-3,11,20-trione, diprotone, 11β,17α-dihydroxy-6-methylpregnane-1,4-diene-3,20-dione, 17α-hydroxypregnane-4,9(11)-diene-3,20-dione, polybetasol, 21-dehydrodexamethasone, 16-dehydroprogesterone, 1,4-pregnanediene-3,20-dione, 11α,17α-dihydroxyprogesterone; b) catalyzing the bioconversion of steroid compound 1 into compound 1a, 1b or 1c; or the bioconversion of compound 2 into compound 2a, 2b or 2c, c) catalyzing the biotransformation of the steroidal compound bufaline to generate 5β-hydroxybufaline, Bufalin

Images