Mulberry-derived stilbene multi-site glycosyltransferase, gene, preparation method and application
By extracting and identifying styrene multi-site glycosyltransferase from mulberry trees, the problem of unstudied glycoside biosynthesis in mulberry trees has been solved, and its efficient glycoside synthesis and bioavailability in vivo was achieved.
Patent Information
- Application Number
- CN202411888306.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-04-18
AI Technical Summary
The prior art has not yet studied the glycoside biosynthesis of styrene and moscin in mulberry trees, resulting in limited accumulation, transport and functional regulation in the body.
A styrene multi-site glycosylation transferase was extracted and identified from mulberry trees, which can catalyze the multi-site glycosylation reaction of styrene and moscin, and promote its glycoside synthesis in vivo.
This enzyme can catalyze the synthesis of multiple endogenous glycosides in mulberry trees, and has catalytic ability to phenol substrates with resorcinol structure, improving the bioavailability and function of styrene and mucinin.
Smart Images
Figure CN119842652A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and specifically relates to a mulberry-derived stilbene multi-site glycosyltransferase, a gene, a preparation method and an application. Background Art
[0002] Stilbene is a non-flavonoid polyphenol compound widely distributed in the plant kingdom. It is a phytoalexin secreted by plants when they are damaged by external pathogens. The most common stilbene in plants is resveratrol, which has magical effects in antifungal, antioxidant, anti-tumor, anti-cancer, anti-obesity, nerve protection, and cardiovascular protection.
[0003] Mulberry is an important economic crop for raising silkworms. It is also a kind of medicinal and edible plant with hypoglycemic, anti-tumor, anti-inflammatory and antioxidant effects. Mulberry is rich in phenylpropanoid metabolites, mainly including diphenylethylene, sangxin and flavonoids. Sangxin is a characteristic secondary metabolite mainly found in Moraceae plants. It has the basic structure of 2-arylbenzofuran and is a downstream product of diphenylethylene in the biogenic pathway. Studies have shown that sangxin compounds have good antibacterial, antioxidant, anti-inflammatory, anti-diabetic and phosphodiesterase inhibition activities. Although phenylpropanoid metabolites in mulberry have good biological activity, their poor water solubility seriously affects oral bioavailability.
[0004] Glycosylation modification can not only improve the solubility of compounds in water and promote absorption, but also affect characteristics such as chemical stability and subcellular localization, thereby regulating its accumulation, transport and function in the body, and playing an important role in plant growth and development and stress response. Glycosylation reactions in plants are mainly catalyzed by glycosyltransferases, and often occur in groups such as -OH, -COOH, -NH2, -SH, and carbon atoms of specific substrates. Mulberry contains a large number of phenylpropanoid glycoside compounds, such as mulberry glycoside A, mulberry glycoside C, mulberry glycoside F, etc. However, the prior art only reports several glycosyltransferases in mulberry that catalyze flavonoid substrates, and there has been no research on the biosynthesis of stilbene and stilbene glycosides. Therefore, in-depth research on mulberry glycosyltransferases is of great significance for analyzing the synthesis pathway of endogenous glycosides and the heterologous biosynthesis of stilbene glycosides. Summary of the invention
[0005] The purpose of the present invention is to solve the deficiencies in the prior art and provide a mulberry-derived stilbene multi-site glycosyltransferase, a gene, a preparation method and an application.
[0006] The specific technical solutions adopted by the present invention are as follows:
[0007] In a first aspect, the present invention provides a stilbene multi-site glycosyltransferase derived from mulberry, wherein the amino acid sequence of the stilbene multi-site glycosyltransferase has one or more of the following characteristics:
[0008] (a) having the amino acid sequence shown in SEQ ID NO.1;
[0009] (b) an amino acid sequence having the same activity formed by substituting and / or deleting and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO.1;
[0010] (c) an amino acid sequence derived from Morus Linn having an identity greater than 95% with the amino acid sequence shown in SEQ ID NO. 1 and having the same activity.
[0011] In a second aspect, the present invention provides a stilbene multi-site glycosyltransferase gene derived from mulberry, wherein the nucleotide sequence of the stilbene multi-site glycosyltransferase gene has one or more of the following characteristics:
[0012] (a) having the nucleotide sequence shown in SEQ ID NO.2;
[0013] (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1;
[0014] (c) a nucleotide sequence encoding the same glycosyltransferase activity as described in the first aspect obtained by substituting and / or deleting and / or adding one or more nucleotides to the nucleotide sequence of SEQ ID NO.2;
[0015] (d) A nucleotide sequence derived from Morus Linn having a sequence identity greater than 90% with the nucleotide sequence shown in SEQ ID NO. 2 and encoding the same stilbene multi-site glycosyltransferase activity as described in the first aspect.
[0016] In a third aspect, the present invention provides a recombinant expression vector obtained by inserting the diphenylethylene multi-site glycosyltransferase gene described in the second aspect into an expression vector.
[0017] Preferably, the expression vector is pET-28a(+) plasmid.
[0018] In a fourth aspect, the present invention provides a recombinant genetically engineered bacterium containing the recombinant expression vector described in the third aspect.
[0019] Preferably, Escherichia coli BL21 (DE3) is used as the host bacteria.
[0020] In a fifth aspect, the present invention provides a method for preparing diphenylethylene multi-site glycosyltransferase, wherein the diphenylethylene multi-site glycosyltransferase gene described in the second aspect is cloned into a recombinant expression vector, introduced into a host cell, and the recombinantly expressed diphenylethylene multi-site glycosyltransferase is obtained.
[0021] Preferably, the recombinant expression vector is an Escherichia coli expression vector, a yeast expression vector, a plant expression vector, an insect expression vector or a mammalian cell expression vector; the host cell is an Escherichia coli host cell, a yeast host cell, a plant cell, an insect cell or a mammalian cell.
[0022] In a sixth aspect, the present invention provides an application of a distilbene multi-site glycosyltransferase obtained according to the preparation method described in the fifth aspect, wherein the distilbene multi-site glycosyltransferase is used to catalyze the glycosylation reaction of distilbene, sulcin, flavonoids or phenolic compounds having a resorcinol structure.
[0023] In the seventh aspect, the present invention provides an application of a distilbene multi-site glycosyltransferase obtained according to the preparation method described in the fifth aspect, wherein the distilbene multi-site glycosyltransferase is used to prepare distilbene glycosides, sansin glycosides, flavonoid glycosides or phenol glycoside compounds having a resorcinol core.
[0024] Compared with the prior art, the present invention has the following beneficial effects:
[0025] The stilbene multi-site glycosyltransferase provided by the present invention is the first enzyme extracted from mulberry that can catalyze the multi-site glycosylation reaction of stilbene and sulcinol substrates. The enzyme can catalyze the synthesis of multiple endogenous glycosides in mulberry, and also has catalytic ability for phenolic substrates with a resorcinol structure, and has high economic value and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 The stilbene multi-site glycosyltransferase MaUGT74BK13 expressed by E. coli in Example 1 and its purification result;
[0027] Figure 2 The chromatogram of the products of the in vitro enzymatic reaction of stilbene multi-site glycosyltransferase MaUGT74BK13 with different substrates in Example 2: Figure 2 A represents the chromatogram of catalytic moracin M substrate. Figure 2 B shows the chromatogram of the catalytic resveratrol substrate. Figure 2 C represents the chromatogram of the catalytic oxyresveratrol substrate, Figure 2 D represents the chromatogram of catalytic moracin P substrate
[0028] Figure 3 The stilbene multi-site glycosyltransferase MaUGT74BK13 in Example 2 was analyzed at different pH values ( Figure 3 A) Different temperatures ( Figure 3 B) and for different substrates ( Figure 3 C) catalytic activity;
[0029] Figure 4 Schematic diagram of the molecular basis of the recognition of the stilbene multi-site glycosyltransferase enzyme MaUGT74BK13 by the substrate of sulcinone M in Example 3: Figure 4 A, 4B, and 4C represent the global view, local view, and interaction analysis of 3'-OH glycosylation products, respectively. Figure 4 D, 4E, and 4F represent the global view, local view, and interaction analysis of the 6-OH glycosylation products, respectively. DETAILED DESCRIPTION
[0030] The present invention is further described and illustrated below in conjunction with the accompanying drawings and specific embodiments. The technical features of each embodiment of the present invention can be combined accordingly without conflicting with each other.
[0031] Example 1: Cloning, expression and purification of white mulberry MaUGT74BK13
[0032] The gene encoding MaUGT74BK13 was identified from transcriptome data of different tissues of Morus alba L. seedlings. To clone the gene, total RNA from the fibrous roots of Morus alba L. seedlings was extracted and reverse transcribed into cDNA. Primers MaUGT74BK13-F1 and MaUGT74BK13-R1 were designed based on the coding sequence of MaUGT74BK13 in the transcriptome, and the gene encoding MaUGT74BK13 was amplified using a high-fidelity enzyme.
[0033] MaUGT74BK13-F1:CTATGGAGCAAAACAAGTACTAC;
[0034] MaUGT74BK13-R1: CCGCTACTCTATCTCTTTATACC.
[0035] The amplified target band was excised and recovered, connected to the TOPO cloning vector pClone007, and the recombinant pClone007-MaUGT74BK13 cloning vector was obtained. The recombinant E. coli DH5α competent vector was transformed and spread on solid LB medium containing 50 μg / mL ampicillin, and cultured at 37°C for 12-16 hours. Single clones were picked for colony PCR, and the positive single clones were expanded and cultured and sent for sequencing.
[0036] The nucleotide sequence of the MaUGT74BK13 encoding gene obtained by sequencing is 1410 bp in length, as shown in SEQ ID NO. 2. The amino acid sequence of the stilbene multisite glycosyltransferase MaUGT74BK13 (encoding 469 amino acids, with a theoretical molecular weight of 52.7 kDa) encoded by the encoding gene is shown in SEQ ID NO.1.
[0037] The MaUGT74BK13 gene fragment containing BamH I and Not I restriction sites at both ends was amplified from the recombinant pClone007-MaUGT74BK13 cloning vector using high-fidelity enzyme and specific primers MaUGT74BK13-F2 and MaUGT74BK13-R2. The MaUGT74BK13 gene fragment and the pET-28a(+) empty vector were double-digested with BamH I and Not I endonucleases, respectively. The linearized vector and the target gene fragment were recovered by gel cutting and ligated with T4 DNA ligase to obtain the recombinant pET-28a(+)-MaUGT74BK13 expression vector.
[0038] MaUGT74BK13-F2: CGGGATCCATGGAGCAAAACAAGT;
[0039] MaUGT74BK13-R2: TAAAGCGGCCGCTAATAATGAGTTCC.
[0040] The above recombinant pET-28a(+)-MaUGT74BK13 expression vector was transformed into competent E. coli DH5α, spread on solid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C for 12-16 hours. Single clones were picked for colony PCR, and positive single clones were expanded and cultured and sent for sequencing.
[0041] The recombinant pET-28a(+)-MaUGT74BK13 expression vector with correct sequencing was transformed into competent E. coli BL21(DE3), spread on solid LB medium containing 50 μg / mL kanamycin, and cultured at 37°C for 12-16 hours. Single clones were picked for colony PCR, and positive single clones were inoculated into liquid LB medium containing 50 μg / mL kanamycin and cultured at 37°C, 200 rpm until OD 600 = about 0.5, add IPTG with a final concentration of 0.1 mM as an inducer, and transfer to 16°C, 150 rpm to induce expression for 20 h.
[0042] Extraction: Escherichia coli cells expressing the recombinant pET-28a(+)-MaUGT74BK13 expression vector were collected by centrifugation, resuspended in 9.5 mL of binding buffer (0.02 M phosphate buffer, 0.5 M NaCl, 0.03 M imidazole, pH 7.4), and the cells were disrupted by ultrasonication after adding 1 mM PMSF.
[0043] Purification: After centrifugation, the supernatant was filtered through a 0.22 μm filter and loaded onto a pre-equilibrated HisTrap TM HP prepacked column (1 mL, Cytiva, Uppsala, Sweden), after fully washing away nonspecific adsorbed proteins, the target protein, i.e., stilbene multisite glycosyltransferase MaUGT74BK13, was eluted using elution buffer (0.02 M phosphate buffer, 0.5 M NaCl, 0.3 M imidazole, pH 7.4).
[0044] Desalting: Load the eluted target protein fraction onto the pre-equilibrated HiTrap TM The column was desalted and replaced with 50 mM Tris-HCl (pH 8.0) buffer containing 1 mM DTT and 10% glycerol.
[0045] The protein concentration was determined by Bradford method, and the expression and purification of MaUGT74BK13 were detected by polyacrylamide gel electrophoresis. Figure 1 As shown. Lane M represents protein marker, and lanes 1 to 3 represent the total protein of the supernatant of bacterial cell crushing in the pET-28a(+) empty vector group, the total protein of the supernatant of bacterial cell crushing in the MaUGT74BK13 group, and the purified recombinant MaUGT74BK13 protein, respectively. The purified stilbene multi-site glycosyltransferase MaUGT74BK13 appeared as a single band on the electrophoresis gel, and its molecular weight was about 55kDa, which was consistent with the theoretical value of 56.3kDa for the expression of recombinant protein by the vector, indicating that the stilbene multi-site glycosyltransferase MaUGT74BK13 was successfully expressed in Escherichia coli.
[0046] Example 2: Characterization of in vitro enzymatic reaction of MaUGT74BK13
[0047] In this example, the diphenylethylene multisite glycosyltransferase MaUGT74BK13 expressed by Escherichia coli in Example 1 was used to perform in vitro enzymatic reaction detection.
[0048] The in vitro enzymatic reaction system (100 μL) was as follows: 100 mM Tris-HCl (pH 9.0), 1 mM DTT, 1 mM sugar donor substrate, 0.2 mM sugar acceptor substrate, and 10 μg purified stilbene multi-site glycosyltransferase MaUGT74BK13.
[0049] After incubation at 30°C for 1 h, 10 μL of acetic acid was added to inactivate the reaction. After centrifugation at 17,000 g for 20 min, the supernatant was taken for UPLC analysis. The chromatographic column used was an accucore C18 column (150×2.1 mm, 2.6 μm, Thermo Fisher Scientific), mobile phase A was 0.1% formic acid / acetonitrile, mobile phase B was 0.1% formic acid in water, the flow rate was 0.5 ml / min, and the chromatographic gradient was: 0-1 min, 7% A; 1-10 min, 7-55% A; 10-12 min, 95% A; 12-15 min, 7% A.
[0050] Figure 2 A is the result of MaUGT74BK13 protein catalyzing moracin M substrate: Compared with the blank control, the MaUGT74BK13 group produced three products, among which M3 co-eluted with the disaccharide mulberroside F standard. The NMR results of the prepared products showed that M1 and M2 were monosaccharide products of 3'-OH and 6-OH, respectively.
[0051] Figure 2 B is the result of MaUGT74BK13 protein catalyzing resveratrol substrate: after comparison with the standard, the two products R1 and R2 produced by the MaUGT74BK13 group are monosaccharide products of 3-OH and 4'-OH, respectively.
[0052] Figure 2 C is the result of MaUGT74BK13 protein catalyzing the oxidation of resveratrol (oxyresveratrol) substrate: compared with the blank control, the MaUGT74BK13 group produced four products, among which O1~3 were monosaccharide products, O3 was a 2-OH glycosylation product, and O4 was a disaccharide product mulberroside A.
[0053] Figure 2 D is the result of MaUGT74BK13 protein catalyzing moracin P substrate: compared with the blank control, the MaUGT74BK13 group produced a unique product, which did not co-elute with 3'-OH glycoside (mulberroside F), and it was speculated that it should be the glycosylation product of the hydroxyl group on the pyranose ring.
[0054] According to the above reaction system, the catalytic activity of stilbene multi-site glycosyltransferase MaUGT74BK13 at different pH (6.0-10.5) and different temperatures (20-50°C) and on different substrates was investigated. Figure 3 As shown. Sugar acceptor substrates include moracin M / C / N / O / P, stilbenes (resveratrol, oxyresveratrol, pinosylvin, piceatannol), flavonoids (naringenin, steppogenin, norartocarpetin, kaempferol, genistein, phloretin), coumarins (umbelliferone), phenolic acids (p-coumaric acid) and phenols (orcinol, 4-methylresorcinol); sugar donor substrates include UDP-Glc, UDP-Gal, UDP-Rha, UDP-GlcA and UDP-GlcNAc.
[0055] Figure 3 A is an investigation of the optimal reaction pH for the glycosyltransferase MaUGT74BK13 catalyzing moracin M substrate. The results show that its optimal pH is 9.0 and it maintains high activity under weak alkaline conditions.
[0056] Figure 3 B is the investigation of the optimal reaction temperature of moracin M substrate catalyzed by glycosyltransferase MaUGT74BK13. The results show that the optimal reaction temperature is 30℃, and the activity rapidly decreases when it exceeds 35℃.
[0057] Figure 3 C is the catalytic activity of glycosyltransferase MaUGT74BK13 towards different substrates. The results show that it has the strongest catalytic activity towards moracin M substrate, generally has strong activity towards diphenylethylene substrates, has relatively weak activity towards flavonoid substrates, has only weak activity towards coumarin substrates, and has no activity towards phenolic acid substrates. In addition, it also has strong activity towards phenol substrates containing resorcinol structure. MaUGT74BK13 protein has high specificity towards sugar donor substrates, and only shows high activity towards UDP-Glc.
[0058] Example 3: Molecular basis for MaUGT74BK13 recognition of moracin M substrate
[0059] In this example, in order to explore the molecular basis of the reaction of different sites of the moracin M substrate catalyzed by the MaUGT74BK13 protein, the three-dimensional structure of the MaUGT74BK13 protein was first predicted using the AlphaFold2 algorithm, and then superimposed with the reported CgUGT74AN2 crystal structure (PDB ID: 7w1h) to determine the binding conformation of the UDP-Glc molecule, and the MaUGT74BK13-UDP-Glc complex structure was preserved. Finally, the moracin M substrate molecule was molecularly docked with the above complex structure using AutoDock vina software, and a reasonable docking conformation was determined according to the glycosylation site to analyze the interaction between the enzyme and the substrate.
[0060] The first binding conformation of MaUGT74BK13 protein and moracin M corresponds to the 3'-OH glycosylation product. The resorcinol part of moracin M enters the binding pocket and fits tightly with the saddle surface formed by the side chains of Tyr16 and Tyr188. The 5'-OH is located in a narrow cavity near the outside of the pocket and forms competitive hydrogen bonds with the side chains of Tyr16 and Tyr188. The 3'-OH extends into the pocket and forms a hydrogen bond with the key residue His21 that catalyzes the deprotonation of the sugar receptor substrate, and a glycosylation reaction occurs. The 6-OH on the opposite benzofuran ring forms a hydrogen bond with Tyr46 ( Figure 4 A, 4B and 4C). The high activity of MaUGT74BK13 towards orcinol and 4-methylresorcinol suggests that it has a general catalytic activity towards resorcinol structures ( Figure 3 C). In addition, it was found that there may be hydrophobic interactions between other amino acids in the binding pocket and moracin M to maintain the correct conformation of the substrate, such as Phe113 and Met191 at the bottom of the pocket, Phe70 at the top, and Cys18 and Met281 at the lower outer side ( Figure 4 C).
[0061] The second binding conformation of MaUGT74BK13 protein and moracin M corresponds to the 6-OH glycosylation product. Figure 4 D and 4E, the benzofuran ring of the substrate enters the pocket, allowing 6-OH to form a hydrogen bond with His21 and undergo a glycosyl substitution reaction. In this conformation, other sites on the substrate do not form hydrogen bonds with the polar residues in the pocket, so the steric hindrance and hydrophobic interactions of the residues in the pocket are the main factors in maintaining the substrate conformation ( Figure 4 F).
[0062] The above-described embodiment is only a preferred solution of the present invention, but it is not intended to limit the present invention. A person skilled in the relevant technical field may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.
Claims
1. A stilbene multi-site glycosyltransferase derived from mulberry, characterized in that: The amino acid sequence of the stilbene multi-site glycosyltransferase has one or more of the following characteristics: (a) having the amino acid sequence shown in SEQ ID NO.1; (b) an amino acid sequence having the same activity formed by substituting and / or deleting and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO.1; (c) an amino acid sequence derived from Morus Linn having an identity greater than 95% with the amino acid sequence shown in SEQ ID NO. 1 and having the same activity.
2. A stilbene multi-site glycosyltransferase gene from mulberry, characterized in that: The nucleotide sequence of the stilbene multisite glycosyltransferase gene has one or more of the following characteristics: (a) having the nucleotide sequence shown in SEQ ID NO.2; (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1; (c) a nucleotide sequence encoding the same glycosyltransferase activity as that of claim 1 obtained by substituting and / or deleting and / or adding one or more nucleotides to the nucleotide sequence of SEQ ID NO.2; (d) A nucleotide sequence derived from Morus Linn having a sequence identity greater than 90% with the nucleotide sequence shown in SEQ ID NO. 2 and encoding the same stilbene multi-site glycosyltransferase activity as the one described in claim 1.
3. A recombinant expression vector, characterized in that: The method is obtained by inserting the stilbene multi-site glycosyltransferase gene according to claim 2 into an expression vector.
4. The recombinant expression vector according to claim 3, characterized in that The expression vector is pET-28a(+) plasmid.
5. A recombinant genetically engineered bacterium containing the recombinant expression vector according to claim 3 or 4.
6. The recombinant genetically engineered bacterium according to claim 5, characterized in that: Escherichia coli BL21 (DE3) was used as the host bacteria.
7. A method for preparing stilbene multi-site glycosyltransferase, characterized in that: The stilbene multi-site glycosyltransferase gene according to claim 2 is cloned into a recombinant expression vector, and introduced into a host cell to obtain the recombinantly expressed stilbene multi-site glycosyltransferase.
8. The method for preparing stilbene multi-site glycosyltransferase according to claim 7, characterized in that: The recombinant expression vector is an Escherichia coli expression vector, a yeast expression vector, a plant expression vector, an insect expression vector or a mammalian cell expression vector; the host cell is an Escherichia coli host cell, a yeast host cell, a plant cell, an insect cell or a mammalian cell.
9. Use of the stilbene multi-site glycosyltransferase obtained according to the preparation method of claim 7 or 8, characterized in that: The stilbene multi-site glycosyltransferase is used to catalyze the glycosylation reaction of stilbene, sansin, flavonoids or phenolic compounds with a resorcinol structure.
10. Use of the stilbene multi-site glycosyltransferase obtained according to the preparation method of claim 7 or 8, characterized in that: The distilbene multi-site glycosyltransferase is used to prepare distilbene glycosides, sansin glycosides, flavonoid glycosides or glycoside compounds of phenol glycosides having a resorcinol mother core.