A lysophospholipase mutant

Abstract

The application belongs to the technical field of genetic engineering and protein modification, and specifically provides a lysophospholipase mutant and application thereof. The mutant is a wild-type lysophospholipase with an amino acid sequence of SEQ ID NO: 1, wherein the 128th amino acid is mutated from Cys to Thr, and the specificity of hydrolyzing the 2-position acyl group of phosphatidylcholine is significantly improved. In lysophospholipids generated by hydrolyzing soybean phospholipids by the mutant, the content of sn-1-lysophosphatidylcholine reaches 49.82%-50.26%, and sn-2-lysophosphatidylcholine is almost not generated, and an unexpected technical effect is achieved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering and protein modification, and particularly relates to a lysophospholipase mutant. BACKGROUND

[0002] Soybean phospholipid is a product extracted from the oil dregs produced in the process of producing soybean oil, and is a mixed phospholipid composed of phosphatidylcholine (lecithin, abbreviated as PC, high-grade PPC), phosphatidylethanolamine (cephaline, abbreviated as PE), phosphatidylinositol (inositol phospholipid, abbreviated as PI), and phosphatidylserine (serine phospholipid, abbreviated as PS), etc. Among them, the most typical are the first three. Soybean phospholipid not only has strong emulsifying, wetting and dispersing effects, but also plays an important role in promoting fat metabolism, muscle growth, nervous system development and antioxidant damage in the body, and can be widely used in feed.

[0003] Lysophospholipid is obtained by removing one fatty acyl group from phosphatidylcholine (lecithin) in soybean phospholipid under the catalysis of phospholipase to convert it into lysophosphatidylcholine. Lysophospholipid has stronger polarity than ordinary phospholipid, and can produce smaller micelles in water environment, which means better emulsifying performance. In addition, the unsaturated double bond of lysophospholipid is reduced, and the stability is improved, so it has good emulsifying stability in low pH value, high temperature and high ion concentration environment. More importantly, lysophospholipid also has three important physiological functions: ①regulating the composition, morphology and physiological function of cell membrane; ②activating various cell signal transduction pathways through G protein-coupled receptors, and then promoting cell proliferation and differentiation; ③regulating fat metabolism, transporting fat together with cholesterol and protein in the liver, clearing deposited fat in the liver, and preventing fatty liver.

[0004] As a functional additive modified from phospholipid, lysophospholipid can significantly improve animal growth performance, increase the absorption and utilization of nutrients by the body, and improve the morphology and function of the intestinal tract. Through comprehensive adjustment of the feed formula, the quality of the feed can be further improved, the cost of the formula can be saved, and the profit level of the feed enterprise can be improved.

[0005] In the production process of lysophospholipid, phospholipase catalyzes the hydrolysis of the 1-position acyl group of phosphatidylcholine (lecithin) to obtain the product sn-2 lysophosphatidylcholine, and hydrolyzes the 2-position acyl group to obtain the product sn-1 lysophosphatidylcholine. Among them, sn-2 lysophosphatidylcholine is unstable and is easily decomposed under the influence of solvent polarity, temperature, solvent pH, hydrolysis time, etc. Therefore, it is necessary to modify the phospholipase to enhance the specificity of hydrolyzing the 2-position acyl group of phosphatidylcholine, so as to improve the conversion rate of sn-1 lysophosphatidylcholine and improve the stability of lysophospholipid. SUMMARY

[0006] The application aims to provide a lysophospholipase mutant, which significantly improves the specificity of hydrolyzing the 2-position acyl group of phosphatidylcholine and the conversion rate of sn-1-lysophosphatidylcholine, and can be widely applied to the production of lysophospholipids.

[0007] In order to achieve the above-mentioned application purposes, the application provides the following technical solutions.

[0008] The application provides a lysophospholipase mutant, which has any one of the amino acid sequences shown in (I), (II) or (III):

[0009] (I) a sequence with at least 70% homology with the amino acid sequence SEQ ID NO: 1 of the lysophospholipase;

[0010] (II) at least one amino acid mutation of the lysophospholipase described in (I), and the amino acid mutation of the lysophospholipase is an amino acid sequence obtained by modifying, substituting, deleting or adding one or more amino acids;

[0011] (III) an amino acid sequence encoded by a nucleotide sequence as shown in SEQ ID NO: 2 or a complementary sequence thereof or a sequence different from the nucleotide sequence as shown in SEQ ID NO: 2 or a complementary sequence thereof due to the degeneracy of genetic code;

[0012] In some embodiments of the application, the substitution is substitution of 1 amino acid.

[0013] In some embodiments of the application, the substitution comprises that the 95th amino acid of the lysophospholipase with the amino acid sequence of SEQ ID NO: 1 is changed from His to Val.

[0014] In some embodiments of the application, the substitution comprises that the 128th amino acid of the lysophospholipase with the amino acid sequence of SEQ ID NO: 1 is changed from Cys to Thr.

[0015] The application further provides a DNA molecule encoding the lysophospholipase mutant.

[0016] The application further provides a recombinant expression vector comprising the DNA molecule.

[0017] The application further provides a host cell comprising the recombinant expression vector.

[0018] The host cell is Pichia pastoris (P.pastoris) Pichia pastoris ).

[0019] The host cell is Aspergillus niger (A.niger) Aspergillus niger ).

[0020] The host cell is Trichoderma reesei (T.reesei)Trichoderma reesei

[0021] The application further provides application of the above-mentioned lysophospholipase mutant in preparation of lysophospholipid.

[0022] Compared with the wild type, the lysophospholipase mutant provided by the application respectively containing H95V and C128T single-point mutations has significantly improved hydrolysis specificity for the 2-position acyl group of phosphatidylcholine. After 2 h of reaction at 70℃, the content of sn-1-lysophosphatidylcholine in lysophospholipid generated by hydrolysis of soybean phospholipid by the lysophospholipase single-point mutant reaches 49.82%-50.26%, and sn-2-lysophosphatidylcholine is almost not generated, achieving an unexpected technical effect. The lysophospholipase mutant provided by the application can be widely applied to production of lysophospholipid, and has a broad prospect. DETAILED DESCRIPTION

[0023] The method of the application is further described below in conjunction with examples. The experimental methods in the following examples not specifically indicated are generally performed according to conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Manual by J. Sambrook et al., or the conditions suggested by the manufacturer. The person skilled in the relevant art can better understand and master the application with the help of the examples. However, the protection and scope of claims of the application are not limited to the specific cases provided, but should include the protection scope that can be extended by the person skilled in the art without creative labor on the basis of the description.

[0024] Experimental materials and reagents:

[0025] Enzymes and kits: PCR enzymes and ligase were purchased from Takara Company, restriction endonucleases were purchased from Fermentas Company, plasmid extraction kit and gel purification and recovery kit were purchased from Omega Company, and GeneMorph II random mutation kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0026] Culture medium formula:

[0027] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0028] LB+Amp culture medium: LB medium plus 100 μg / mL ampicillin;

[0029] LB+Kana culture medium: LB medium plus 50 μg / mL kanamycin;

[0030] The application is described in detail below in conjunction with examples.

[0031] Example 1 Preparation of wild-type lysophospholipase​

[0032] 1. Construction of expression carrier

[0033] Will come from Aspergillus niger ( Aspergillus niger The lysophospholipase gene of PLA2 is named PLA2, and its nucleotide sequence is SEQ ID NO: 1, and the encoded amino acid sequence is SEQ ID NO: 2.

[0034] PCR primers were designed based on the 5' end of the gene, containing a KpnI restriction enzyme site, and PCR primers were designed based on the 3' end, containing an XbaI restriction enzyme site. The primer sequences are as follows:

[0035] PLA2-F: GCA GGTACC ATGAAGAACATCTTCGTTGCC (The underlined part is the restriction endonuclease KpnI recognition site);

[0036] PLA2-R: GGC TCTAGA TTACTCGTCGACGGCGAAGCG (The underlined part is the recognition site of the restriction endonuclease XbaI).

[0037] Using Aspergillus niger genomic DNA as a template, PCR amplification was performed using the primers described above. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer PLA2-F, 1 μL downstream primer PLA2-R, 10 μL 5×PS Buffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, for a total reaction volume of 50 μL. The PCR cycling program was as follows: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 30 sec, 72℃ for 10 min; PCR products were recovered from the gel, digested with KpnI and XbaI, and then ligated with the pSE vector digested with the same enzymes overnight at 16℃ and transformed into E. coli DH5α. The transformed products were plated on LB+Amp plates and incubated upside down at 37℃. After the transformants appeared, the colony PCR was used to verify the positive clones. After sequencing verification, the correct recombinant plasmid pSE-PLA2 was finally obtained.

[0038] 2. Recombinant expression of wild-type lysophospholipase

[0039] Protoplast preparation: inoculate the host of Aspergillus niger on PDA+U plate, cultivate at 30℃ for 5-7d. Cut 2cm×2cm size of mycelium, inoculate in 100mL liquid PDA+U medium, cultivate at 30℃ for 24h to grow mycelium, for transformation. Filter the grown mycelium, resuspend with 20mL 1.2M magnesium sulfate solution, add 0.2g lysozyme. Cultivate at 30℃, 100rpm for 2-3h. Filter the lysed mycelium with 2 layers of lens paper, centrifuge at 3000rpm for 10min to obtain protoplasts.

[0040] Transformation: wash the protoplasts with 1.2M sorbitol solution twice, resuspend with appropriate amount of sorbitol solution to make the concentration of protoplasts 10 8 CFU / mL. Add 10uL prepared plasmid to 200uL protoplasts, add 50uL 25% PEG6000, ice bath for 20min, then add 2mL 25% PEG6000, room temperature for 5min, add 4mL sorbitol solution, mix well. Pour into 50mL upper transformation medium, then pour into 4 lower transformation plates, after the upper medium solidifies, invert and cultivate in 30℃ incubator for 5d.

[0041] Transformation screening: after 5d cultivation, pick the grown colonies, inoculate on lower transformation plates for re-screening, cultivate at 30℃ for 2d. Inoculate the normally grown transformants on fresh PDA plates, cultivate at 30℃ for 5-7d. Cut 2cm×2cm size of mycelium from each transformant, inoculate in 50mL liquid shake flask medium for fermentation, cultivate at 32℃ for 5d, add appropriate amount of ammonia water every day to control the pH at about 4.5. After 5d cultivation, centrifuge the mycelium to obtain supernatant, which is crude enzyme solution, use phospholipase A2 kit for enzyme activity detection, screen the transformant expressing lysophospholipase.

[0042] The Aspergillus niger engineering strain with the highest expression of lysophospholipase obtained by screening is named Su2-PLA2, under shake flask fermentation conditions, the enzyme activity of lysophospholipase in the fermentation supernatant reaches 582 u / mL.

[0043] Lysophospholipase enzyme activity detection

[0044] (1) Definition of enzyme activity unit

[0045] Under the condition of 37℃ and pH value of 7.0, the amount of enzyme required to hydrolyze 2-thiohexadecanoyl ethyl phosphocholine (HEPC) to produce 1 nmol free sulfhydryl per minute is defined as one enzyme activity unit U.

[0046] (2) Enzyme activity determination steps

[0047] Add 100 uL of diluted enzyme solution to the sample tube, then add 300 uL of substrate solution (HEPC), 600 uL of color developing solution (5,5'-dithiobis(2-nitrobenzoic acid) DTNB), mix well, and react at 37°C for 10 min. In a 1 mL glass cuvette, adjust to zero with distilled water, and measure the absorbance at 412 nm, which is A1.

[0048] Add 100 uL of diluted enzyme solution to the sample tube, then add 900 uL of substrate solution (HEPC), mix well, and react at 37°C for 10 min. In a 1 mL glass cuvette, adjust to zero with distilled water, and measure the absorbance at 412 nm, which is A2.

[0049] (3) Enzyme activity calculation

[0050] Lysophospholipase activity is calculated according to the following formula:

[0051] U = (A1-A2) x 10 x N / (ε x d) / T.

[0052] U - lysophospholipase enzyme activity, u / g or u / mL;

[0053] A1 - sample absorbance;

[0054] A2 - blank control absorbance;

[0055] 10 - conversion factor, sample dilution factor in the reaction system;

[0056] N - sample dilution factor before reaction;

[0057] ε - TNB extinction coefficient, 13600 L / mol / cm;

[0058] d - cuvette optical path, cm;

[0059] T - reaction time, 10 min.

[0060] Example 2 Preparation of lysophospholipase mutants

[0061] In order to further improve the specificity of lysophospholipase PLA2 in hydrolyzing the 2-position acyl group of phosphatidylcholine and improve the conversion rate of sn-1-lysophosphatidylcholine, the protein structure of lysophospholipase PLA2 was simulated and analyzed, and it was found that the amino acid sites in lysophospholipase that may be related to the hydrolysis of the 2-position acyl group of phosphatidylcholine were the 95th histidine (His) and the 128th cysteine (Cys). The 95th and 128th amino acids in lysophospholipase were saturated mutated, and mutant sites that significantly improved the specificity of lysophospholipase in hydrolyzing the 2-position acyl group of phosphatidylcholine were screened out.

[0062] The primers were designed respectively, and the pSE-PLA2 plasmid was used as a template for PCR reaction. The reaction was performed in a 50 μL system, and the reaction conditions were as follows: 94 ℃ pre-denaturation for 5 min; then 30 cycles of 94 ℃ for 30 s, 56 ℃ for 30 s, and 72 ℃ for 7 min; 72 ℃ extension for 10 min; and finally 4 ℃ incubation. The PCR product was digested by Dpn I (Fermentas Company), and the transformed E. coli JM109 competent cells were coated on LB plates containing 100 mg / L ampicillin, which were incubated at 37 ℃ overnight. Two single colonies were picked from the plate and inoculated into LB liquid medium. After 8 h, the plasmid was extracted and sequenced, which was correct. The constructed plasmid was a lysophospholipase single-point mutant.

[0063] (2) Expression of mutant enzyme

[0064] The recombinant expression of lysophospholipase single-point mutant of Aspergillus niger engineering strain was constructed according to the method described in Example 1. Under the condition of a shake flask, the lysophospholipase enzyme activity in the fermentation supernatant was 550-650 u / mL.

[0065] Example 3 Specificity analysis of lysophospholipase mutant in hydrolysis of phosphatidylcholine 2-acyl group

[0066] 95 g of soybean phospholipid was weighed, 5 g of water was added, and the mixture was uniformly stirred. Then, 1 mL of the fermentation supernatant of the recombinant expression of lysophospholipase single-point mutant of Aspergillus niger engineering strain described in Example 2 was added, and the mixture was reacted at 70 ℃ for 2 h. After the reaction, samples were taken, and the contents of sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine were detected according to the following method. The wild-type lysophospholipase PLA2 was used as a control.

[0067] Method for detecting sn-1-lysophosphatidylcholine and sn-2-lysophosphatidylcholine in enzyme-modified phospholipid

[0068] (1) Sample preparation

[0069] 50-100 mg of phospholipid sample was weighed, dissolved and diluted to 25 mL with 95% ethanol, centrifuged with a high-speed centrifuge, and the supernatant was filtered with a 0.45 μm fiber membrane. The prepared sample was used immediately.

[0070] (2) High-performance liquid chromatography conditions

[0071] Amino column: 250 mm x 4.6 mm; mobile phase: 95% ethanol: oxalic acid solution = 92:8, filtered through a 0.45 μm fiber membrane, and treated with ultrasonic degassing; flow rate: 1 mL / min; column temperature: 25 ℃.

[0072] (3) Standard curve

[0073] Accurately weigh phosphatidylcholine, sn-1 -lysophosphatidylcholine and sn-2-lysophosphatidylcholine respectively, dissolve them in 95% ethanol, dilute and prepare a series of standard solutions with the concentration of each phospholipid component in the range of 0.05 mmol / L to 2.0 mmol / L.

[0074] Accurately inject 10 μl of each concentration of the standard solution with a microsyringe, and record the peak area. Plot the standard curve with the peak area versus the injection amount.

[0075] (4) Sample determination

[0076] Accurately inject 10 μl of the sample solution with a microsyringe, perform chromatographic analysis and record the peak area. Qualify according to the retention time, and quantify by external standard method to obtain the molar concentration c of sn-1 -lysophosphatidylcholine and sn-2-lysophosphatidylcholine in the sample.

[0077] (5) Content calculation

[0078] P = c x Mw x V x 0.1 / m.

[0079] P - the content of sn-1 -lysophosphatidylcholine or sn-2-lysophosphatidylcholine in the sample, %;

[0080] c - the molar concentration of sn-1 -lysophosphatidylcholine or sn-2-lysophosphatidylcholine measured by external standard method, mmol / L;

[0081] Mw - the average value of the molar mass of sn-1 -lysophosphatidylcholine or sn-2-lysophosphatidylcholine, g / mol;

[0082] V - the final constant volume of the sample, mL;

[0083] M - the mass of the sample, mg.

[0084] The detection results show that, compared with the wild type, some mutations have no effect on the specificity of lysophospholipase PLA2 in hydrolyzing the 2-position acyl group of phosphatidylcholine, and some mutations even reduce the substrate specificity. The mutation sites that can significantly improve the specificity of lysophospholipase PLA2 in hydrolyzing the 2-position acyl group of phosphatidylcholine are H95V and C128T.

[0085] The contents of sn-1 -lysophosphatidylcholine and sn-2-lysophosphatidylcholine produced by the enzymatic hydrolysis of soybean phospholipids by the H95V single-point mutant and the C128T single-point mutant are shown in Table 1.

[0086] Table 1 Analysis of the specificity of lysophospholipase in hydrolyzing the 2-position acyl group of phosphatidylcholine

[0087] Name sn-1 -lysophosphatidylcholine content sn-2-lysophosphatidylcholine content Wild-type PLA2 39.21% 11.30% H95V single point mutant 49.82% 1.09% C128T single point mutant 50.26% 0.83%

[0088] From the results of Table 1, it can be seen that the specificity of lysophospholipase mutants containing H95V or C128T single mutation site for hydrolyzing the 2-acyl group of phosphatidylcholine is significantly improved compared with the wild type. After 2 h of reaction at 70℃, the content of sn-1-lysophosphatidylcholine in lysophospholipids generated by hydrolysis of soybean phospholipids by wild-type lysophospholipase PLA2 is 39.21%, and the content of sn-2-lysophosphatidylcholine is 11.30%. However, the content of sn-1-lysophosphatidylcholine in lysophospholipids generated by hydrolysis of soybean phospholipids by the lysophospholipase single-point mutant provided by the present application is 49.82%-50.26%, and sn-2-lysophosphatidylcholine is almost not generated, achieving an unexpected technical effect.

[0089] In summary, compared with the wild type, the lysophospholipase mutant screened by the present application has better substrate specificity, which is conducive to its wide use in lysophospholipid preparation.

[0090] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.

Claims

1. A lysophospholipase mutant, characterized in that, The mutant is a mutant of lysophospholipase having an amino acid sequence of SEQ ID NO: 1, in which the 128th amino acid is changed from Cys to Thr.

2. A DNA molecule encoding the mutant of lysophospholipase according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule according to claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell of claim 4, wherein The host cell is Pichia pastoris ( Pichia pastoris ) or Aspergillus niger ( Aspergillus niger ) or Trichoderma reesei ( Trichoderma reesei ).

6. Use of the mutant of lysophospholipase according to claim 1 in the production of lysophospholipids.