Application of maize potassium efficient gene nkt1 excellent haplotype

Abstract

The application relates to an application of a maize potassium high-efficiency gene NKT1 excellent haplotype. It is found that six linkage sites located on a maize NKT1 gene promoter are significantly related to the expression level of the gene. The 7.1 kb large fragment insertion of an InDel(-1592) site inhibits the activity of the NKT1 promoter, reduces the transcription level, and finally leads to the reduction of the potassium content and the nitrogen content in maize leaves. The NKT1 without the large fragment insertion of the InDel(-1592) site is an excellent haplotype, and a maize inbred line containing the excellent haplotype has a certain yield advantage. The identification of the excellent allelic variation of the NKT1 gene provides important gene resources and theoretical guidance for cultivating new maize varieties with high efficiency of potassium and nitrogen nutrients.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to application of an excellent haplotype of a maize potassium efficient gene NKT1. BACKGROUND

[0002] Potassium and nitrogen are essential macronutrients for plant growth and development, and are the two most abundant mineral elements in plants. Their supply level and utilization efficiency directly affect crop yield and quality. Potassium and nitrogen are absorbed by plant roots in the form of K + and NO3 - (less NH4 + ), then loaded into the vascular tissue, transported to the aboveground part, and distributed to the required tissue parts. The absorption and transport of the two elements have a synergistic effect. Gramineae plants have evolved a complex and rigorous vascular system to control the ordered distribution of mineral elements to leaves and ears, thereby affecting photosynthesis and yield. However, the distribution mechanism remains unclear.

[0003] Maize potassium efficient gene NKT1 (N and K transporter 1) has K + and NO3 - transport activity, and is mainly expressed in the xylem parenchyma cells of maize nodes to regulate the ordered distribution of K + and NO3 - from nodes to leaves, thereby improving the potassium and nitrogen nutrient use efficiency of maize. Therefore, further analysis of functional variation sites and excellent haplotypes of NKT1 gene can provide a theoretical basis for breeding new maize varieties with high potassium and nitrogen nutrient efficiency, and ultimately achieve stable yield with less fertilizer, and increased yield with less fertilizer, to ensure China's food security and sustainable development of green agriculture. SUMMARY

[0004] In view of the defects in the prior art, the purpose of the present application is to provide an application of a corn potassium efficient gene NKT1 excellent haplotype. According to the expression level of the corn NKT1 gene (Zm00001d017666, MaizeGDB_v4) in the different corn inbred ear nodes, candidate gene association analysis is carried out, and 6 linked natural variation sites are identified in the promoter region of the NKT1 gene: SNP(-1278) site GCT / TCC base mutation, SNP(-1298) site G / T base mutation, SNP(-1400) site A / T base mutation, SNP(-1430) site A / T base mutation, InDel(-1592) site 7.1kb large fragment deletion / insertion, and InDel(-1638) site 7bp fragment (ATTGGAA) deletion / insertion. Among them, the InDel(-1592) site 7.1kb large fragment deletion / insertion is a functional variation site affecting the expression of NKT1. The NKT1 genotype with the InDel(-1592) site deleted is identified as an excellent haplotype for efficient distribution of corn leaf potassium and nitrogen. The identification of the excellent allelic variation of the NKT1 gene provides a new breeding idea for the cultivation and improvement of new corn potassium and nitrogen efficient varieties.

[0005] The corn NKT1 gene promoter sequence is shown in SEQ ID NO. 5, specifically:

[0006] In SEQ ID NO. 5, 7bp fragments (ATTGGAA) are deleted after the 559bp site, corresponding to the InDel(-1638) site 7bp fragment (ATTGGAA) deletion / insertion; 7.1kb large fragments are deleted after the 631bp site, corresponding to the InDel(-1592) site 7.1kb large fragment deletion / insertion; the 700bp site is A, corresponding to the SNP(-1430) site A / T base mutation; the 725bp site is A, corresponding to the SNP(-1400) site A / T base mutation; the 826bp site is G, corresponding to the SNP(-1298) site G / T base mutation; the 844bp-846bp site is GCT, corresponding to the SNP(-1278) site GCT / TCC base mutation.

[0007] The 7.1kb large fragment insertion sequence of the InDel(-1592) site is shown in SEQ ID NO. 6.

[0008] The specific technical solutions are:

[0009] The application of the corn NKT1 gene in the breeding of corn potassium and nitrogen efficient distribution varieties, characterized in that the application is: promoting the expression of the NKT1 gene in the corn plant, and breeding corn potassium and nitrogen efficient distribution varieties;

[0010] The corn NKT1 gene is shown as SEQ ID NO. 1, and the NKT1 gene encodes a protein shown as SEQ ID NO. 2.

[0011] The application of the corn NKT1 gene in the identification of excellent haplotypes of corn leaf potassium and nitrogen efficient distribution is characterized in that the application identifies the excellent haplotypes of corn leaf potassium and nitrogen efficient distribution by detecting whether there is a large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene.

[0012] Among them, the haplotype without large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene is an excellent haplotype of corn leaf potassium and nitrogen efficient distribution.

[0013] The application of the corn NKT1 gene in the identification of potassium and nitrogen efficient distribution corn varieties is characterized in that the application identifies the potassium and nitrogen efficient distribution corn varieties by detecting whether there is a large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene.

[0014] Among them, the haplotype without large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene is a potassium and nitrogen efficient distribution corn variety.

[0015] A kit for detecting corn leaf potassium and nitrogen efficient distribution, wherein the primer pair for detecting the genotype at the-1592 site in the promoter region of the corn NKT1 gene is shown as SEQ ID NO. 3-4.

[0016] The application of the above-mentioned kit in the phenotype identification of corn leaf potassium and nitrogen content.

[0017] The application of the above-mentioned kit in the improvement of corn leaf potassium and nitrogen efficient distribution varieties.

[0018] The application of the above-mentioned kit in the cultivation of potassium and nitrogen nutrient synergistic efficient corn varieties is characterized in that, based on the detection result of the genotype of the-1592 site in the promoter region of the corn NKT1 gene by the kit, a homozygous sample lacking the-1592 site is selected for breeding.

[0019] The application of the above-mentioned kit in any one of the following:

[0020] (1) preparing a product for corn breeding or assisting breeding;

[0021] (2) preparing a product for identifying or assisting in identifying the phenotype of corn leaf potassium and nitrogen content;

[0022] (3) The product for breeding or assisting breeding of maize potassium and nitrogen nutrient synergistic high-efficiency varieties is prepared.

[0023] The application of the maize potassium high-efficiency gene NKT1 excellent haplotype has the beneficial effects that:

[0024] (1) The application provides the application of the NKT1 gene excellent haplotype in regulating maize leaf potassium and nitrogen distribution. The NKT1 gene excellent haplotype promotes the distribution of maize leaf potassium and nitrogen, improves the utilization efficiency of maize aboveground potassium and nitrogen, and thus certain yield advantage is obtained. The identification of the NKT1 gene excellent allelic variation provides a new breeding idea for the cultivation and improvement of maize potassium and nitrogen nutrient high-efficiency new varieties.

[0025] (2) The application uses PCR technology to detect the natural variation sites of the NKT1 gene promoter region in different maize inbred lines, and the method has the advantages of simple operation, high sensitivity and good accuracy.

[0026] (3) According to the natural variation sites of the NKT1 gene promoter region, different maize inbred line populations are divided into two haplotypes, and statistical analysis finds that there is a significant difference in the leaf potassium and nitrogen distribution phenotype data between different haplotype populations, which further proves that different haplotypes of the gene affect the potassium and nitrogen distribution efficiency of maize leaves. BRIEF DESCRIPTION OF DRAWINGS

[0027] The application has the following drawings:

[0028] Figure 1 For NKT1 candidate gene association analysis. A is the association analysis and linkage disequilibrium (LD) analysis of the NKT1 gene in 125 maize inbred lines: the upper part of the picture represents the natural variation sites associated with the expression level of the NKT1 gene in the ear node, and the highlighted red site represents the 6 natural variation sites most significantly associated with the expression level of the NKT1 gene; the middle part of the picture is a schematic diagram of the gene structure of NKT1, and the red box represents the exon, and the blue straight line represents the intron and the promoter; the lower part of the picture is the linkage disequilibrium (LD) analysis of the NKT1 natural variation site, and the TASSEL5.0 software and the Haploview software are used for association analysis and linkage disequilibrium analysis. B is the haplotype division of 125 maize inbred lines: the left part represents that 125 maize inbred lines are divided into two haplotypes Hap 1 and Hap 2 according to the 6 significant variation sites in the promoter region of the NKT1 gene; the right part represents the distribution of the expression level of the NKT1 gene in the ear node in the maize inbred lines contained in the two haplotypes; n represents the number of maize inbred lines contained in each haplotype. The significance analysis method is t-test.

[0029] Figure 2This study describes the detection of LUC activity using different haplotype promoters of NKT1. Schematic diagrams of vectors driving LUC expression using 1563bp promoter (A) and 2023bp promoter (B) from Hap 1 haplotype inbred lines Zheng58, CI7, and Dan340, and Hap 2 haplotype inbred lines Zong3, 04K5702, and CIMBL17 are presented, along with the promoter activity detection results. LUC (Firefly luciferase) was used as the reporter gene, and REN (Renilla luciferase) was used as the internal control gene. The ratio of reporter gene expression to internal control gene expression, LUC / REN, represents promoter activity. Statistical results are expressed as mean ± standard error (n=4). Significance analysis was performed using ANOVA one-way ANOVA and Tukey's multiple comparisons method. Different letters indicate significant differences (P<0.05).

[0030] Figure 3 Phenotypic analysis of haplotype inbred lines Hap 1 and Hap 2. The expression levels (A), potassium content (B), and nitrogen content (C) of NKT1 in the ear leaves of haplotype inbred lines Hap 1 (n=30) and Hap 2 (n=17) were measured in normal fertilization (CK) and no potassium fertilizer (LK) plots. Significance analysis was performed using the t-test.

[0031] Figure 4 Yield analysis of haplotypes Hap 1 and Hap 2. Ear grain weight of the two haplotype inbred lines was measured in high-nitrogen and low-nitrogen plots at the Anyang Experimental Station in 2017 (A) and 2018 (B). The significance analysis method was t-test. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] The maize inbred line population material used in the embodiments of the present application was donated by the laboratory of Professor Yang Xiaohong of China Agricultural University. The inbred lines used for experimental testing are shown in Table 1 below, and the inbred line population materials in Table 1 can be obtained through commercial channels:

[0035] Table 1 Inbred line name and genotype

[0036]

[0037]

[0038]

[0039] The corn material in the embodiments of the present application is cultured using a field planting method:

[0040] Field phenotype experiments were carried out at the Zhuozhou Experimental Station and the Anyang Experimental Station of China Agricultural University. The field fertilization scheme was N 240 kg / ha, P2O5 100 kg / ha, and K2O 80 kg / ha. No potassium fertilizer was applied in the low potassium nutrient plots, and no nitrogen fertilizer was applied in the low nitrogen nutrient plots. When fertilizing in the field, phosphorus fertilizer and potassium fertilizer were applied as base fertilizer at one time, 30% of the total amount of nitrogen fertilizer was applied as base fertilizer, and the remaining 70% was applied at the jointing stage. In different nutrient plots, seeding plots were set up, each plot was 2.5 m long, 0.6 m apart, 0.25 m apart, the interval between plots was 0.5 m, the interval between different nutrient plots was 1-2 m, single and double seeds were sown, artificial thinning was carried out at the three-leaf stage to ensure 10 plants per row of material. Three plots were set up in different nutrient plots as three replicates.

[0041] Example 1 Detection of the expression level of the maize NKT1 gene

[0042] The plant RNA extraction kit (product number AG21019) of Aikuerui Biological Company was used to extract the corn stem node RNA, and the integrity of the RNA was checked by agarose gel electrophoresis. The reverse transcription premix kit (product number AG11728) of Aikuerui Biological Company was used to synthesize cDNA product. The 2xM5 HiPer Realtime PCR Super Mix (product number MF797) of Heyi Biotechnology Co., Ltd. was used for real-time fluorescent quantitative PCR. The synthesized cDNA product was diluted 5 times with ddH2O and then used. ZmUBI2 gene was used as an internal reference gene. The Real-time PCR primer sequences are as follows (5'-3'):

[0043] qRT-NKT1-F: ACACGCAAGGGTTCAGTTTC

[0044] qRT-NKT1-R: CTGGGTGAAGACAACGGAGT

[0045] qRT-ZmUBI2-F: TGGTTGTGGCTTCGTTGGTT

[0046] qRT-ZmUBI2-R: GCTGCAGAAGAGTTTTGGGTACA

[0047] The reaction system is as follows:

[0048] Table 2 Fluorescent quantitative PCR system (20 μL)

[0049]

[0050] After mixing the reaction system, the real-time fluorescent quantitative PCR instrument (Applied Biosystems, model 7500 Real-Time PCR System) was used for reaction. The reaction condition was 95 °C pre-denaturation for 10 min, 95 °C denaturation for 15 s, 60 °C annealing and extension for 1 min, and the reaction was ended after 40 cycles of denaturation, annealing and extension. The 2 -△△CT for subsequent data processing.

[0051] Example 2 Resequencing of maize NKT1 gene and candidate gene association analysis

[0052] Randomly selected 125 maize inbred lines (shown in Table 1), using the plant genome DNA extraction kit (product code AG21011) of Aikuer biological company to extract DNA. The 6.3 kb region of the promoter, coding region and UTR region of NKT1 was amplified, and 3 pairs of primers were designed, and the primer sequences were as follows (5'-3'):

[0053] NKT1-Promoter-F: CAGAGAAGACAGGAGGGAAGA (SEQ ID NO. 3)

[0054] NKT1-Promoter-R: GCAGGTTGATTTTTGTGTGG (SEQ ID NO. 4)

[0055] NKT1-G1-F: ATACCTGCACGAGTGACATC (SEQ ID NO. 7)

[0056] NKT1-G1-R: GATTAGGTAGAGGTGCGACGA (SEQ ID NO. 8)

[0057] NKT1-G2-F: CCAACAACGTCAGCAAGTGG (SEQ ID NO. 9)

[0058] NKT1-G2-R: CTCTCTCCCATCACCACTAAAA (SEQ ID NO. 10)

[0059] The primer amplification system and procedure were as follows:

[0060] Table 3 Primer amplification system (50 μL) of promoter and gene region

[0061]

[0062]

[0063] Table 4 Primer amplification procedure of promoter

[0064]

[0065] Table 5 Primer amplification procedure of gene region

[0066]

[0067] The PCR products were sequenced in the first generation, which was completed by Beijing Genecom Biotechnology Co., Ltd. The sequences of the promoter and gene region of each inbred line were spliced by using SeqMan software, and the sequence information of NKT1 gene in 125 maize inbred lines was obtained. The spliced sequences were compared and analyzed by using BioEdit Sequence Alignment Editor software, and were sorted into genotype files. After screening according to the minimum allele frequency (Minor Allele Frequency, MAF) ≥0.05, 146 single nucleotide polymorphism (Single nucleotide polymorphism, SNP) sites and 36 insert and / or deletion (Insert and / or deletion, InDel) sites were identified. Combined with the expression level of NKT1 in the peduncle node of 125 maize inbred lines, candidate gene association analysis was carried out by using TASSEL5.0 software. The results, as shown in Table 6, showed that the SNP(-1278), SNP(-1298), SNP(-1400), SNP(-1430), InDel(-1592) and InDel(-1638) sites located on the promoter had the most significant correlation with the expression level of NKT1 (-Log10(P)=2.767). Figure 1 The results of linkage disequilibrium analysis and mapping by using HaploView software showed that the six sites with the most significant correlation were completely linked (D' = 1.0) (Fig. 1). Figure 1). By PCR amplification, it was found that InDel (-1592) was a 7.1 kb large fragment insertion site. According to the 6 most significant linkage loci, 125 maize inbred lines were divided into two different haplotypes (Haplotype, Hap), Hap 1 (n = 110) and Hap 2 (n = 15). By comparing the expression levels of NKT1 in the ear node between the two haplotypes, it was found that the expression level of NKT1 in the Hap 1 haplotype inbred line was significantly higher than that in the Hap 2 haplotype inbred line Figure 1 ) The above results show that the 6 linkage natural variation sites in the promoter region of NKT1 affect its transcription level.

[0068] Example 3 Verification of functional variation sites of corn NKT1 gene

[0069] Three inbred lines were selected from each of the two haplotype groups, and promoter sequences of different lengths were amplified and constructed into pGreen0800-LUC vectors. After transient expression in corn protoplasts using a dual luciferase reporter system, the effect of different promoters on LUC activity was detected. Plasmid extraction and purification were performed using the plasmid large extraction and purification kit (product code N001) from Weigelas Biotechnology Co., Ltd. Corn protoplast transient transformation experiment: the operation steps are as follows:

[0070] (1) Germinate corn inbred line ND101 with mixed substrate (imported soil: black soil: vermiculite = 1:1:2). Before the first true leaf unfolds, avoid light treatment, and grow until the second leaf fully unfolds. Select the middle part of the second fully unfolded leaf of the yellowing seedling, cut it into a thin filament with a sharp knife, and put it into the enzyme solution.

[0071] (2) Wrap the enzyme solution containing the leaf with tin foil paper, place it in a shaker at a low speed of about 40 rpm, and perform room temperature enzyme reaction for 4-5 h.

[0072] (3) Filter W5 solution, 40% PEG solution and MMG solution in advance for use, and pre-cool the W5 solution.

[0073] (4) Rinse 200-mesh nylon membrane and funnel with pre-cooled W5 solution, filter the enzyme-treated sample with nylon membrane into a new 50-mL centrifuge tube, and perform the whole process gently.

[0074] (5) Adjust the lifting speed of the 4°C centrifuge to the lowest, centrifuge the filtered protoplast solution at 100 x g, 4°C, for 5 min, and carefully discard the supernatant.

[0075] (6) Slowly add 30 mL of W5 solution with a wide-mouth pipette to resuspend the protoplasts, and let them stand on ice for 30 min.

[0076] (7) Prepare 2 mL of round-bottom centrifuge tube, add 16 μg of plasmid to be transformed to the bottom of the tube for standby.

[0077] (8) After ice bath, centrifuge the protoplast solution at 100 x g, 4°C, for 5 min, and carefully aspirate the supernatant. According to the total amount and dosage of the protoplast, add an appropriate amount of MMG solution to resuspend the protoplast.

[0078] (9) Add 200 μL of protoplast solution to the plasmid to be transformed using a cut and burned wide-mouth blue gun head, and mix gently.

[0079] (10) Add 200 μL of 40% PEG solution, mix gently, and place the transformation reaction horizontally for 18 min.

[0080] (11) Add 1 mL of W5 solution to terminate the reaction, mix gently, centrifuge at 100 x g, 4°C, for 3 min, and carefully aspirate the supernatant.

[0081] (12) Add 1 mL of W5 solution, mix gently, place the centrifuge tube horizontally, and place it in a 28°C incubator for 16 h in the dark, then perform dual luciferase reporter gene detection.

[0082] Use the dual luciferase reporter gene detection kit (product code 11402ES80) from Yixing Biotech (Shanghai) Co., Ltd. for detection. The operation steps are as follows:

[0083] (1) After incubation, centrifuge the protoplast at 100 x g, 4°C, for 3 min, and carefully aspirate the supernatant.

[0084] (2) Add 50 μL of lysis solution, incubate on ice for about 10 min, and fully lyse the protoplast.

[0085] (3) Centrifuge at 13,000 x g, 4°C, for 10 min, and carefully aspirate the supernatant into a new 1.5 mL centrifuge tube.

[0086] (4) Thaw the firefly luciferase reaction solution to room temperature, and aliquot 50 μL per tube into a new 1.5 mL centrifuge tube.

[0087] (5) Use Promega GLOMAX TM 20 / 20 luminescence detector for determination. Turn on and warm up for 5 min, reset the system according to Tools-Setting-Reset, set the program as Protocol→Run Promega Protocol→DLR-O-INJ→OK.

[0088] (6) Take 10 μL of supernatant and add it to 50 μL of firefly luciferase reaction solution, mix by blowing and sucking 10 times, and detect the activity of firefly luciferase.

[0089] (7) Take out the sample tube, add 50 μL of Rensonia luciferase reaction solution, mix by blowing and aspiration 10 times, detect the activity of Rensonia luciferase, and the instrument automatically calculates the LUC / REN Ratio value.

[0090] The results are as follows Figure 2 As shown, InDel(-1592) is a 7.1kb large fragment (shown in SEQ ID NO. 6) insertion site. First, 1563bp promoter fragments without this site were amplified from different haplotype inbred lines to construct Zheng58-1563, CI7-1563, Dan340-1563, Zong3-1563, 04K5702-1563, and CIMBL17-1563 vectors. After transient expression in maize protoplasts, LUC activity was detected. The results showed that the 1563bp promoter fragments from the six inbred lines had no significant difference in effect on LUC activity. Figure 2 This indicates that SNP(-1278), SNP(-1298), SNP(-1400), and SNP(-1430) are not functional variants affecting NKT1 expression.

[0091] The promoter fragment was further amplified to 2023 bp, with the Hap 2 haplotype inbred line containing a 460 bp insertion fragment at the InDel(-1592) site (this 460 bp fragment is located at 6643 bp to 7102 bp of the 7.1 kb large fragment sequence shown in SEQ ID NO. 6 above). Vectors Zheng58-2023, CI7-2023, Dan340-2023, Zong3-2023, 04K5702-2023, and CIMBL17-2023 were constructed. After transient expression in maize protoplasts, LUC activity was detected. Compared with the Hap 1 haplotype inbred line, the promoter with the 460 bp insertion fragment showed significantly reduced LUC activity. Figure 2 This indicates that the large insertion at the InDel(-1592) site inhibited the activity of the NKT1 promoter, reducing its transcriptional level. The InDel(-1592) site is a functional variation site that affects NKT1 expression.

[0092] Example 4: Phenotypic detection of different haplotypes of the maize NKT1 gene

[0093] Thirty Hap 1 haplotype inbred lines and 17 Hap 2 haplotype inbred lines were selected for phenotype experiments in normal fertilization (CK) plots and no potassium fertilization (LK) plots in Zhuozhou Experimental Station. The expression levels of NKT1 in the spike node of different haplotype inbred lines in different nutrient plots were detected. The results showed that the expression level of NKT1 in Hap 1 haplotype inbred lines was significantly higher than that in Hap 2 haplotype inbred lines in normal fertilization (CK) plots and no potassium fertilization (LK) plots, and the expression level of NKT1 in low potassium plots was significantly lower than that in normal fertilization plots for the same haplotype inbred line Figure 3

[0094] The potassium content and nitrogen content of the ear leaves of different haplotype inbred lines in different nutrient plots were detected. The potassium ion determination method of corn materials is as follows:

[0095] (1) Place the sample in an 80°C oven to kill the green, and continuously dry for 3-4 days to constant weight.

[0096] (2) Soak the crucible used for the experiment with 0.1N HCl (8.68mL of concentrated hydrochloric acid is taken and added to ddH2O, and then diluted to 1L), and clean it with distilled water after overnight treatment. Dry in an 80°C oven for standby use.

[0097] (3) Weigh the dry sample and record it. If the sample weight is greater than 0.2g, the sample needs to be crushed with a crusher.

[0098] (4) Weigh about 0.2g of crushed sample into the treated crucible, and use a muffle furnace to treat the sample. Set the muffle furnace program: carbonization at 300°C for 3h, and ashing at 575°C for 6h. Turn off the muffle furnace, and carefully take out the crucible when the temperature drops to room temperature.

[0099] (5) Add 20mL of 0.1N HCl to the ashed sample and soak overnight.

[0100] (6) Use a needle-free syringe to mix the leaching liquid, and filter it with a 0.22μm water filter membrane.

[0101] (7) Dilute the filtered solution with 0.1N HCl according to the proportion, and prepare the potassium ion standard curve sample. Use a microwave plasma atomic emission spectrometer (AGILENT, MP4100, USA) to determine the K + content.

[0102] The nitrogen content determination method of corn materials is as follows:

[0103] (1) Place the sample in an 80°C oven to kill the green, and continuously dry for 3-4 days to constant weight.

[0104] (2) Weigh the dry sample and record it. Use a crusher to crush the sample.​

[0105] (3) Preparation of catalyst, sodium sulfate and copper sulfate are mixed in a mass ratio of 10:1 and crushed with a crusher for standby.

[0106] (4) 0.1 g of the crushed sample is weighed in a 50 mL digestion tube, and 0.1 g of the catalyst is added and mixed.

[0107] (5) After wetting the sample with 1 mL of ddH2O, 5 mL of concentrated hydrochloric acid is added to the digestion tube.

[0108] (6) Carefully place the digestion tube on the digestion furnace, and place a bent funnel on the tube opening.

[0109] (7) Turn on the digestion furnace and set the temperature to 220°C. After the temperature of the digestion furnace rises to 220°C, keep it at this temperature for 30 minutes. Adjust the temperature of the digestion furnace to 380°C until the sample appears peacock green. Continue to keep it at this temperature for 1 hour to ensure that the sample is completely digested. Turn off the digestion furnace.

[0110] (8) When the temperature of the digestion furnace decreases to room temperature, carefully remove the digestion tube, wash the bent funnel with ddH2O, and dilute to 50 mL. Insert the rubber plug, mix the digestion solution upside down.

[0111] (9) Filter the mixed and digested solution with a 0.22 μm water filter membrane, dilute it to the appropriate concentration, and prepare a standard curve sample. Use a flow analyzer (AGILENT, MP4100, USA) to detect the nitrogen content.

[0112] Statistical analysis of potassium content in the panicle leaves showed that in the CK and LK plots, the leaf potassium content of the Hap 2 haplotype inbred line with low expression level was significantly lower than that of the Hap 1 haplotype inbred line with high expression level. Figure 3 ) At the same time, the nitrogen content of the panicle leaves of different haplotype inbred lines was measured, and the nitrogen content of the Hap 2 haplotype inbred line was significantly lower than that of the Hap 1 haplotype inbred line in the CK and LK plots. Figure 3 ) The change in the transcription level of NKT1 in different haplotype inbred lines leads to the difference in the potassium content and nitrogen content of the leaves.

[0113] Example 5 Yield analysis of corn NKT1 gene different haplotype

[0114] The change in the expression level of NKT1 in Hap 1 and Hap 2 haplotype inbred lines leads to the difference in the response of corn to different nutrient stress, so whether it will cause the difference in the yield of corn. The present application further analyzes the yield difference of Hap 1 and Hap 2 haplotype inbred lines. In 2017, the high-nitrogen plot and low-nitrogen plot of Anyang Experimental Station Figure 4 A), and in 2018, the high-nitrogen plot and low-nitrogen plot of Anyang Experimental StationFigure 4 B), the ear grain weight of the Hap 1 haplotype inbred line was significantly higher than that of the Hap 2 haplotype inbred line. It is indicated that the Hap 1 haplotype of the NKT1 gene is an excellent haplotype, which can improve the potassium and nitrogen utilization efficiency of the aboveground part of corn by promoting the distribution of potassium and nitrogen from the node to the leaf, thereby obtaining a certain yield advantage. The identification of the excellent allelic variation of the NKT1 gene provides a new breeding idea for the cultivation and improvement of new corn potassium and nitrogen nutrient efficient varieties.

[0115] In summary, the large fragment insertion of InDel(-1592) site on the promoter of corn NKT1 gene leads to the change of NKT1 expression level in different inbred lines, and further affects the potassium content and nitrogen content of corn leaves under different nutrient stress. NKT1 without InDel(-1592) site is an excellent haplotype, and corn inbred lines containing this haplotype have a certain yield advantage. In the breeding process, through the directional selection of NKT1 excellent haplotype, the potassium and nitrogen nutrient distribution efficiency of corn stem node can be improved, which is beneficial to improve the stress resistance and yield of corn.

[0116] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including the changes made by the conventional technology known in the art, which deviates from the range disclosed in the present application.

[0117] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.

Claims

1. The application of maize NKT1 gene in maize breeding of potassium and nitrogen efficient distribution varieties, characterized in that, The application is: promoting the expression of the corn NKT1 gene in corn plants, and cultivating corn potassium and nitrogen efficient distribution varieties. The corn NKT1 gene is shown as SEQ ID NO. 1, and the NKT1 gene encodes a protein shown as SEQ ID NO.

2.

2. Application of corn NKT1 gene in identification of excellent haplotype of corn leaf potassium and nitrogen efficient distribution, characterized in that: The application identifies excellent haplotypes of corn leaf potassium and nitrogen efficient distribution by detecting whether there is a large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene. The haplotype without large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene is an excellent haplotype of corn leaf potassium and nitrogen efficient distribution.

3. The use of the maize NKT1 gene in the identification of maize varieties with high potassium and nitrogen efficiency distribution, characterized in that: The application identifies corn varieties with efficient distribution of potassium and nitrogen in corn leaves by detecting whether there is a large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene. The haplotype without large fragment insertion at the-1592 site in the promoter region of the corn NKT1 gene is a corn variety with efficient distribution of potassium and nitrogen.

4. A kit for detecting corn leaf potassium and nitrogen efficient distribution, wherein the primer pair for detecting the genotype at the-1592 site in the promoter region of the corn NKT1 gene is shown as SEQ ID NO. 3-4.

5. The kit of claim 4 in the application of corn leaf potassium content and nitrogen content phenotype identification.

6. The kit of claim 4 in the application of corn leaf potassium and nitrogen efficient distribution variety improvement.

7. Use of the kit according to claim 4 for the breeding of maize varieties with high efficiency partitioning of potassium and nitrogen nutrients, characterized in that, Based on the detection results of the kit on the genotype of the-1592 site in the promoter region of the corn NKT1 gene, samples homozygous for the deletion of the-1592 site are selected for breeding.

8. The kit of claim 4 in the application of any one of the following: (1) preparing a product for identifying or assisting in identifying the phenotype of corn leaf potassium content and nitrogen content; (2) preparing a product for selecting or assisting in selecting corn potassium and nitrogen nutrient efficient distribution varieties.

Images