System and method for toxic gene protein expression

Abstract

The invention belongs to the technical field of synthetic biology, and particularly relates to a system and a method for toxic gene protein expression. The system comprises a host modified by a cryptographic subsystem, a target gene expression vector and a tRNA vector, the toxic gene protein expression system is obtained by modifying the host, the vector and the target gene, and the toxic gene can be subjected to protein expression by using the system; the problem that toxic gene protein expression products severely interfere with the growth state and mutation of cells of hosts such as escherichia coli is solved, so that the target gene can be successfully expressed in an anti-toxic strain, and the success rate and timeliness of protein synthesis are guaranteed.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology, and in particular relates to a system and method for expressing toxic gene proteins. Background Art

[0002] Synthetic biology is an emerging discipline that has developed in recent years. Its main goal is to design and construct a variety of new devices, networks and biological pathways through DNA-encoded biological component modules. The most critical issue is how to synthesize or modify genes.

[0003] In gene synthesis production, various types of genes are involved, such as genes expressed as cell surface receptors, genes expressed as antibodies, genes expressed as DNA polymerases, genes expressed as salivary amylases, genes expressed as sugar synthesis-related proteins, etc. In general, the gene synthesis process includes splitting the gene into oligo DNA and chemically synthesizing it, and then synthesizing multiple segments of oligo DNA into double-stranded DNA under the action of DNA polymerase. The double-stranded DNA is connected to various DNA vectors by enzyme cutting, enzyme ligation or recombination, and then transformed into Escherichia coli cells for propagation. The propagated plasmid is finally sequenced and verified to obtain the target gene.

[0004] However, after the gene cloning is completed, further protein expression will be performed in the host. Although the gene synthesis / cloning products are not toxic, the protein expression products of some genes (produced by undesired leakage expression, also known as background expression) will seriously interfere with the growth state of host cells such as Escherichia coli, resulting in abnormal bacterial growth or even death. In this application, such genes are referred to as "toxic genes", such as restriction endonuclease genes (restriction endonucleases will cut host DNA to cause toxicity), certain glycosyltransferase genes (adding glycosylation modifications to certain sites of host proteins, resulting in abnormal functions), certain antibody genes (certain antibodies target and bind to host proteins, resulting in inhibition of the activity of the protein), etc. At the same time, Escherichia coli host cells may also spontaneously undergo gene deletion mutations, transversion mutations, insertion mutations, etc. in order to survive due to their inability to tolerate the expression products of some of the above genes, such as EcoRI, BamHI restriction endonucleases, UDG uracil glycosyltransferases, etc., which will seriously affect the success rate and timeliness of gene synthesis.

[0005] More importantly, with the development of synthetic biology, the demand for reconstruction of synthetic pathways for a variety of natural products continues to increase, such as paclitaxel, squalene, lycopene, etc. These synthetic pathways often contain more than a dozen or even dozens of functional genes rearranged into clusters. Functional genes are more likely to produce E. coli host toxicity, and as long as one of these genes is toxic to the E. coli host, the final large plasmid cannot be successfully synthesized. Therefore, solving the synthesis of toxic genes is of great significance to the development of synthetic biology.

[0006] Currently, there are some methods for synthesizing toxic genes: ① Replace the high-copy replicon of the vector with a low-copy replicon. ② Use special strains EPI300 and EPI400 to reduce the vector copy number, reduce the copy number of toxic genes in the host cell, and then reduce leaky expression (i.e. background expression). ③ Use an inhibitory expression sequence, such as adding a LacO sequence to the 5' end of the target gene. ④ Cultivate at low temperature to reduce protein activity. ⑤ Replace the strong promoter with a weak promoter. ⑥ Use a rigorous promoter to more rigorously control leaky expression.

[0007] It is understandable that these methods have changed the characteristics of the vector to a large extent, but they can only reduce the background expression and cannot completely block the leakage expression. More importantly, in actual production, for genes with strong toxicity, even a trace amount of leakage expression will still cause the death of the host bacteria or mutation of the toxic gene, and the use of the above methods still cannot avoid toxicity. Therefore, an expression system that completely blocks leakage expression is needed, and will not have a significant impact on the subsequent application scenarios of the vector carrying the target gene.

[0008] On this basis, in some cases, the synthetic E. coli host toxicity gene needs to be transferred into the E. coli cells for protein expression. Therefore, it is also necessary to develop a system and method suitable for the protein expression of the above toxicity gene. Summary of the invention

[0009] In order to solve the above technical problems, the present invention will provide a system and method that can successfully complete the expression of toxic gene proteins.

[0010] The technical route for achieving the above-mentioned purpose of the present invention is as follows: One of the technical solutions provided by the present invention is a protein expression system of a toxic gene, the system comprising: a host with a modified codon system, a target gene expression vector and a tRNA vector; The host with modified codon system is to perform codon degeneration on the host genome while ensuring normal expression of the host genome, wherein the codon degeneration refers to deleting at least one of the multiple codons encoding the same amino acid, retaining at least one codon, replacing the deleted codon with a synonymous codon, and deleting the tRNA corresponding to the deleted codon; Furthermore, when the deleted codon corresponds to multiple tRNAs, all corresponding tRNAs need to be deleted; Furthermore, after the codon degeneracy and the corresponding tRNA are deleted, it is ensured that the host genome can continue to express normally. If the codon degeneracy and the corresponding tRNA are deleted, it is necessary to select other codons for degeneracy and deletion of the corresponding tRNA.

[0011] Preferably, codons encoding leucine, alanine, glycine, proline, arginine, serine, and threonine are selected for degeneracy; Preferably, codons encoding leucine, arginine, and serine are selected for degeneracy; Optimally, serine was selected for codon degeneracy; Preferably, the host includes but is not limited to Escherichia coli, Bacillus subtilis, Bacillus pumilus, Saccharomyces cerevisiae, Pichia pastoris, etc.; More preferably, the host is Escherichia coli; More optimally, TCT, TCA, TCG, TCC, AGT, and AGC all encode serine, and the codons TCG and TCA encoding serine in the Escherichia coli genome are deleted and replaced with synonymous codons AGC and AGT, respectively, and the tRNAs corresponding to the TCG and TCA codons are deleted: serT (GenBank: 944826) and serU (GenBank: 946492); optimally, Escherichia coli Syn61Δ3 (ev5) obtained by degenerating serine codons and deleting corresponding tRNAs is used as the host cell.

[0012] The target gene expression vector carries the target gene to be expressed after codon modification, wherein the nucleotide sequence of the target gene to be expressed contains at least one of the codons that are degenerate in the host; the target gene is controlled by a T7 promoter; The codon-modified target gene refers to a target gene nucleotide sequence to be expressed that contains at least one of the codons that are degenerate in the host; for example, the codons TCG and TCA encoding serine are degenerate in the host Escherichia coli Syn61Δ3 (ev5), then the target gene to be expressed should contain at least one of TCG and TCA; Furthermore, the target gene is a toxic gene, which refers to a gene that will be toxic to the host or affect cell growth after expression, such as a restriction endonuclease gene (restriction endonucleases will cut host DNA and cause toxicity), certain glycosyltransferase genes (glycosylation modifications are added to certain sites of the host protein, resulting in abnormal functions), certain antibody genes (certain antibodies target and bind to host proteins, resulting in inhibition of the activity of the protein), etc.; further, such as PuvII restriction endonuclease, BsaI restriction endonuclease, EcoRI restriction endonuclease, EcoRV restriction endonuclease, DnaseI nuclease, SSB single-stranded binding protein protein, HupA protein, etc.

[0013] The backbone vector used in the target gene expression vector can be selected from pUC57, pET28a or pENTR4 plasmids, preferably pET28a plasmid; Preferably, the nucleotide sequence of the target gene to be expressed contains at least one of TCG and TCA; Furthermore, the target gene expression vector also contains a resistance gene, and the optimization method of the resistance gene is consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the resistance gene on the target gene expression vector is also degenerate and replaced with other synonymous codons.

[0014] The tRNA vector carries a gene encoding a tRNA deleted in the expression host, and the tRNA encoding gene is controlled by a T7 promoter; the tRNA vector also carries a T7 RNA polymerase encoding gene, and the T7 RNA polymerase encoding gene sequence contains at least one of the codons that are degenerate in the host, and the T7 RNA polymerase encoding gene is controlled by a Lac promoter; The backbone vector used by the tRNA vector is selected from pRARE, pLysS and pREP4 plasmids, preferably pRARE plasmid; Preferably, the tRNA vector carries tRNA encoding genes corresponding to TCG and TCA codons; Further, serT, GenBank No.: 944826; serU, GenBank: 946492; Furthermore, the tRNA vector also contains a resistance gene, and the optimization method of the resistance gene is consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the resistance gene on the tRNA vector is also degenerate and replaced with other synonymous codons.

[0015] Furthermore, the protein expression system also includes an inducer, and the inducer includes: inducer 1: yeast tRNA, and inducer 2: IPTG.

[0016] The second technical solution provided by the present invention is the application of the protein expression system described in the first technical solution, especially in the expression of toxic gene proteins; The toxic gene refers to a gene that will be toxic to the host or affect cell growth after expression, including but not limited to: restriction endonuclease genes (restriction endonucleases will cut host DNA and cause toxicity), certain glycosyltransferase genes (glycosylation modifications are added to certain sites of the host protein, resulting in abnormal functions), certain antibody genes (certain antibodies target and bind to host proteins, resulting in inhibition of the activity of the protein), etc.; further, such as PuvII restriction endonuclease, BsaI restriction endonuclease, EcoRI restriction endonuclease, EcoRV restriction endonuclease, DnaseI nuclease, SSB single-stranded binding protein protein, HupA protein, etc.

[0017] The third technical solution provided by the present invention is a method for expressing a target gene using the protein system of the toxic gene described in the first technical solution, which is specifically as follows: After the target gene expression vector and tRNA vector were co-transformed into the host with modified codon system, the transformants were enriched and cultured until OD 600 The concentration is about 0.6-1.0. Add inducers yeast tRNA and IPTG, and continue to induce expression for 4-6 hours to express protein.

[0018] Furthermore, 10 Units of yeast tRNA and 500 μL of 1 M IPTG were added to every 500 mL of expression system.

[0019] Beneficial effects: The present invention obtains a toxic gene protein expression system by modifying the host, vector and target gene. The system can be used to express the toxic gene protein, change the problem that the toxic gene protein expression product seriously interferes with the growth state and mutation of the host cells such as Escherichia coli, so that the target gene can be successfully expressed in the resistant strain, thereby ensuring the success rate and timeliness of protein synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram of the relationship between the host, vector, and target gene before and after modification in the gene cloning (biosynthesis) system.

[0021] Figure 2 The schematic diagram of the toxic protein expression system is shown in Figure 1. Figure 2A in the middle means before induction of expression, there is no T7 RNA polymerase, no tRNA corresponding to TCG and TCA: without T7 RNA polymerase, tRNA corresponding to TCG and TCA cannot be generated, and without tRNA corresponding to TCG and TCA, complete T7 RNA polymerase cannot be synthesized; Figure 2 When B is induced expression, tRNA is added. At this time, the tRNA of TCG and TCA is incorporated into the synthesis of T7 RNA polymerase to form a complete T7 RNA polymerase. T7 RNA polymerase starts the expression of tRNA genes corresponding to TCG and TCA, and then generates tRNA corresponding to TCG and TCA. tRNA is in turn incorporated into the synthesis of T7 RNA polymerase and toxic genes to form a closed loop.

[0022] Figure 3 This is the pET28a plasmid map.

[0023] Figure 4 This is the plasmid map of pRARE-GG.

[0024] Figure 5 The middle shows the transformation of LB+Amp resistance plate after PuvII-pRARE-GG recombination.

[0025] Figure 6 This is the colony PCR identification picture.

[0026] Figure 7 This is the SDS-PAGE identification result after induced expression of the mixed plasmid of tRNA plasmid and toxic gene expression vector.

[0027] Figure 8 This is the identification result after protein purification.

[0028] Fig. 9 This is the gel run result for diluted protease digestion identification. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of this patent more clear, this patent is further described in detail in combination with specific embodiments. It should be understood that the specific embodiments described here are only used to explain this patent and are not used to limit the present invention.

[0030] As we all know, there are 61 codons corresponding to the 20 amino acids and 3 termination signals, which will produce a "redundant" situation in which multiple codons correspond to the same amino acid, and the codons encoding the same amino acid are called synonymous codons.

[0031] Therefore, in theory, the codons of the E. coli host genome can be degenerated, "redundant" codons can be deleted, replaced with synonymous codons, and the tRNA corresponding to the "redundant" codons can be deleted. Since the degenerate codons are replaced with synonymous codons, the host protein expression will not be blocked.

[0032] As mentioned above, since the tRNA corresponding to the "redundant" codons in the strain is deleted, the vacated "redundant" codons cannot be recognized by the modified strain.

[0033] For the biosynthesis of toxic genes, ① other expression elements on the vector other than toxic genes, such as resistance genes and or sopA, should be kept normally expressed; ② the expression of toxic genes should be completely blocked at the same time. Only by meeting these two requirements can a stable plasmid that can be replicated be obtained. Based on the above analysis and conclusions, the codon-optimized vector can be combined with the toxic gene (containing at least one degenerate codon) and transformed into the above-mentioned modified tRNA-deficient strain, so that the functional genes on the vector, such as resistance genes, sopA and other genes, can be expressed normally, and the target gene (toxic gene) loaded thereon can be cloned and replicated normally, while the expression of the toxic gene can be completely blocked. This is because: the genes on the vector can be codon-optimized, and the degenerate codons can be replaced with synonymous codons, so they can be recognized and translated by the above-mentioned modified tRNA-deficient strain; while the toxic gene contains at least one degenerate codon, and the degenerate codon cannot be recognized by the above-mentioned modified tRNA-deficient strain, the translation of the toxic gene is interrupted, and the toxicity is lost. Finally, the normal synthesis of the toxic gene is achieved, but its translation process is blocked, so that it loses the ability to produce toxicity to cells.

[0034] According to the above principles, it is necessary to perform codon modification on the gene synthesis system including the host, vector and target gene. Among them, the host is codon degenerate, and the tRNA corresponding to the degenerate codon is deleted. The vector is subjected to the same codon degeneracy as the host, and at the same time, it is ensured that the target gene (toxic gene) sequence contains at least one degenerate codon. Even if the mRNA of the toxic gene is produced due to leakage transcription, the translation process of the toxic gene mRNA will be interrupted due to the lack of corresponding tRNA in the host, thereby achieving the purpose of completely blocking the leakage expression of the toxic gene. In this application, these strains that have undergone codon degeneracy modification and tRNA deletion are also referred to as resistant strains. Because it does not contain tRNA with degenerate codons, the resistant strain can theoretically completely block the leakage expression of the toxic gene. The details are as follows: (1) Taking E. coli as an example, the E. coli host genome is subjected to codon degeneration, "redundant" codons are deleted, replaced with synonymous codons, and the tRNA corresponding to the "redundant" codons is deleted. The codon degeneration refers to degenerating the 61 codons corresponding to 20 amino acids and at least one of the three termination signals on the host genome (after degeneration, at least one codon must be retained for each amino acid and terminator to ensure that the host genome can be expressed normally), deleting the degenerated codons, replacing them with synonymous codons, and deleting the tRNA corresponding to the degenerated codons.

[0035] For example, if the codons XXX and YYY (which can represent 3 completely identical nucleotides or 3 completely different nucleotides or 3 non-completely identical nucleotides) both encode AAA amino acids, one of the XXX or YYY codons in the genome can be deleted, and the deleted codons can be replaced with the codons that have not been deleted in XXX and YYY as synonymous codons to ensure the normal expression of the gene, and the tRNA corresponding to the degenerate codons can be deleted at the same time. If the degenerate codon corresponds to multiple tRNAs, all the tRNAs corresponding to it need to be deleted. Specifically, for example, tRNA-serV only recognizes the codons AGT and AGC (encoding serine), and AGT and AGC can only be recognized by tRNA-serV. And TCG, TCA, TCT, and TCC can all encode serine, so the AGT and AGC codons can be deleted, and at least one of TCG, TCA, TCT, and TCC can be used for codon synonymous replacement, and tRNA-serV can be deleted, so that the host cannot read the AGT and AGC codons.

[0036] After the above codon degeneration and tRNA deletion, it is necessary to ensure that the host genome can be expressed normally. If a codon is degenerate and its corresponding tRNA is deleted, resulting in the normal expression of the host genome being blocked, the degenerate codon and its corresponding tRNA need to be replaced. For example, if the degenerate codon is XXX, its corresponding tRNAX is responsible for transporting the amino acid BBB corresponding to the codon ZZZ in addition to transporting XXX, and the deletion of tRNAX will cause the transport of the amino acid BBB corresponding to the codon ZZZ to be blocked, thereby resulting in the normal expression of the host genome being blocked, and the degenerate codon XXX needs to be replaced. If an amino acid AAA is encoded by only two codons XXX and YYY, and XXX and YYY correspond to the same tRNA, then degenerating one of XXX and YYY and deleting its corresponding tRNA will result in the amino acid AAA not being expressed normally, thereby resulting in the host genome not being expressed normally. At this time, the codons of other amino acids need to be replaced for degeneration.

[0037] In short, the following conditions must be met after codon degeneration and corresponding tRNA deletion in the host: ① All tRNAs corresponding to the degenerated codons must be deleted; ② After codon degeneration and corresponding tRNA deletion, ensure that the host genome can continue to express normally.

[0038] Further, the following modifications can be performed according to the codon table, at least one of the codons being modified: TTT and TTC both encode phenylalanine, so one of the TTT or TTC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNA that recognizes TTT and TTC is not the same*, delete the tRNA corresponding to the degenerate codon (*Due to the wobbling characteristics of tRNA, different codons can sometimes be recognized by the same tRNA); TTA, TTG, CTT, CTC, CTA, and CTG all encode leucine, so one or more of the TTA, TTG, CTT, CTC, CTA, and CTG codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport leucine can be retained); ATT, ATC, and ATA all encode isoleucine, so one or more of the ATT, ATC, and ATA codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport isoleucine can be retained); GTT, GTC, GTA, and GTG all encode valine, so one or more of the GTT, GTC, GTA, and GTG codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport valine can be retained); TCT, TCA, TCG, TCC, AGT, and AGC all encode serine, so one or more of the TCT, TCA, TCG, TCA, AGT, and AGC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport serine is retained); CCT, CCA, CCG, and CCC all encode proline, so one or more of the CCT, CCA, CCG, and CCC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport proline is retained); ACT, ACA, ACG, and ACC all encode threonine, so one or more of the ACT, ACA, ACG, and ACC codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport threonine can be retained); GCT, GCA, GCG, and GCC all encode alanine, so one or more of the GCT, GCA, GCG, and GCC codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport alanine can be retained); TAT and TAC both encode tyrosine, so one of the TAT and TAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize TAT and TAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport tyrosine is retained); CAT and CAC both encode histidine, so one of the CAT and CAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize CAT and CAC are not the same, delete one of the corresponding tRNAs (at least keep one tRNA that can transport histidine); CAA and CAG both encode glutamine, so one of the CAA and CAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize CAA and CAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport glutamine is retained); AAT and AAC both encode asparagine, so one of the AAT and AAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AAT and AAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport asparagine is retained); AAA and AAG both encode lysine, so one of the AAA and AAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AAA and AAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport lysine is retained); GAT and GAC both encode aspartic acid, so one of the GAT and GAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize GAT and GAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport aspartic acid is retained); GAA and GAG both encode glutamate, so one of the GAA and GAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize GAA and GAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport glutamate is retained); Both TGT and TGC encode cysteine, so one of the TGT and TGC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize TGT and TGC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport cysteine ​​is retained); CGT, CGA, CGG, CGC, AGA, and AGG all encode arginine, so one or more of the CGT, CGA, CGG, CGC, AGA, and AGG codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport arginine can be retained); AGT and AGC both encode cysteine, so one of the AGT and AGC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AGT and AGC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport cysteine ​​is retained); GGT, GGA, GGG, and GGC all encode glycine, so one or more of the GGT, GGA, GGG, and GGC codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport glycine can be retained); Preferably, the codons encoding leucine, alanine, glycine, proline, arginine, serine, and threonine are selected for degeneracy, because the number of codons corresponding to these amino acids is ≥ 4, which can relatively slightly change the strain genome and relatively little affect the natural state of the host; Preferably, codon degeneracy is selected for leucine, arginine, and serine, because the number of codons corresponding to these amino acids is ≥ 6, which will lessen the change of the strain genome and less affect the natural state of the host; Optimally, serine is selected for codon degeneracy, because serine tRNA has been thoroughly studied, and serine is the active center of most functional proteins, which plays an important role in maintaining protein activity. More optimally, TCT, TCA, TCG, TCC, AGT, and AGC all encode serine. The codons TCG and TCA encoding serine on the E. coli genome are deleted and replaced with synonymous codons AGC and AGT, respectively, and the tRNAs corresponding to the TCG and TCA codons: serT and serU are deleted. This strain is named Syn61Δ3, and the Syn61Δ3 strain is further subjected to several rounds of induced random mutation transformation to obtain its derivative strain Syn61Δ3 (ev5). This application further uses Syn61Δ3 (ev5) as a host to construct a toxic gene synthesis system (the detailed construction process of Syn61Δ3 (ev5) can be found in Chinese invention patent application CN202180101101.6, which can also be purchased from the Addgene official website: Bacterial strain #174514).

[0039] (2) Codon optimization of the vector is performed. Codon optimization is performed on the entire sequence of the vector. The optimization method should be consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the vector is also degenerate and replaced with other synonymous codons.

[0040] Preferably, in order to reduce the workload of vector modification, it is not necessary to optimize the entire sequence of the vector, and only the codons of the relevant functional genes that affect the propagation of the vector are optimized. The functional genes include but are not limited to: ① Resistance screening genes: such as Amp , Kana, CmR etc.; ② Genes that maintain plasmid distribution: such as sopA , sopB , repE etc.; ③Special functional genes, such as those that reduce background expression LacI Genes, etc. Some genes that have no effect on plasmid propagation and strain growth do not need to be optimized, such as Z The gene is just a β-galactosidase used for blue-white spot screening. It has no effect on plasmid propagation and host growth, so no codon optimization is required. Some other vectors, such as the shuttle vector: pCC1BAC plasmid, also have a gene encoding tryptophan, but this gene only needs to be expressed in yeast to function, so there is no need to optimize its codon when Escherichia coli is used as the host.

[0041] The above-mentioned codon-optimized vectors can replicate normally in the aforementioned codon-optimized hosts. At the same time, unmodified E. coli such as DH5α, TOP10, BL21 (DE3) contain complete codons and tRNA, so even codon-optimized vectors can still replicate normally in normal strains.

[0042] (3) The target gene (toxic gene) to be synthesized may or may not be codon optimized. However, regardless of whether codon optimization is performed or not, it is necessary to ensure that the nucleotide sequence of the target gene to be synthesized contains at least one of the degenerate codons in the host. This will prevent the degenerate codons on the toxic gene from being recognized by the modified tRNA-deficient strain, resulting in interruption of toxic gene translation and loss of toxicity.

[0043] In the present invention, the vector is a vector that has undergone codon degeneracy modification. The modified vector can not only replicate normally in the strain with codon degeneracy modification, but also replicate normally in unmodified Escherichia coli such as DH5α, TOP10, BL21 (DE3) and other cells. The strain described in the present invention is a strain that has undergone codon degeneracy modification and tRNA deletion modification. The relationship between the modified vector and the unmodified vector, the modified strain and the unmodified strain, and the toxic gene Figure 1 shown.

[0044] However, in some cases, the host toxicity genes of E. coli synthesized by resistant strains need to be transferred into E. coli cells for protein expression. At this time, when the plasmid containing toxic genes synthesized in the resistant strains is transferred into the existing conventional commercial expression strains (such as BL21 (DE3), Rosetta, etc.), the toxicity will still cause mutation of toxic gene sequences and death of host cells. Therefore, it is necessary to develop a protein expression system so that the above toxic genes can be expressed as proteins.

[0045] Adding tRNA corresponding to TCG and TCA to the original anti-toxic strain expression system can make the toxic gene be expressed as protein, but at this time, the protein expression product of the toxic gene will still cause the host bacteria to die or the toxic gene to mutate. It is thought that tRNA corresponding to TCG and TCA can be introduced into the anti-toxic strain expression system, but before inducing expression, the tRNA corresponding to TCG and TCA is not present in the cell, and a certain number of tRNA corresponding to TCG and TCA must exist during expression. Because before inducing expression, the number of bacteria has reached a sufficient number after a certain period of accumulation, and the presence of tRNA corresponding to TCG and TCA at this time makes the toxic protein expressed in large quantities, even if it causes the death of the host cell, it does not matter, because the number of bacteria is sufficient, and a certain number of toxic proteins must have accumulated in the dead host cells, achieving the purpose of toxic protein expression and accumulation. However, since the commodity tRNA is expensive, directly adding a sufficient amount of tRNA during inducing expression will add a large economic burden to industrial production.

[0046] According to the above ideas, this application designs a protein expression system based on the aforementioned gene cloning (biosynthesis) system as follows: (1) Expression host: the resistant strain obtained by degenerating codons in the aforementioned gene cloning system and deleting the tRNA corresponding to the deleted codons; Preferably, the host is Escherichia coli Syn61Δ3 (ev5); (2) Target gene expression vector: The target gene expression vector carries the target gene (toxic gene) to be synthesized in the aforementioned cloning system, and the nucleotide sequence of the target gene to be synthesized contains at least one of the codons that are degenerate in the host; the target gene is controlled by a T7 promoter; The backbone vector used in the target gene expression vector can be selected from pUC57, pET28a or pENTR4 plasmids, preferably pET28a plasmid; Preferably, the target gene nucleotide sequence to be synthesized contains at least one of TCG and TCA; Furthermore, the target gene expression vector also contains a resistance gene, and the optimization method of the resistance gene is consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the resistance gene on the target gene expression vector is also degenerate and replaced with other synonymous codons.

[0047] (3) tRNA vector: the tRNA vector carries a gene encoding a tRNA deleted in the expression host, and the tRNA encoding gene is controlled by a T7 promoter; the tRNA vector also carries a gene encoding a T7 RNA polymerase, and the sequence of the T7 RNA polymerase encoding gene contains at least one of the codons that have been degenerate in the host, and the T7 RNA polymerase encoding gene is controlled by a Lac promoter; The backbone vector used by the tRNA vector is selected from pRARE, pLysS and pREP4 plasmids, preferably pRARE plasmid; Preferably, the tRNA vector carries tRNA encoding genes corresponding to TCG and TCA codons; Further, serT , GenBank No.: 944826; serU , GenBank: 946492; Furthermore, the tRNA vector also contains a resistance gene, and the optimization method of the resistance gene is consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the resistance gene on the tRNA vector is also degenerate and replaced with other synonymous codons; The principle of the above protein expression system is as follows ( Figure 2 shown): When the above-mentioned target gene expression vector and tRNA vector are transformed into the expression host, because the host cells and the culture medium do not contain tRNA corresponding to TCG and TCA before induction of expression, and both the T7 RNA polymerase and the toxic gene contain at least one or more TCG and TCA codons, at this time, the T7 RNA polymerase cannot be expressed, and the expression of the tRNA genes corresponding to TCG and TCA cannot be initiated. Similarly, the tRNA genes corresponding to TCG and TCA are not expressed, and the T7 RNA polymerase cannot be fully expressed.

[0048] After a period of growth and accumulation, the host cells enter the induced expression stage. At this time, a certain amount of yeast tRNA is added to the culture medium as inducer 1, and inducer IPTG is added as inducer 2.

[0049] The tRNA corresponding to TCG and TCA is incorporated into the synthesis of T7 RNA polymerase as a "trigger", which can synthesize a complete T7 RNA polymerase. The complete T7 RNA polymerase initiates the gene expression of the tRNA corresponding to TCG and TCA on the one hand, and initiates the expression of toxic genes on the other hand. At the same time, the tRNA corresponding to the above-mentioned synthesized TCG and TCA is incorporated into the synthesis of toxic genes, thereby expressing a complete toxic protein.

[0050] Unless otherwise specified, the experimental materials used in the present invention are all commercially available.

[0051] Unless otherwise specified, the test methods used in the present invention are all conventional operating methods in the art.

[0052] In the toxic gene synthesis or protein expression systems constructed in the following examples, the hosts used were all Escherichia coli Syn61Δ3 (ev5), purchased from Addgene; the yeast tRNA used was purchased from Sigma, catalog number 9014-25-9.

[0053] The present invention will be further explained below through specific examples.

[0054] Example 1 Optimization of cloning vector pET28a Expression vector pET28a codon modification: Delete TCG and TCA in the vector gene and replace them with AGC and AGT synonymous codons respectively: Figure 3 This is the plasmid map of pET28a. It can be observed that pET28a contains three genes: resistance screening marker Kan Gene, for expression of repressor protein lacI Gene, maintain plasmid stability rop These three genes all have their functions, so they all need to be codon optimized.

[0055] Original pET28a plasmid (SEQ ID NO.1) Kan The gene contained one TCG codon, which was replaced with AGC, and seven TCA codons, which were replaced with AGT; lacI The gene contained 5 TCG codons, which were replaced with AGC, and 3 TCA codons, which were replaced with AGT; rop The gene contains one TCG codon, which is replaced with AGC; the amino acid sequence expressed before and after the codon replacement remains unchanged. The full-length pET28a vector sequence after the codon replacement is shown in SEQ ID NO.2.

[0056] The entire sequence was sent to Qingke Biotechnology for full gene synthesis and cyclization to obtain the codon-optimized pET28a vector, which was named pET28a-GG.

[0057] Example 2 Optimization of tRNA vector pRARE Select pRARE vector as the basic vector and perform the following steps: Figure 4 Plasmid optimization and transformation: ① Add the coding genes of tRNA corresponding to TCG and TCA codons: serT and serU (serT, GenBank: 944826; serU, GenBank: 946492), and the promoter P t7 control; ② add T7 RNA polymerase encoding gene (GenBank: 1261050) and its promoter P lac Sequence, the gene contains TCG and TCA codons; ③ Cm The resistance gene contains two TCG codons, which are replaced by AGC; three TCA codons, which are replaced by AGT. The amino acid sequence of the expression product remains unchanged after the synonymous codons are replaced; ④ Delete the redundant sequence. The pRARE vector obtained after the above transformation and design is named pRARE-GG: The full sequence is shown in SEQ ID NO.3, and it was submitted to Qingke Company for full sequence synthesis.

[0058] Example 3 Preparation of competent cells of the resistant strain Syn61Δ3 (ev5) (calcium chloride method) ① Inoculate Syn61Δ3 (ev5) one day in advance: aspirate 100 μL of glycerol bacteria into 50 mL of LB medium and culture at 37°C in a shaking incubator overnight (about 20 hours); ② Transfer 15 mL of overnight culture into 500 mL of LB medium and culture vigorously on a shaker at 37°C for about 5 hours (250-300 rpm); ③ Pre-cool 0.1 M CaCl2 solution on ice; ④ When the OD of the bacterial solution reaches 0.4-0.5, take it out and place it on ice to cool for 10 minutes; ⑤ Centrifuge at 3000 rpm for 5 minutes at 4°C; ⑥Discard the supernatant, add 100 mL of pre-cooled 0.1 M CaCl2 solution, gently pipette up and down to mix well to resuspend the cells, and place on ice again for 20 minutes; ⑦ Centrifuge at 3000 rpm for 5 minutes at 4°C; ⑧Discard the supernatant, add 20 mL of pre-cooled 0.1 M CaCl2 + 20% glycerol solution, and gently pipette up and down to mix well to resuspend the cells; ⑨ Store in ultra-low temperature (-70℃) for future use.

[0059] Example 4 Gene cloning of host toxic restriction endonuclease gene PvuII (biosynthesis) Using the toxicity-resistant competent Syn61△3 (ev5) as the host cell, the host toxicity restriction endonuclease gene PuvII was synthesized de novo onto the codon-optimized pET28a-GG vector constructed in Example 1. The restriction endonuclease PvuII gene expression vector was designed and synthesized as follows: Expression of PvuII based on expression vector pET28a: ① The PvuII coding gene contains TCG and TCA codons, and the sequence is shown in SEQ ID NO.4, which was submitted to Qingke Company for full sequence synthesis; ② Using the pET28a plasmid as the backbone, the TCG and TCA codons of the resistance gene on it were replaced with other synonymous codons, named pET28a-GG, as shown in SEQ ID NO.2, and handed over to Qingke Company for full sequence synthesis.

[0060] ③ Recombination, the synthetic product of ① was constructed into the pET28a-GG optimized in ② by homologous recombination, and the obtained recombinant vector was named PuvII-pET28a-GG, the full sequence is shown in SEQ ID NO.5, and the recombination system is as follows:

[0061] React at 50℃ for 30min.

[0062] ④Transformation: Take 5 μL of the recombinant product in ③ and transform it into the chemically resistant Syn61Δ3 (ev5), apply it to LB+Kana resistance plate, and culture it at 37℃ overnight; ⑤ Plate colony status Figure 5 As shown by Figure 5 It can be seen that after the restriction endonuclease PvuII gene expression vector is transformed, there are transformants on the plate, indicating that after the codon system optimization and modification of the host, vector and target gene as described in the present invention, the toxicity of toxic gene cloning expression to the host is solved.

[0063] ⑥ Picking Figure 5 The 8 transformant colonies (transformants 1-8) on the medium plate with Syn61Δ3 (ev5) as the host were identified by PCR. The gene size was 576 bp, plus the 375 bp of the vector sequence at both ends, so the total length of the colony PCR product was about 951 bp. The results are as follows Figure 6 shown.

[0064] Colony PCR identification was performed using the following primers: pET28a-Check-F:tcccgcgaaattaatacgactcactatag pET28a-Check-R:cagcaaaaaacccctcaag A, the reaction system is as follows:

[0065] B, PCR procedure is as follows:

[0066] Identification of bacteria test gel Figure 6 As shown by Figure 6 It can be seen that the target bands were amplified in all 8 transformants, and the positive transformation rate was 100%, which was much higher than the transformation rate of toxic gene cloning in the prior art; the positive transformants of colony PCR were subjected to second-generation sequencing, and the comparison results were completely in line with expectations, indicating that the gene synthesis system of the restriction endonuclease gene PvuII constructed in this example (including Syn61Δ3 (ev5) host cells, optimized expression vector pET28a, and optimized PvuII gene) can block the leakage expression of toxic genes, and enable the host cells to grow normally under the premise of ensuring the normal replication of the expression vector, indicating that the expression product of the system will not be toxic to the host.

[0067] Example 5 Protein-induced expression of host toxic restriction endonuclease gene PvuII ① Double plasmid transformation of virus-resistant strains: A, take 100 ng of the tRNA plasmid pRARE-GG obtained in Example 2 and mix it with 100 ng of the toxic gene expression vector PuvII-pET28a-GG plasmid obtained in Example 4; B, take one tube of toxic-resistant Syn61Δ3 (ev5) competent cells and place it on ice for 5 minutes to allow it to thaw slowly; C. Pipette the mixed plasmid into the competent cells, flick to mix, and place back on ice for 30 minutes. D, heat shock at 42°C water bath for 60 seconds, then put back into ice for 2 minutes; E, add 700 μL M9 liquid medium and resuscitate at 200 rpm in a 37°C incubator for 60 min; F, M9 medium with dual resistance to tucanal (25 μg / mL) and chloramphenicol (15 μg / mL).

[0068] ②Induced expression: A, pick a single clone into 5 mL of M9 liquid medium containing dual resistance to kanamycin (25 μg / mL) and chloramphenicol (15 μg / mL) and culture at 37°C, 250 rpm for 20 h; B. Take 5 mL of the above bacterial solution and transfer it to 500 mL of M9 liquid medium containing dual resistance to kanamycin (25 μg / mL) and chloramphenicol (15 μg / mL). Cultivate at 37°C and 250 rpm for about 5 hours. When the OD value is about 0.6, take a sample. C, add 10 units of yeast tRNA and 500 μL of 1M IPTG, and continue to induce expression at 37°C, 250 rpm for 4 hours; D. Bacteria collection: Divide the bacterial solution into two 250 mL centrifuge bottles and collect the bacteria by centrifugation at 8000 × g for 30 min at 4°C.

[0069] ③Identification and purification: A. Heat lysis of the whole bacteria and SDS-PAGE identification. The results are as follows Figure 7 As shown: Obvious protein expression bands were observed in the induced strain, which were consistent with the position of pure PvuII endonuclease in the control lane.

[0070] B. BNi-NTA gravity column purification: Lysis buffer 1 L composition: 20 mM Tris-HCl pH 7.5, 200 mM NaCl, 5 mM imidazole; The washing solution (1 L) consisted of: 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 20 mM imidazole; The eluent (0.2 L) consisted of: 20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 250 mM imidazole; Enzyme dilution solution (0.1 L) consists of: 20 mM Tris-HCl, pH 7.5, 150 mM NaCl.

[0071] a. Take 2.5 g of bacterial cells, add 25 mL of lysis buffer, supersonicate for 3 seconds and stop for 6 seconds at 600w and No. 12 horn, sonicate for 15 minutes, centrifuge at 15000×g and 4℃ for 30 minutes, and take the supernatant; b, the supernatant was filtered with a 0.45 μm filter and loaded into a 50 mL gravity column filled with 5 mL of filler at a drip rate of about 1 drop / second; c. After loading, add 40 mL of rinse solution for elution; d. After rinsing, add 10 mL of elution buffer for elution and collect the samples in different tubes. Run gel for identification of each tube (tubes 1-9). The identification results are as follows: Figure 8 As shown, more and purer protein was collected in tube 5. TM The purified product was measured by ultra-micro spectrophotometer, and the concentration was 223 ng / μL.

[0072] Use enzyme diluent to dilute the eluted product in tube 5 by 10, 20, 40, 80, 160, 320, 640, 1280, 2560, 5120, and 10240 times, and place on ice for later use.

[0073] C. Perform enzyme digestion identification on the diluted protein, the system is as follows: λDNA (dam-, dcm-) 1 μg; 10× cut buffer 2 μL; diluent 1 μL; ddH2O to 20 μL.

[0074] The sample was placed in a constant temperature of 37°C for reaction, and 5 μL of the enzyme digestion product was run on the gel for identification. Fig. 9 As shown, it can be observed that 1 μL PvuII endonuclease diluted 640 times can still cut 1 μg λDNA (dam-, dcm-) within 15 minutes, indicating that the host toxic protein PvuII endonuclease was successfully expressed in the resistant strain.

[0075] At the same time, the methods described in ① and ② were used to prepare the CK blank group, except that in step ①A, only 100 ng of the toxic gene expression vector PuvII-pET28a-GG plasmid was taken in the CK blank group; in step ①C, only the PuvII-pET28a-GG plasmid was aspirated into the competent cells in the CK blank group; in step ②C, only IPTG was added to the CK blank group without tRNA; the remaining steps were the same as ① and ②. After induction of expression, the whole bacteria were thermally lysed and SDS-PAGE was performed for identification, and the results of the CK blank group were: no band was observed at the position of the PvuII endonuclease.

[0076] It can be seen that the protein expression system and method of the present invention can achieve protein expression of toxic genes.

[0077] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent. It should be pointed out that, for ordinary technicians in this field, the above-mentioned implementation methods can also be modified, combined and improved without departing from the concept of this patent, which all belong to the protection scope of this patent. Therefore, the protection scope of this patent shall be based on the claims.

Claims

1. A protein expression system of a toxic gene, characterized in that: The system comprises: a host with a modified codon system, a target gene expression vector and a tRNA vector; The host with modified codon system is to perform codon degeneration on the host genome, wherein the codon degeneration refers to deleting at least one of multiple codons encoding the same amino acid, retaining at least one codon, ensuring the normal expression of the host genome, replacing the deleted codon with a synonymous codon, and deleting the tRNA corresponding to the deleted codon; The target gene expression vector carries the target gene to be expressed after codon modification, wherein the nucleotide sequence of the target gene to be expressed contains at least one of the codons that are degenerate in the host; the target gene is controlled by a T7 promoter; The tRNA vector carries a gene encoding a tRNA deleted in the expression host, and the tRNA encoding gene is controlled by a T7 promoter; the tRNA vector also carries a gene encoding a T7 RNA polymerase, and the T7 RNA polymerase encoding gene sequence contains at least one of the codons that are degenerate in the host, and the T7 RNA polymerase encoding gene is controlled by a Lac promoter.

2. A protein expression system of a toxic gene according to claim 1, characterized in that: The host is a host that deletes the codons TCG and TCA encoding serine on the Escherichia coli genome, replaces them with synonymous codons AGC and AGT respectively, and deletes the tRNAs corresponding to the TCG and TCA codons: serT and serU.

3. A protein expression system of a toxic gene according to claim 2, characterized in that: The host is Escherichia coli Syn61Δ3 (ev5) cells.

4. A protein expression system of a toxic gene according to claim 1, characterized in that: The target gene is a toxic gene, which refers to a gene that is toxic to the host or affects cell growth after expression, including but not limited to restriction endonuclease genes, glycosyltransferase genes, and antibody genes; Such as PuvII restriction endonuclease, BsaI restriction endonuclease, EcoRI restriction endonuclease, EcoRV restriction endonuclease, DnaseI nuclease, SSB single-stranded binding protein protein, HupA protein, etc.

5. The protein expression system of a toxic gene according to claim 1, characterized in that: The target gene expression vector and the tRNA vector also contain resistance genes, and the optimization method of the resistance genes is consistent with the codon degeneracy of the host.

6. A protein expression system of a toxic gene according to claim 1, characterized in that: The host after codon system modification is Escherichia coli Syn61Δ3 (ev5); the nucleotide sequence of the target gene to be expressed on the target gene expression vector contains at least one of TCG and TCA; and the tRNA vector carries tRNA coding genes corresponding to TCG and TCA codons.

7. A protein expression system of a toxic gene according to claim 6, characterized in that: The host after codon system modification is Escherichia coli Syn61Δ3 (ev5); the target gene expression vector is PuvII-pET28a-GG, and the nucleotide sequence is shown in SEQ ID NO.5; the tRNA vector is pRARE-GG, and the nucleotide sequence is shown in SEQ ID NO.

3.

8. The protein expression system of a toxic gene according to claim 1, characterized in that: The protein expression system further comprises an inducer, which comprises: inducer 1: yeast tRNA, and inducer 2: IPTG.

9. Use of the protein expression system according to any one of claims 1 to 8 in the expression of toxic gene proteins.

10. The use according to claim 9, characterized in that The method for expressing the target gene using the protein system of the toxic gene is as follows: After the target gene expression vector and tRNA vector were co-transformed into the host with modified codon system, the transformants were enriched and cultured until OD 600 The concentration of 50 μg / mL was 0.6-1.0, and the inducers yeast tRNA and IPTG were added to continue inducing expression for 4-6 hours to obtain the target protein.

Images