Application of exogenous drug-resistant gene in genetic transformation of lentinus edodes

Abstract

The invention provides application of an exogenous drug-resistant gene in genetic transformation of lentinus edodes, the exogenous drug-resistant gene is a bar gene, and the application refers to that the bar gene is used as a selection marker of genetic transformation of lentinus edodes. The invention also provides a construction method for genetic transformation of shiitake mushrooms, which comprises the following steps: (1) carrying out GA sensitivity analysis on shiitake mushroom strains, and determining 200 ug / ml GA as the concentration of shiitake mushroom screening transformation; (2) constructing a bar gene binary expression pAgbar vector plasmid; (3) transforming agrobacterium tumefaciens by using a pAgbar vector; and (4) carrying out genetic transformation on agrobacterium tumefaciens-mediated shiitake mushrooms to obtain shiitake mushroom transformants which contain bar genes and have resistance to GA. The invention provides a new tool for introducing an exogenous beneficial target gene into the body of the shiitake mushroom and cultivating a shiitake mushroom genetic engineering strain, and opens up a new path for deeply researching key agricultural traits of the shiitake mushroom.

Description

Technical Field

[0001] The invention relates to the technical field of edible fungus genetic engineering, and in particular to the application of an exogenous drug-resistant gene in the genetic transformation of shiitake mushrooms. Background Art

[0002] Lentinula edodes is a typical wood-rotting fungus belonging to the phylum Basidiomycetes. It is rich in lentinan and has biological properties such as anti-tumor, anti-viral, anti-microbial, immune regulation and cholesterol regulation. It is a food that can be used as both food and medicine, with high nutritional, medicinal and health value.

[0003] Genetic engineering of edible fungi is the frontier field of scientific research on edible fungi. It is not only an important means to study the gene function of edible fungi, but also opens up opportunities for the directional breeding of new varieties with genetic improvement. In contrast to the huge economic, ecological and social effects of the edible fungi industry, the molecular genetics of shiitake mushrooms has made some progress, but it is not enough to provide theoretical support for the technological upgrading of the shiitake mushroom industry. The reason is that the genetic transformation efficiency of shiitake mushrooms is low.

[0004] Agrobacterium tumefaciens-mediated transformation has become the most widely used genetic transformation technology for edible fungi genetic transformation and gene function research due to its wide range of selectable receptor materials, high transformation efficiency and high frequency of T-DNA single copy integration. However, Agrobacterium-mediated fungal genetic transformation requires a large number of non-transformants to screen the target transformants, so choosing an appropriate screening marker is particularly important for improving the genetic transformation efficiency of Lentinus edodes. In the genetic transformation of Lentinus edodes, except for the hygromycin resistance gene-hygromycin phosphotransferase gene (hph or hyg) and the carboxin resistance gene-succinate dehydrogenase iron-sulfur protein subunit (sdh), there are no reports on other resistance screening genes. Although the carboxin resistance gene is derived from the endogenous gene of Lentinus edodes-succinate dehydrogenase iron-sulfur protein subunit point mutation, it is an endogenous resistance screening marker of Lentinus edodes. When it is integrated into the genome, there is a possibility of gene repair, which may affect the subsequent screening of transformants, and the transformant verification process is cumbersome. Therefore, there are few studies on the use of this screening marker in the genetic transformation of Lentinus edodes. Currently, the most frequently used method in the genetic transformation of shiitake mushrooms is to screen transformants using hygromycin resistance, but hygromycin has the disadvantage of a high false positive rate. Therefore, in the genetic screening of shiitake mushrooms, it is urgent to research and develop new resistance markers for screening transformants.

[0005] The bar gene is a herbicide-resistant gene from Streptomyces hygroscopicus. The acyltransferase it encodes can acetylate and inactivate the herbicide Glufosinate-ammonium (GA), thereby conferring resistance to GA to transgenic materials. GA is a broad-spectrum herbicide that inhibits the activity of glutamine synthetase in cells, affects ammonia assimilation and nitrogen metabolism, causes lethal accumulation of ammonia in sensitive non-transformants, and rapidly stops growing, thus achieving a screening effect. Due to the low price of GA, bar is widely used as an effective screening marker in the genetic transformation of plants and filamentous fungi. However, there have been no reports of using bar as a screening marker gene and GA as a resistance screening gene in the genetic transformation research of Lentinus edodes.

[0006] Technical content

[0007] The present invention first provides an application of an exogenous drug-resistant gene in the genetic transformation of shiitake mushrooms, wherein the exogenous drug-resistant gene refers to the bar gene, that is, the present invention provides the bar gene as a screening marker for shiitake mushroom transformants.

[0008] The present invention also provides a method for constructing genetic transformation of Lentinus edodes, comprising the following steps:

[0009] (1) GA sensitivity analysis of shiitake mushroom strains: Select shiitake mushroom strains with a colony diameter of 5-6 cm, and use the punch inoculation method to inoculate them on PDA resistance culture media with GA concentrations (0ug / ml, 200ug / ml, 400ug / ml, 600ug / ml, 800ug / ml, 1000ug / ml) for cultivation. By comparing and observing the growth of the strains under different antibiotic concentrations, the sensitivity of the strains to GA is analyzed. By observing the growth of shiitake mushroom Shenxiang 215-4 under different GA concentrations, it was found that shiitake mushroom Shenxiang 215-4 basically did not grow at a concentration of 200ug / ml GA. Determine 200ug / ml GA as the concentration for shiitake mushroom screening and transformation.

[0010] (2) Construction of pAgbar vector plasmid for binary expression of bar gene

[0011] The Agaricus bisporus gpd promoter Agpd was amplified using the primer pair AbgpdF / AbgpdR using the PYN6981 plasmid as a template;

[0012] Using pDHT-bar as template, the bar gene fragment was amplified with primer pair AbBarF / AbBarR;

[0013] The PCR amplification system was: 25 μl of 2× Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / l primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to make up to a 50 μl system;

[0014] PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min);

[0015] pDHT-Bar was double-digested with BamHI / BcuI endonucleases (Thermo Scientific FastDigest) to recover the pDHT vector backbone, thus obtaining the linearized pDHT vector;

[0016] Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected, and the connection products were transformed into E. coli. Colony PCR was performed with primers M13F / M13R to verify. The plasmid was extracted from the samples verified by PCR and named pAgbar.

[0017] The specific steps of E. coli transformation and PCR verification are as follows:

[0018] Take 100 μL of E. coli competent cells TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) and thaw on ice for 10 minutes; add the above-mentioned ligation product, mix gently, and place on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds, and quickly cool in an ice-water mixture for 5 minutes; (clean bench) add 1 ml of LB liquid, culture at 37°C, 180 rpm for 1 hour; centrifuge the bacterial solution at 5000 rpm for 5 minutes; (clean bench) pour out the supernatant, keep 100 μL (mix by blowing) and apply it to LB solid plate (containing 50 μg / mL kanamycin (purchased from Sangon Biotech), invert and culture at 37°C for 12-18 hours; pick 8 single colonies and streak them onto LB solid plate (containing 50 μg / mL kanamycin), and use M13F / M13R on the vector for colony PCR verification. The PCR amplification system is: 2×Premix Taq Version (TAKARA, RR901A) 10μl, 10μmol / l primers 1μl each, colonies, add water to 20μl system. PCR reaction parameters: 95℃ (3min); 30 cycles: 95℃ (30sec), 58℃ (30sec), 72℃ (1min); 72℃ (15min). After 1.2% agarose electrophoresis, 3 samples were selected for sequencing, and plasmids were extracted from the samples with correct sequencing, and the plasmid was named pAgbar.

[0019] The difference between the pAgbar vector and pDHT-bar lies in the different promoters. pAgbar uses the promoter of Agaricus bisporus gpd to drive the expression of the bar gene, while pDHT-bar uses the promoter of Trpc to drive the expression of the bar gene.

[0020] Among them, the primer pair used for amplification of Abgpd fragment is:

[0021] AbgpdF (SEQ ID NO.1):

[0022] CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG

[0023] AbgpdR (SEQ ID NO.2):

[0024] GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG

[0025] Primer pairs used for amplification of bar fragment:

[0026] AbBarF (SEQ ID NO.3):

[0027] CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC

[0028] AbBarR (SEQ ID NO.4):

[0029] CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG

[0030] Vector verification primer pairs:

[0031] M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG

[0032] M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC

[0033] (3) Genetic transformation of Agrobacterium inoculation with pAgbar vector

[0034] Take out the competent Agrobacterium AGL-1 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) stored at -80℃, thaw on ice for 10 minutes, add 1ul pAgbar plasmid, mix by pipetting, ice bath for 30 minutes, quick freeze with liquid nitrogen for 5 minutes, water bath at 37℃ for 5 minutes, immediately ice bath for 2 minutes, add 1ml LB liquid (clean bench), culture at 28℃, 150rpm for 3 hours; centrifuge at 5000rpm for 5 minutes, pour out the supernatant (clean bench), keep 100ul, take half of it and coat it on LB solid plate (containing 50μg / mL carbenicillin (Carb) and 50μg / mL kanamycin (kan), blow dry, culture at 28℃, invert for 2-2.5d; take 3-5 single colonies and re-streak them on LB solid plate (containing 50μg / mL Carb and 50μg / mL kan), cultured at 28°C, 220 rpm for 2 days, and then the colonies were taken for PCR verification (clean bench). Carbenicillin was purchased from Sangon Biotech.

[0035] PCR amplification system: 2×Premix Taq Version (TAKARA, RR901A) 10μl, primers M13F / M13R 0.5μl each, template is colony, add water to 20μl system. Among them, the amplified fragment of M13F / M13R is about 1kb. Amplification program: 95℃ pre-denaturation 5min, 30 cycles: 95℃ 30s, 56℃ 30s, 72℃ 1min, 72℃ extension 10min.

[0036] (4) Agrobacterium-mediated genetic transformation of Lentinus edodes - obtaining Lentinus edodes transformants containing bar and resistant to GA

[0037] The monokaryotic strain of Lentinus edodes was used as a transformation receptor and transformed by using a fungal genetic transformation method mediated by Agrobacterium tumefaciens; the transformed Lentinus edodes mycelium block was transferred to a PDA resistance plate (containing GA (200ug / ml) + Cef 450ug / ml), and cultured at 25°C until resistant colonies appeared, thereby obtaining the desired Lentinus edodes transformants;

[0038] The culture medium and specific transformation method used for transformation are as follows:

[0039] Culture medium used during transformation:

[0040] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl.

[0041] IM solid medium (1L): 400ml 2.5×mm salt solution / l, 5ml glycerol / l, 0.9g / l glucose, 15g / l agar powder (add 200μmol / l acetosyringone and 40mmol / l MES before use), high temperature sterilization at 121℃ for 15min.

[0042] IM liquid medium (1L): 400ml 2.5×mm salt solution / l, 5ml glycerol / l, glucose 1.8g / l, (add 200μmol / l acetosyringone and 40mmol / l MES before use), store in dark)

[0043] 2.5×MM salts (liquid, 1L): KH2PO4 3.625g, K2HPO4 5.125g, MgSO4 7H2O 1.250g, NaCl 0.375g, CaCl2 2H2O, 0.165g, FeSO4.7H2O 0.0062g, (NH4)2SO4 1.250g, water 1L.

[0044] PDA medium: purchased from BD

[0045] Agrobacterium culture:

[0046] Inoculate Agrobacterium with pAgbar vector in 3mL LB (kan+Carb) liquid medium, culture at 28°C, 200rpm, for 14-20h; in a clean bench, take 2mL of Agrobacterium bacterial solution and place it in a centrifuge tube, 12000rpm, 2min, discard the supernatant, add 1mL IM liquid medium to resuspend the bacteria, aspirate 500μL of bacterial solution and add it to 5mL IM liquid medium, culture at 28°C, 200rpm, for 4h and adjust it to OD600=0.3-0.4.

[0047] Infection and co-cultivation:

[0048] Take the monokaryotic strain of Lentinula edodes Shenxiang 215-4 cultured on PDA medium for 15 days, use a 10ul or 200ul pipette tip to punch a hole to take the hyphae near the edge, and inoculate it into IM liquid medium. After ultrasonication (53kHz, 1min), mix it with Agrobacterium cultured for 4 hours, and continue to culture on a shaking table for 2 hours at 25℃ and 50rpm. Discard the Agrobacterium, move the hyphae block to an IM solid plate covered with filter paper, and use the hyphae without Agrobacterium as a control; culture at 25℃ in the dark for 3 days;

[0049] The principle of screening shiitake mushroom transformants is as follows:

[0050] PDA medium containing 200ug / ml GA resistance is used as the screening medium. When the pAgbar plasmid is integrated into the genome and the expression of the bar gene is started, the transformants transformed with the pAgbar plasmid will grow on the resistance plate, while the strains not transformed with the pAgbar plasmid cannot grow.

[0051] Identification of transformants containing the bar gene

[0052] The transformants growing on PDA resistant plates were selected, their genomes were extracted by CTAB method and verified by PCR, and the untransformed recipient strain 215-4 was used as a control.

[0053] The above-mentioned construction method for genetic transformation of Lentinus edodes is applicable to all Lentinus edodes strains, and is particularly applicable to the Shenxiang 215-4 strain.

[0054] The present invention also provides a pAgbar plasmid containing the bar gene constructed by the above method; and a Lentinus edodes transformant containing the bar screening gene constructed by the above genetic transformation method.

[0055] The application of the bar gene screening marker provided by the present invention in the genetic transformation of Lentinus edodes has the following innovative features and beneficial technical effects:

[0056] Resistance screening is a time-consuming and most critical step in the fungal genetic transformation process. The selection of resistance markers is very important for fungal genetic transformation. In the genetic transformation of shiitake mushrooms, no research has been seen on using bar as a resistance gene and glufosinate-ammonium as resistance to screen transformants. In addition, the genetic transformation efficiency of filamentous fungi is closely related to the type of vector selected. In Agrobacterium-mediated genetic transformation of shiitake mushrooms, pCAMBIA series is mainly used as a backbone vector, and hygromycin is used for resistance screening. The present invention is aimed at the characteristics of few available resistance screening markers in shiitake mushrooms, uses the commonly used expression vector pDHT in filamentous fungi as a backbone, utilizes the Agaricus bisporus gpd promoter to drive the expression of bar, and successfully realizes the genetic transformation of shiitake mushrooms using glufosinate-ammonium GA as a resistance screening marker.

[0057] The successful development of the pDHT binary vector, pAgbar vector and GA marker provides new available screening markers for in-depth research on their gene functions, provides new tools for cultivating genetically engineered strains of shiitake mushrooms, and opens up new paths for in-depth research on the key agricultural traits of shiitake mushrooms. This system may also be applicable to the genetic transformation of other basidiomycete edible fungi.

[0058] The present invention significantly shortens the time for transformant strain identification by changing the culture method of the strain. In previous studies, the strain needed to be inoculated on a PDA medium covered with a layer of cellophane and cultured for 10 days before the material could be taken for genome extraction. Laying the cellophane was not only time-consuming, but also easily led to contamination of the strain. Placing a layer of cellophane on the culture medium also delayed the growth of the strain. The present invention adopts the method of directly digging out the strain grown on the culture medium for 4-5 days for genome extraction, which significantly shortens the time for transformant strain identification and shortens the experimental cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 Determination of Sensitivity of Lentinus edodes to GA

[0060] Figure 2 Construction and schematic diagram of pAgbar vector

[0061] (A) is the pDHT linearized vector obtained by double restriction digestion of pDHT-bar, (B) is the Agpd fragment, and (C) is

[0062] bar fragment, (D) is the verification of pAgbar vector, and (E) is the schematic diagram of pAgbar vector construction.

[0063] Figure 3 pAgbar vector map

[0064] Figure 4 The culture medium used for rescreening of Shenxiang 215-4 transformants was PDA containing 200ug / ml GA. The middle one was the control strain 215-4 (wt), and the colonies around it were transformants.

[0065] Figure 5 Growth of Shenxiang 215-4 transformants on PDA plates

[0066] The middle one is the control strain 215-4 (wt), and the surrounding colonies are transformants.

[0067] Figure 6 PCR verification of resistant transformants of Shenxiang 215-4

[0068] bar is an exogenous gene; 18s is an internal reference gene of Lentinus edodes.

[0069] 1-14: transformant strains containing bar, of which 1-7 are strains before mitosis and 8-14 are strains after mitosis; wt: Shenxiang 215-4; pc: pAgbar plasmid, used as positive control; nc: negative control using water as template, M: marker2000. DETAILED DESCRIPTION

[0070] The following examples are only used to explain or illustrate the present invention, and are not intended to limit the present invention.

[0071] Unless otherwise specified, the reagents, materials or instruments used in the examples are common commercially available products.

[0072] All primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; all gene sequences were also determined by Shanghai Sangon Biotechnology Co., Ltd.

[0073] The sequence of the Agpd fragment is shown in SEQ ID NO.11;

[0074] GAAGAAGCATTAAGAGGTCCGCAAGTAGATTGAAAGTTCAGTACGTTTTTAGCAAT

[0075] AGAGCATTTCGAGGCTTGCGTCATTCTGTGTCAGGCTAGCAGTTTATAAGCGTTGA

[0076] GGATCTAGAGCTGCTGTTCCCGCGTCTCGAATGTTCTCGGTGTTTAGGGGTTAGCA

[0077] ATCTGATATGATAATAATTTGTGATGACATCGATAGTACAAAAACCCCAATTCCGGTCACATCCACCATCTCCGTTTTCTCCCATCTACACACAACAAGCTAATCGCC(276bp)

[0078] The sequence of the bar gene fragment is shown in SEQ ID NO.12;

[0079] ATGAGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGC

[0080] CGGCGGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCG

[0081] TACCGAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGA

[0082] GCGCTATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTAC

[0083] GCGGGCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTG

[0084] TACGTCTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACC

[0085] TGCTGAAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCT

[0086] GCCCAACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGC

[0087] ATGCTGCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGGC

[0088] AGCTGGACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGATCTGATGA(555bp)

[0089] The sequence of the bar specific fragment is shown in SEQ ID NO.13:

[0090] AGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGCCG

[0091] GCGGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCGTA

[0092] CCGAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGAGC

[0093] GCTATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTACGC

[0094] GGGCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTGTA

[0095] CGTCTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACCTG

[0096] CTGAAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCTGC

[0097] CCAACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGCAT

[0098] GCTGCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGGCAG

[0099] CTGGACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGATC(546bp)

[0100] The specific fragment of Lentinus edodes Shenxiang 215-4 strain, the sequence is shown in SEQ ID NO.14 GCCTGGAAGTTTTGACGGTGCTATAAGGTGTGTCAACCATCTGCCTCCTTCAAAATTCGATCTGTAACACATATGTCTCGATCTTTCAGTATATCCGTTCTGCAATGGCTGCTTAACGCAGAAACATCTCATCCTACATCTTCACCACCACATAGGCTCAATAGATTCTTCACCACCCTTCATTCTGCTCTTCGGA (196 bp)

[0101] Example 1 Construction of resistant transformants of Lentinula edodes Shenxiang 215-4

[0102] (1) GA sensitivity analysis

[0103] Several strains with a colony diameter of 5-6 cm were selected (Shiitake mushroom: Shenxiang 215-4; Black fungus: Mudan No. 1; Ganoderma lucidum: Hunong No. 1; all of which were preserved and provided by the Strain Collection Center of the Institute of Edible Fungi of Shanghai Academy of Agricultural Sciences), and were inoculated on PDA (purchased from BD Company) resistance medium with GA concentrations (0ug / ml, 200ug / ml, 400ug / ml, 600ug / ml, 800ug / ml, 1000ug / ml) using the punch inoculation method for culture. The growth of the strains under different antibiotic concentrations was compared and observed to analyze the sensitivity of the strains to GA. GA was purchased from Hubei Jiahui Xingcheng Biotechnology Co., Ltd.

[0104] pass Figure 1 It can be seen that Lentinula edodes Shenxiang 215-4 did not grow at a concentration of 200ug / ml GA. 200ug / ml GA was determined as the concentration for screening transformants.

[0105] (2) Construction of pAgbar vector plasmid for binary expression of bar selection marker gene

[0106] The PYN6981 plasmid (provided by the Genetics Laboratory of the Edible Fungi Research Institute of Shanghai Academy of Agricultural Sciences) was used as a template and the synthetic primer pair AbgpdF / AbgpdR was used to amplify the Agaricus bisporus gpd promoter Agpd;

[0107] Using pDHT-bar as a template (pDHT-bar was donated by Dr. Wang Chengshu from the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences), AbBarF / AbBarR amplified the bar gene fragment;

[0108] The amplification system was: 2×Phanta Max Master Mix (vazyme) 25 μl, 1 μl of each 10 μmol / l primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to make a 50 μl system;

[0109] PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min);

[0110] Agpd fragment (276 bp, SEQ ID NO.11) and bar fragment (555 bp, SEQ ID NO.12) were recovered by 1.2% agarose electrophoresis. pDHT-bar was double-digested with BamHI / BcuI to recover the pDHT vector backbone (about 7421 bp), i.e., the linearized pDHT vector.

[0111] Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected using the kit (EZ-HiFi Seamless Cloning Kit, GenStar, T196) from Beijing Kangrun Chengye Biotechnology Co., Ltd. The ligation product was transformed into Escherichia coli and verified by colony PCR using primer pair M13F / M13R. The plasmid was extracted from the sample verified by PCR and named pAgbar.

[0112] The specific steps of E. coli transformation and PCR verification are as follows:

[0113] Take 100 μL of competent E. coli TOP10 and thaw it on ice for 10 min; add the above-mentioned ligation product, mix gently, and place on ice for 30 min; heat shock in a 42°C water bath for 90 s, and quickly cool in an ice-water mixture for 5 min; (clean bench) add 1 ml of LB liquid (without antibiotics), and culture at 37°C, 180 rpm for 1 h; centrifuge the bacterial solution at 5000 rpm for 5 min; (clean bench) pour off the supernatant, keep 100 μL (mix by pipetting), apply it to an LB plate (containing kan), and culture it inverted at 37°C for 12-18 h; pick 8 single colonies and streak them onto the LB plate (containing kan), and use M13F / M13R on the vector for colony PCR verification. M13F / M13R primer sequence (same as above), amplification system: 2×PremixTaq Version (TAKARA, RR901A) 10μl, 10μmol / l primers 1μl each, colony, add water to 20μl system. PCR reaction parameters: 95℃ (3min); 30 cycles: 95℃ (30sec), 58℃ (30sec), 72℃ (2min); 72℃ (15min). After 1.2% agarose electrophoresis, 3 samples of target size were selected for sequencing, and plasmids were extracted from the samples with correct sequencing, and the plasmid was named pAgbar.

[0114] The difference between the pAgbar vector and PDHT-bar is that the promoters are different. pAgbar uses the promoter of Agaricus bisporus gpd to drive the expression of the bar gene, while pDHT-bar uses the promoter of Trpc to drive the expression of the bar gene ( Figure 2-3 ).

[0115] Primers used for amplification of Abgpd fragment

[0116] AbgpdF (SEQ ID NO.1):

[0117] CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG

[0118] AbgpdR (SEQ ID NO.2):

[0119] GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG

[0120] Primers used for amplification of bar fragment

[0121] AbBarF (SEQ ID NO.3):

[0122] CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC

[0123] AbBarR (SEQ ID NO.4):

[0124] CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG

[0125] Universal primers for vector verification:

[0126] M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG

[0127] M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC

[0128] (3) Genetic transformation of Agrobacterium inoculation with pAgbar vector

[0129] Take out the competent Agrobacterium AGL-1 (100ul) stored at -80℃, thaw on ice for 10min, 1ul pAgbar plasmid, mix by pipetting, ice bath for 30min, quick freeze in liquid nitrogen for 5min, water bath at 37℃ for 5min, ice bath immediately for 2min, add 1ml LB liquid (without antibiotics) (clean bench), culture at 28℃, 150rpm for 3h. Centrifuge at 5000rpm for 5min, pour out the supernatant (clean bench), keep 100ul, take half of it and coat it on LB plate (containing Kan+Carb), blow dry, culture at 28℃, invert for 2-2.5d. Take 3-5 single colonies, re-streak them on LB plate (containing Kan+Carb), culture at 28℃, 220rpm for 2d, and take them for colony PCR verification (clean bench).

[0130] PCR amplification system: 2×Premix Taq Version (TAKARA, RR901A) 10μl, M13F / M13R 0.5μl each, the template is the colony, add water to 20μl system. Among them, the amplified fragment of M13F / M13R is about 1kb. Amplification program: 95℃ pre-denaturation 5min, 30 cycles: 95℃ 30s, 56℃ 30s, 72℃ 1min, 72℃ extension 10min.

[0131] (4) Agrobacterium-mediated genetic transformation of Lentinus edodes - obtaining Lentinus edodes transformants resistant to GA

[0132] The monokaryotic strain 215-4 of Lentinula edodes Shenxiang 215 was used as the transformation recipient. The transformation was carried out using the fungal genetic transformation method mediated by Agrobacterium tumefaciens. The culture medium and specific transformation method used were as follows:

[0133] Culture medium used during transformation:

[0134] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl.

[0135] IM solid medium (1L): 400ml 2.5×mm salt solution / l, 5ml glycerol / l, 0.9g / l glucose, 15g / l agar powder (add 200μmol / l acetosyringone and 40mmol / l MES before use), high temperature sterilization at 121℃ for 15min.

[0136] IM liquid medium (1L): 400ml 2.5×mm salt solution / l, 5ml glycerol / l, glucose 1.8g / l, (add 200μmol / l acetosyringone and 40mmol / l MES before use), store in dark)

[0137] 2.5×MM salts (liquid, 1L): KH2PO4 3.625g, K2HPO4 5.125g, MgSO4 7H2O 1.250g, NaCl 0.375g, CaCl2 2H2O, 0.165g, FeSO4.7H2O 0.0062g, (NH4)2SO4 1.250g, water 1L.

[0138] PDA medium: purchased from BD

[0139] Agrobacterium culture:

[0140] Inoculate Agrobacterium with pAgbar vector in 3mL LB (kan+Carb) liquid medium, culture at 28°C, 200rpm, for 14-20h; in a clean bench, take 2mL of Agrobacterium bacterial solution and place it in a centrifuge tube, 12000rpm, 2min, discard the supernatant, add 1mL IM liquid medium to resuspend the bacteria, aspirate 500μL of bacterial solution and add it to 5mL IM liquid medium, culture at 28°C, 200rpm, for 4h and adjust it to OD600=0.3-0.4.

[0141] Infection and co-cultivation:

[0142] Take the monokaryotic strain of Lentinula edodes Shenxiang 215-4 (colony diameter 5-6cm) cultured on PDA medium for 12-15 days, use a 10ul or 200ul pipette tip to punch a hole to take the hyphae near the edge, and inoculate it into IM liquid medium. After ultrasonication (53kHz, 1min), mix it with Agrobacterium cultured for 4 hours, and continue to culture on a shaking table for 2 hours at 25℃ and 50rpm. Discard the Agrobacterium, move the hyphae block to the IM solid plate covered with filter paper, and use the hyphae without Agrobacterium as a control; culture at 25℃ in the dark for 3 days;

[0143] Screening culture:

[0144] The mycelial block of Lentinus edodes Shenxiang 215-4 was transferred to a PDA resistance plate (containing GA (200ug / ml) + Cef 450ug / ml), and cultured at 25°C until resistant colonies appeared, thus obtaining the desired Shenxiang 215-4 transformants.

[0145] Transformant screening principle:

[0146] PDA medium containing 200ug / ml GA resistance is used as the screening medium. When the pAgbar plasmid is integrated into the genome and the expression of the bar gene is started, the suspected transformants will grow on the resistance plate, and the strains that have not been transformed with the pAgbar plasmid cannot grow.

[0147] Example 2 Rescreening and identification of transformants of Lentinula edodes Shenxiang 215-4: ( Figure 4-6 )

[0148] Transformants were screened using PDA resistance plates (culture medium containing 200ug / ml GA resistance). Some transformants were randomly picked from the selection plates where colonies grew and transferred to PDA plates without resistance. After five consecutive transfers, they were inoculated on PDA plates containing GA. After cultivation, it was found that they could still grow on the resistance plates. Different transformants had different growth rates on the resistance plates.

[0149] The resistant transformants of Lentinus edodes were transferred to PDA resistance plates (containing GA 200ug / ml) and subcultured, repeated 3 times, with the recipient strain 215-4 as a control.

[0150] The transformants were picked and transferred to PDA medium plates, and after five consecutive transfers, they were transferred to PDA resistance plates. The transformants grown on PDA resistance plates were selected, and their genomes were extracted by CTAB method and verified by PCR, while the untransformed recipient strain was used as a control.

[0151] CTAB method for genome extraction: the mycelium was placed in a 2 ml centrifuge tube containing steel beads, and then placed in a freezing grinder (Shanghai Bannuo) for crushing. The grinder was set at 60 Hz for 60 seconds, and the tube was vibrated twice continuously. 500 ul of CTAB extract was added, mixed and incubated at 55°C for 15 min, an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added, mixed by inversion, centrifuged at 10,000 rpm for 5 min, the supernatant was taken and an equal volume of cold anhydrous ethanol was added, inverted 3-5 times, placed in a -20°C refrigerator for 30 min, centrifuged at 12,000 rpm for 10 min, the supernatant was poured out, centrifuged for 10 seconds, the liquid on the tube wall was discarded, the tube tip was aspirated dry, and the tube was opened and allowed to stand at room temperature for 5 min. After evaporation, 100 ul of ddH2O was added, and the tube was placed in a 4°C refrigerator for 3 h to dissolve the DNA precipitate.

[0152] CTAB extraction solution (200ml): CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20ml (pH 8), 0.5M EDTA 8ml. PCR amplification system: 2×Premix Taq Version (TAKARA, RR901A) 10μl, primer pair 0.5μl, genomic DNA template 1μl (50ng), add water to 20μl system. Amplification program: 95℃ pre-denaturation 5min, 30 cycles: 95℃ 30s, 58℃ 30s, 72℃ 1min, 72℃ extension 10min.

[0153] Bar verification primers (amplification of partial genes):

[0154] YZbarF(SEQ ID NO.7):AGCCCAGAACGACGCCCGGC

[0155] YZbarR(SEQ ID NO.8):GATCTCGGGTGACGGGCAGGAC

[0156] Primers for the 18s internal reference gene of Lentinus edodes:

[0157] 18sF (SEQ ID NO.9): GCCTGGAAGTTTTGACG

[0158] 18sR (SEQ ID NO.10):TCCGAAGAGCAGAAATGAA

[0159] The results showed that, except for the wild-type strain 215-4, the YZbarF / YZbarR primer-resistant transformants were able to amplify a 546bp (SEQ ID NO.13) bar-specific fragment, and the 18sF / 18sR primers were able to amplify a 196bp fragment (a specific fragment of the Shiitake mushroom Shenxiang 215-4 strain, the sequence is shown in SEQ ID NO.14), indicating that the results of genome amplification are reliable. The above results show that the pAgbar vector has been integrated into the Shenxiang 215-4 genome ( Figure 6 ). The results of GA resistance screening, transformant mitosis resistance stability detection and bar resistance gene detection showed that the GA resistance of the transformant was stable during the mitosis process of Lentinus edodes.

Claims

1. An application of an exogenous drug resistance gene in the genetic transformation of shiitake mushrooms, characterized in that The exogenous drug-resistant gene is the bar gene, and the application refers to the bar gene being used as a screening marker for genetic transformation of shiitake mushrooms.

2. A method for constructing genetic transformation of Lentinus edodes, characterized in that The steps include: (1) GA sensitivity analysis was performed on the shiitake mushroom strains, and 200ug / ml GA was determined as the concentration for shiitake mushroom screening and transformation; (2) Construction of pAgbar vector plasmid for binary expression of bar gene The Agaricus bisporus gpd promoter Agpd was amplified using the primer pair AbgpdF / AbgpdR using the PYN6981 plasmid as a template; Using pDHT-bar as template, the bar gene fragment was amplified with primer pair AbBarF / AbBarR; pDHT-bar was double-digested with BamHI / BcuI endonucleases to recover the pDHT vector backbone and obtain the linearized pDHT vector; Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected, and the connection products were transformed into E. coli. Colony PCR was performed with primers M13F / M13R to verify. The plasmid was extracted from the samples verified by PCR and named pAgbar. Among them, the primer pair used for amplification of Abgpd fragment is: AbgpdF (SEQ ID NO.1): CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG AbgpdR (SEQ ID NO.2): GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG Primer pairs used for amplification of bar fragment: AbBarF (SEQ ID NO.3): CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC AbBarR (SEQ ID NO.4): CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG Vector verification primer pairs: M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC (3) pAgbar vector transformation of Agrobacterium (4) Agrobacterium-mediated genetic transformation of Lentinus edodes - obtaining Lentinus edodes transformants containing the bar gene and resistant to GA The monokaryotic strain of Lentinus edodes is used as a transformation receptor and transformed by using a fungal genetic transformation method mediated by Agrobacterium tumefaciens; the transformed Lentinus edodes mycelium block is transferred to a PDA resistance plate and cultured at 25°C until resistant colonies appear, thereby obtaining the desired Lentinus edodes transformants; The PDA resistance plate contained GA 200ug / ml and Cef 450ug / ml.

3. The method for constructing genetic transformation of Lentinus edodes according to claim 2, wherein the Lentinus edodes is Shenxiang 215-4.

4. In the method for constructing genetic transformation of Lentinus edodes as claimed in claim 2, the pAgbar plasmid prepared in step (1) is used.

5. The shiitake mushroom transformant containing the bar gene prepared by the construction method of shiitake mushroom genetic transformation according to claim 2.

6. The shiitake mushroom transformant containing the bar gene according to claim 5, wherein the shiitake mushroom is Shenxiang 215-4.

Images