Construction method of flammulina velutipes genetic transformation system

Abstract

The invention discloses a construction method of flammulina velutipes genetic transformation. The construction method comprises the following steps: (1) carrying out glufosinate-ammonium sensitivity analysis on flammulina velutipes strains; (2) constructing a carrier plasmid containing the bar gene, wherein the constructed carrier plasmid containing the bar gene is a pAgbar carrier plasmid or a pAgbarG carrier plasmid; (3) transforming agrobacterium tumefaciens by using a pAgbar carrier or a pAgbarG carrier; and (4) carrying out genetic transformation on agrobacterium tumefaciens-mediated flammulina velutipes to obtain flammulina velutipes transformants which contain bar genes and have resistance to glufosinate-ammonium. Aiming at the defects of few available resistance selection markers and carrier frameworks in flammulina velutipes, an agaricus bisporus gpd promoter is used for driving bar expression, genetic transformation of flammulina velutipes with glufosinate-ammonium as the resistance selection marker is successfully realized, and possibility is provided for cultivating new varieties with specific characters.

Description

Technical Field

[0001] The invention relates to the technical field of edible fungus genetic engineering, and in particular to a method for constructing a genetic transformation system of Flammulina velutipes. Background Art

[0002] Flammulina filiformis is one of the earliest edible fungi to be cultivated in factories in China. Due to its high nutritional properties and medicinal value, it is cultivated in many countries and regions around the world. Its output accounts for more than 10% of the world's cultivated edible fungi. It has become one of the most popular and most consumed edible fungi in the world. With the development of the Flammulina filiformis industry, it is urgent to cultivate new varieties of Flammulina filiformis with stable high yield, excellent quality, better taste and stronger resistance. The premise of cultivating new varieties through molecular biological genetic improvement is to find the key genes of traits, and a stable and efficient genetic transformation system is the key technology for studying gene functions.

[0003] Genetic transformation methods for Flammulina velutipes include polyethylene glycol-mediated method, electroporation method, gene gun method, restriction enzyme-mediated integration method, etc. However, these methods are limited in their application in gene function research due to their complex operation or low transformation efficiency. In contrast, Agrobacterium tumefaciens-mediated transformation has attracted widespread attention and application due to its advantages such as simple operation, high transformation efficiency, and low requirements for receptor materials. Agrobacterium-mediated fungal genetic transformation includes the infection of Agrobacterium and the screening of transformants. At present, the hygromycin resistance gene-hygromycin phosphotransferase gene (hph or hyg) is mainly used for the screening of transformants in the genetic transformation of Flammulina velutipes, and there is no report on the use of other screening markers for genetic transformation. With the development of molecular biology technology and the advancement of genetic improvement technology, the research on Flammulina velutipes will shift from the study of single genes to the study of more complex gene regulatory networks. This shift also means that new resistance screening markers are needed to support these complex gene operations. In the molecular genetic research of Flammulina velutipes, there are few resistance screening markers, and a single resistance screening will not meet the needs of multi-gene regulatory networks, and new resistance screening markers are urgently needed.

[0004] Glufosinate-ammonium (GA) is a widely used and inexpensive broad-spectrum herbicide. Its mechanism of action is to inhibit the function of intracellular glutamine synthetase, causing non-transgenic materials sensitive to glufosinate to quickly stop growing due to the accumulation of ammonia. The bar gene is a herbicide-resistant gene derived from Streptomyces hygroscopicus. The acyltransferase encoded by the bar gene can inactivate GA by acetylation, thereby conferring resistance to glufosinate on transgenic materials. As an effective screening marker, the bar gene is widely used in the genetic transformation of plants and filamentous fungi. So far, there has been no report on the use of the bar gene as a screening marker and glufosinate as a resistance screening agent in the genetic transformation of Flammulina velutipes.

[0005] Technical content

[0006] The present invention first provides a method for constructing a genetic transformation system of Flammulina velutipes, comprising the following steps:

[0007] (1) The GA sensitivity of Flammulina velutipes strains was analyzed, and it was determined that the antibacterial concentration of GA on Flammulina velutipes Dan3 was 500ug / ml on PDA medium and 16ug / ml on M-100 medium;

[0008] (2) Construction of a vector plasmid containing the bar gene, wherein the constructed vector plasmid containing the bar gene is a pAgbar vector plasmid or a pAgbarG vector plasmid;

[0009] The pAgbar vector plasmid is constructed by the following method:

[0010] The Agaricus bisporus gpd promoter Agpd was amplified using the primer pair AbgpdF / AbgpdR using the PYN6981 plasmid as a template;

[0011] Using pDHT-bar as template, the bar gene fragment was amplified with primer pair AbBarF / AbBarR;

[0012] pDHT-bar was double-digested with BamHI / BcuI endonucleases to recover the pDHT vector backbone and obtain the linearized pDHT vector;

[0013] Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected, and the connection products were transformed into E. coli. Colony PCR was performed with primers M13F / M13R to verify. The plasmid was extracted from the samples verified by PCR and named pAgbar.

[0014] Among them, the primer pair used for amplification of Abgpd fragment is:

[0015] AbgpdF (SEQ ID NO.1):

[0016] CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG

[0017] AbgpdR (SEQ ID NO.2):

[0018] GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG

[0019] Primer pairs used for amplification of bar fragment:

[0020] AbBarF (SEQ ID NO.3):

[0021] CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC

[0022] AbBarR (SEQ ID NO.4):

[0023] CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG

[0024] Vector verification primer pairs:

[0025] M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG

[0026] M13R (SEQ ID NO.6): GAGCGGATAACAATTTCACAC;

[0027] The pAgbarG vector plasmid is constructed by the following method:

[0028] The Agbar gene fragment was amplified using the pAgbar plasmid as a template and the primer pair gbF / gbR;

[0029] The pDHT-sur-tef-gfp plasmid was used as a template to amplify the fragment gfp with the primer pair gfpF / gfpR;

[0030] The Agbar fragment and gfp fragment were seamlessly cloned with the linearized pDHT-bar vector (BamHI / BcuI digested), and the ligation products were transformed into E. coli. The transformed colonies were verified by PCR and sequenced using M13F (SEQ ID NO.5) / M13R (SEQ ID NO.6). The plasmid verified by sequencing was named pAgbarG.

[0031] The amplification system is: 2×Phanta Max Master Mix (vazyme) 25μl, 1μl of each 10μmol / l primer, 1μl of genomic DNA template (10ng / μl), add water to 50μl system. PCR reaction parameters: 95℃ (5min); 30 cycles: 95℃ (30sec), 58℃ (30sec), 72℃ (30sec); 72℃ (15min). After 1.2% agarose electrophoresis, the Agbar fragment was recovered, about 825bp, and the gfp fragment was about 717bp. The Agbar fragment, gfp fragment and the linearized pDHT-bar vector (BamHI / BcuI digestion) were seamlessly cloned using the seamless cloning kit (GenStar, T196) from Beijing Kangrun Chengye Biotechnology Co., Ltd. The ligation product was transformed into Escherichia coli, and the transformed colonies were verified by PCR and sequenced using M13F / M13R. The plasmid verified to be correct by sequencing was named pAgbarG.

[0032] Primers used to amplify Agbar fragment:

[0033] gbF (SEQ ID NO.7): CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCGgbR (SEQ ID NO.8): CTCCTCGCCCTTGCTCACGATCTCGGTGACGGGCA

[0034] Primers used to amplify the gfp fragment:

[0035] gfpF (SEQ ID NO.9): TGCCCGTCACCGAGATCGTGAGCAAGGGCGAGGAG

[0036] gfpR (SEQ ID NO.10):

[0037] CGGCCGCTCTAGAACTAGTctaTTACTTGTACAGTCGTCCAT

[0038] Universal primers for vector verification:

[0039] M13F (SEQ ID NO.5): CAGGGTTTCCCAGTCACG

[0040] M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC

[0041] (3) Transformation of Agrobacterium with pAgbar vector or pAgbarG vector

[0042] (4) Agrobacterium-mediated genetic transformation of Flammulina velutipes - Obtaining Flammulina velutipes transformants containing the bar gene and resistant to GA

[0043] The monokaryotic strain of Flammulina velutipes was used as the transformation receptor and the transformation was carried out by using the fungal genetic transformation method mediated by Agrobacterium tumefaciens; the transformed Flammulina velutipes mycelium block was transferred to an M-100 medium containing 16ug / ml GA resistance and cultured at 25°C until resistant colonies appeared, thereby obtaining the desired Flammulina velutipes transformants.

[0044] The method for constructing the Flammulina velutipes genetic transformation system is particularly suitable for the Flammulina velutipes Dan3 strain.

[0045] The present invention also provides a pAgbar vector or a pAgbarG vector containing a bar gene constructed by the above method, and a Flammulina velutipes transformant containing a bar screening gene constructed by the above genetic transformation method.

[0046] The innovative features of the present invention are as follows:

[0047] Resistance screening markers are very important in genetic manipulation. They can help researchers quickly identify successfully transformed strains and ensure that the target gene has been integrated into the genome of the strain. In the genetic transformation of Flammulina velutipes, there is no research on screening transformants using bar as a resistance gene and glufosinate as resistance. Agrobacterium-mediated genetic transformation involves the construction of vectors, and the transformation efficiency is closely related to the type of vector skeleton. In the construction process of the existing Flammulina velutipes genetic transformation system, pCAMBIA and pBGgHg are mainly used as skeleton vectors, and hygromycin is used for resistance screening. The present invention aims at the defects of few available resistance screening markers and vector skeletons in Flammulina velutipes, uses the commonly used expression vector pDHT in filamentous fungi as the skeleton, and uses the Agaricus bisporus gpd promoter to drive the expression of bar, and successfully realizes the genetic transformation of Flammulina velutipes with glufosinate as a resistance screening marker. The successful development of pDHT binary vector and GA marker not only expands the toolbox of Flammulina velutipes genetic transformation, but also provides important support for a comprehensive understanding of the molecular mechanism of the formation of its important agronomic traits, and also provides the possibility for breeding new varieties with specific traits.

[0048] In addition, the present invention found that the composition of the culture medium is crucial for the screening of GA-resistant transformants, which has rarely been paid attention to in previous studies. In most studies, PDA or CYM is used as the screening culture medium, and the present application found that the nutrient-poor M-100 culture medium is more conducive to the screening of Flammulina velutipes transformants than the PDA culture medium. The use of the nutrient-poor M-100 culture medium can not only reduce the false positive rate of transformants, but also shorten the screening time of transformants. In addition, the fusion expression of bar and gfp markers provides a visual screening strategy for the identification of GA-resistant transformants, and provides a reference for the construction of genetic transformation systems of other species. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 , Growth of Flammulina velutipes on different culture media

[0050] (A) Colony morphology of Flammulina velutipes Dan3 grown on different culture media;

[0051] (B) Colony diameters of Flammulina velutipes Dan3 grown on different culture media.

[0052] Figure 2 , Analysis of the sensitivity of Flammulina velutipes Dan3 to GA

[0053] (A) shows the growth of Dan3 strain on PDA medium containing GA;

[0054] (B) shows the growth of Dan3 strain on M-100 medium containing GA.

[0055] Figure 3 , Construction and schematic diagram of pAgbar vector

[0056] (A) pDHT-bar was double-digested to obtain the pDHT linearized vector.

[0057] (B) is the Agpd fragment,

[0058] (C) is the bar fragment,

[0059] (D) is the electrophoresis diagram of pAgbar vector verification (M13 / M13R).

[0060] (E) Schematic diagram of the construction of pAgbar vector.

[0061] Figure 4 Screening and observation of resistant transformant A

[0062] Figure 5 Screening and verification of resistant transformant A

[0063] (A) is the initial screening observation of transformants on M-100 medium containing GA;

[0064] (B) is the re-screening observation of transformants on M-100 medium containing GA;

[0065] (C) shows the results of multiple screening of transformants on PDA medium containing GA;

[0066] (D) shows the culture conditions of transformants on PDA medium without resistance.

[0067] Figure 6 , Construction and schematic diagram of pAgbarG vector

[0068] (A) is a schematic diagram of the construction of the pAgbarG vector; Abgpd promoter is the promoter Agpd of Agaricus bisporus gpd, bar is a resistance gene for screening the drug glufosinate ammonium GA; gfp is the enhanced green fluorescent protein gene, and this vector is a fusion expression of bar and gfp.

[0069] (B) Agbar and gfp fragments used to construct the pAgbarG vector.

[0070] (C) is the electrophoresis diagram of pAgbarG vector verification (M13 / M13R).

[0071] Figure 7 、pAgbarG vector map

[0072] Figure 8 , Screening and verification of resistant transformants B transformants

[0073] (A) Observation of GFP expression in transformants on PDA plates.

[0074] (B) is the electrophoresis diagram of PCR verification of transformant B.

[0075] Fig. 9 , Electrophoresis of PCR verification of resistant transformant A transformant DETAILED DESCRIPTION

[0076] The following embodiments and drawings are only used to explain and illustrate the technical solution of the present invention, and are not intended to limit the contents to be protected by the present invention.

[0077] Unless otherwise specified, the reagents used in the following examples are common commercially available products.

[0078] All primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; all gene sequences were also determined by Shanghai Sangon Biotechnology Co., Ltd.

[0079] Flammulina velutipes strain Dan3 (Strain Collection Center of Edible Fungi Research Institute, Shanghai Academy of Agricultural Sciences);

[0080] Glufosinate GA: Purchased from Hubei Jiahui Xingcheng Biotechnology Co., Ltd.;

[0081] Agbar fragment gene sequence (SEQ ID NO.17):

[0082] GAAGAAGCATTAAGAGGTCCGCAAGTAGATTGAAAGTTCAGTACGTTTTTAGCA

[0083] ATAGAGCATTTCGAGGCTTGCGTCATTCTGTGTCAGGCTAGCAGTTTATAAGCGTTG

[0084] AGGATCTAGAGCTGCTGTTCCCGCGTCTCGAATGTTCTCGGTGTTTAGGGGTTAGC

[0085] AATCTGATATGATAATAATTTGTGATGACATCGATAGTACAAAAACCCCAATTCCGG

[0086] TCACATCCACCATCTCCGTTTTCTCCCATCTACACACAACAAGCTAATCGCCATGAG

[0087] CCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGCCGGC

[0088] GGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCGTACC

[0089] GAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGAGCGC

[0090] TATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTACGCGG

[0091] GCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTGTACGT

[0092] CTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACCTGCTG

[0093] AAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCTGCCCA

[0094] ACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGCATGCT

[0095] GCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGGCAGCTG

[0096] GACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGATC

[0097] GFP fragment gene sequence (SEQ ID NO.18):

[0098] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCT

[0099] GGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGA

[0100] TGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCC

[0101] GTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC

[0102] GCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGG

[0103] CTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC

[0104] GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGC

[0105] ATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACA

[0106] ACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAA

[0107] CTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTAC

[0108] CAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC

[0109] TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGT

[0110] CCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTAC

[0111] AAGTAA

[0112] Verification of bar gene sequence by YZbarF / YZbarR (SEQ ID NO.19):

[0113] AGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGC

[0114] CGGCGGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCG

[0115] TACCGAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGA

[0116] GCGCTATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTAC

[0117] GCGGGCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTG

[0118] TACGTCTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACC

[0119] TGCTGAAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCT

[0120] GCCCAACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGG

[0121] CATGCTGCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGG

[0122] CAGCTGGACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGA

[0123] TC

[0124] Amplification size of YZgfpF / YZgfpR for gfp (SEQ ID NO.20):

[0125] GGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGC

[0126] Amplify Actin (SEQ ID NO.21) with ActF / ActR primers:

[0127] GATCGTATGCAGAAGGAGTTGACACAACTGTCGCCTTCCAGCATGAAGGTTCGTA

[0128] TTCTTATGTTAAAATTTCAAGTGCCTACTAACTCGTGTTATAGGTCAAGATTGTCG

[0129] CTCCTCCCGAACGTAAATACTCTGTCTGGATTGGTGGATCCATTCTCGCGTCGCTC

[0130] TCCACTTTCCAGAACTTGTGGTGCTCCAAGCAAGAGTACGACGAGAGTGG

[0131] Example 1 Construction of Flammulina velutipes Dan3-resistant transformant A

[0132] (1) Analysis of the sensitivity of Flammulina velutipes to GA on different culture media

[0133] Because the mechanism of GA resistance is to inhibit the activity of intracellular glutamine synthetase, affecting the accumulation and metabolism of nitrogen sources. This suggests that the content and composition of the nitrogen source in the exogenous culture medium may affect the resistance of the strain to GA. Therefore, this example determined the sensitivity of Flammulina velutipes strains to GA in culture media with different nitrogen sources. 1) Analysis of the growth of Flammulina velutipes on different culture media

[0134] Using the Flammulina velutipes monokaryotic strain Dan3, a strain with a colony diameter of 5-6 cm was selected, and the fungus blocks were inoculated into PDA, CYM, CYMG, MM, CZM, and M-100 respectively using the cork hole inoculation method. The cultures were cultured at 25°C for 10-15 days, and the growth of the strains was observed.

[0135] Medium used:

[0136] PDA: 200 g potato, 20 g glucose, 15 g agar, 1000 mL distilled water, natural pH, purchased from BD.

[0137] CYM solid culture medium formula (per 1L): maltose 10g, glucose 20g, yeast extract 2g, peptone 2g, MgSO4·7H2O 0.5g, KH2PO4 4.6g, agar powder 15g.

[0138] Improved CYMG solid culture medium formula (per 1 L): maltose 10 g, glucose 20 g, yeast extract 2 g, peptone 2 g, MgSO4·7H2O 0.5 g, KH2PO4 4.6 g, K2HPO4 1 g, agar powder 15 g.

[0139] MM medium (1 L): glucose 20 g, L-asparagine 2 g, MgSO4·7H2O 0.5 g, KH2PO4 0.46 g, K2HPO4 0.1 g, agar powder 15 g.

[0140] CZM medium (1L): NaNO3 2g, KCl 0.5g, K2HPO4 1g, MgSO4·7H2O 0.5g, 1ml0.1mg / mlFeSO4·7H2O, sucrose 30g, adjust pH to 7.0, autoclave, agar powder 15g.

[0141] M-100 medium (1L): Glucose 10g, KNO3 3g, M-100 salt stock solution 62.5ml, dilute to 1L, adjust pH to 7.0, and sterilize by high pressure.

[0142] M-100 salt stock solution (1L): KCl 8g, KH2PO4 16g, MgSO4·7H2O 2g, NaSO4 4g, CaCl2 1g, M-100 trace element stock solution 8ml, store at 4℃ after dilution.

[0143] M-100 trace element mother solution (500ml): MnCl2·4H2O 30mg, ZnCl2 200mg, H3BO3 70mg, FeCl3·6H2O 50mg, Na2MoO4·2H2O 20mg, CuSO4·5H2O 200mg.

[0144] Through the growth observation of Flammulina velutipes monokaryotic strain Dan3 in culture media with different nutrient components, it was found that the aerial hyphae of Flammulina velutipes Dan3 strain were dense on nutrient-rich culture media such as PDA, CYM, CYMG, and MM, while the aerial hyphae were sparse on poor culture media such as CZM and M-100 with nitrate as inorganic nitrogen source. The results of colony diameter measurement showed that Dan3 grew fastest on PDA culture medium and grew slower on CYM culture medium ( Figure 1 ). It can be seen that different culture medium components will affect the development of aerial mycelium and the growth rate of Flammulina velutipes Dan3, and the density of aerial mycelium is closely related to the nitrogen source in the culture medium.

[0145] 2) Analysis of GA sensitivity of Flammulina velutipes strains

[0146] The strain GA sensitivity analysis was carried out on nutrient-rich PDA medium and nutrient-poor M-100 medium respectively.

[0147] The Flammulina velutipes strain Dan3 with a colony diameter of 5-6 cm was selected and inoculated on PDA resistance culture medium containing GA concentrations (0ug / ml, 200ug / ml, 300ug / ml, 400ug / ml, 500ug / ml, 600ug / ml) and M-100 resistance culture medium containing GA concentrations (0ug / ml, 4ug / ml, 8ug / ml, 10ug / ml, 16ug / ml, 20ug / ml) respectively using the cork punch inoculation method. The PDA resistance plate was cultured at 25°C for 10 days, and the M-100 resistance plate was cultured at 25°C for 15 days. The growth of the strain in different culture media and different antibiotic concentrations was compared and observed, and the resistance of the strain to GA was analyzed.

[0148] Test results: The results of GA concentration gradient analysis showed that the antibacterial concentration of GA on Flammulina velutipes Dan3 was 500ug / ml ( Figure 2 ) and determined this concentration as the transformant screening concentration.

[0149] On M-100 medium, the inhibitory concentration of GA on Flammulina velutipes Dan3 was 16ug / ml ( Figure 2 ) and determined this concentration as the transformant screening concentration.

[0150] In summary, the composition of the culture medium is an important factor affecting the sensitivity of Flammulina velutipes Dan3 to GA. The minimum inhibitory concentrations of GA on Flammulina velutipes in PDA and M-100 are quite different.

[0151] (2) Construction of pAgbar vector

[0152] The PYN6981 plasmid (provided by the Genetics Laboratory of the Edible Fungi Research Institute of Shanghai Academy of Agricultural Sciences) was used as a template and the synthetic primer pair AbgpdF / AbgpdR was used to amplify the Agaricus bisporus gpd promoter Agpd;

[0153] Using pDHT-bar as a template (pDHT-bar was donated by Dr. Wang Chengshu from the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences), AbBarF / AbBarR amplified the bar gene fragment;

[0154] The amplification system was: 25 μl of 2× Phanta Max Master Mix (vazyme), 1 μl of each 10 μmol / l primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to make a 50 μl system;

[0155] PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min);

[0156] Agpd fragment (276 bp, SEQ ID NO.11) and bar fragment (555 bp, SEQ ID NO.12) were recovered by 1.2% agarose electrophoresis. pDHT-bar was double-digested with BamHI / BcuI to recover the pDHT vector backbone (about 7421 bp), i.e., the linearized pDHT vector.

[0157] Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected. The kit used was the seamless cloning kit (GenStar, T196) of Beijing Kangrun Chengye Biotechnology Co., Ltd., and the ligation product was transformed into Escherichia coli. Colony PCR was performed with primer pair M13F / M13R, and plasmids were extracted from samples verified by PCR. The plasmid was named pAgbar; vector construction is shown in Figure 3 .

[0158] The specific steps of E. coli transformation and PCR verification are as follows:

[0159] Take 100 μL of competent E. coli TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) and thaw it on ice for 10 minutes; add the above-mentioned ligation product, mix gently, and place on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds, and quickly cool in an ice-water mixture for 5 minutes; (clean bench) add 1 ml of LB liquid (without antibiotics), and culture at 37°C, 180 rpm for 1 hour; centrifuge the bacterial solution at 5000 rpm for 5 minutes; (clean bench) pour off the supernatant, keep 100 μL (mix by blowing) and apply it to an LB plate (containing kan), and culture it inverted at 37°C for 12-18 hours; pick 8 single colonies and streak them onto the LB plate (containing kan), and use M13F / M13R on the vector for colony PCR verification. M13F / M13R primer sequence (same as above), amplification system: 2×Premix Taq Version (TAKARA, RR901A) 10μl, 10μmol / l primers 1μl each, colony, add water to 20μl system. PCR reaction parameters: 95℃ (3min); 30 cycles: 95℃ (30sec), 58℃ (30sec), 72℃ (2min); 72℃ (15min). After 1.2% agarose electrophoresis, 3 samples of target size were selected for sequencing, and plasmids were extracted from the samples with correct sequencing, and the plasmid was named pAgbar.

[0160] Primers used for amplification of Abgpd fragment:

[0161] AbgpdF (SEQ ID NO.1):

[0162] CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG

[0163] AbgpdR (SEQ ID NO.2):

[0164] GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG

[0165] Primers used for amplification of bar fragment:

[0166] AbBarF (SEQ ID NO.3):

[0167] CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC

[0168] AbBarR (SEQ ID NO.4):

[0169] CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG

[0170] Universal primers for vector verification:

[0171] M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG

[0172] M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC

[0173] (3) Genetic transformation of Agrobacterium inoculation with pAgbar vector

[0174] Take out the competent Agrobacterium AGL-1 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) stored at -80℃, thaw on ice for 10 minutes, add 1ul pAgbar plasmid, mix by pipetting, ice bath for 30 minutes, quick freeze with liquid nitrogen for 5 minutes, water bath at 37℃ for 5 minutes, immediately ice bath for 2 minutes, add 1ml LB liquid (clean bench), culture at 28℃, 150rpm for 3 hours; centrifuge at 5000rpm for 5 minutes, pour out the supernatant (clean bench), keep 100ul, take half of it and coat it on LB solid plate (containing 50μg / mL carbenicillin (Carb) and 50μg / mL kanamycin (kan), blow dry, culture at 28℃, invert for 2-2.5d; take 3-5 single colonies and re-streak them on LB solid plate (containing 50μg / mL Carb and 50μg / mL kan), cultured at 28°C, 220 rpm for 2 days, and then the colonies were taken for PCR verification (clean bench). Carbenicillin was purchased from Sangon Biotech.

[0175] PCR amplification system: 2×Premix Taq Version (TAKARA, RR901A) 10μl, primers M13F / M13R 0.5μl each, template is colony, add water to 20μl system. Among them, the amplified fragment of M13F / M13R is about 1kb. Amplification program: 95℃ pre-denaturation 5min, 30 cycles: 95℃ 30s, 56℃ 30s, 72℃ 1min, 72℃ extension 10min. (4) Agrobacterium-mediated genetic transformation of Flammulina velutipes - Flammulina velutipes transformants containing bar and resistant to GA were obtained.

[0176] The transformation was carried out using the Agrobacterium tumefaciens-mediated fungal genetic transformation method with the Flammulina velutipes monokaryotic strain Dan3 as the transformation receptor. The culture medium and specific transformation method used are as follows:

[0177] Culture medium used during transformation:

[0178] LB medium (liquid, 1 L): tryptone 10 g, yeast extract 5 g, NaCl 10 g.

[0179] IM solid medium (1 L): 400 ml 2.5× mm salt solution, 5 ml glycerol, 0.9 g glucose, 15 g agar powder (add 200 μmol acetosyringone and 40 mmol MES before use), high temperature sterilization at 121°C for 15 min.

[0180] IM liquid medium (1L): 400ml 2.5×mm salt solution, 5ml glycerol, 1.8g glucose (add 200μmol acetosyringone and 40mmol MES before use), store in dark)

[0181] M-100 solid medium (200 mL): 100× salt solution 12.5 ml, glucose 2 g, KNO3 0.6 g, agar 2 g, water 187.5 ml.

[0182] 2.5×MM salts (liquid, 1L): KH2PO4 3.625g, K2HPO4 5.125g, MgSO4 7H2O 1.250g, NaCl 0.375g, CaCl2 2H2O, 0.165g, FeSO4.7H2O 0.0062g, (NH4)2SO4 1.250g, water 1L.

[0183] M-100trace element solution (liquid, 500ml): H3BO3 30mg, MnCl2 4H2O 70mg, ZnCl2200mg, Na2MoO4.2H2O 20mg, FeCl 3.6H2O 50mg, CuSO4.5H2O 200mg, water 500ml.

[0184] M-100Salt solution (liquid, 1L): KH2PO4 16g, Na2SO4 4g, KCl 8g, MgSO4.7H2O2g, CaCl2 1g, M-100trace element solution 8ml, water 992ml.

[0185] PDA medium: purchased from BD

[0186] Agrobacterium culture:

[0187] Inoculate Agrobacterium with pAgbar vector in 3mL LB (kan+Carb) liquid medium, culture at 28°C, 200rpm, for 14-20h; in a clean bench, take 2mL of Agrobacterium bacterial solution and place it in a centrifuge tube, 12000rpm, 2min, discard the supernatant, add 1mL IM liquid medium to resuspend the bacteria, aspirate 500μL of bacterial solution and add it to 5mL IM liquid medium, culture at 28°C, 200rpm, for 4h and adjust it to OD600=0.3-0.4.

[0188] Infection and co-cultivation:

[0189] Take the monokaryotic strain Dan3 of Flammulina velutipes cultured on PDA medium for 10 days, use a 10ul or 200ul pipette tip to punch a hole to take the hyphae near the edge, and inoculate it into IM liquid medium. After ultrasonication (53kHz, 1min), mix it with Agrobacterium cultured for 4 hours, and continue to culture on a shaking table for 2 hours at 25℃ and 50rpm. Discard the Agrobacterium, move the hyphae block to an IM solid plate covered with filter paper, and use the hyphae without Agrobacterium as a control; culture it in the dark at 25℃ for 3 days;

[0190] Screening culture:

[0191] Move the Flammulina velutipes Dan3 mycelium block to an M-100 plate resistance plate (containing GA (16ug / ml) + Cef 450ug / ml) or a PDA plate resistance plate (containing GA (500ug / ml) + Cef 450ug / ml) and culture at 25°C until resistant colonies appear.

[0192] Principle of transformant screening: Use M-100 medium containing 16ug / ml GA resistance or PDA medium containing 500ug / ml GA resistance as the screening medium. When the pAgbar plasmid is integrated into the genome and the expression of the bar gene is started, the suspected transformants will grow on the resistance plate, and the strains that have not been transformed with the pAgbar plasmid cannot grow.

[0193] Screening of GA-resistant transformants

[0194] The results showed that when screening transformants on PDA medium containing 500ug / ml GA, it took about 15 days to distinguish transformants from non-transformants, while it only took 7 days on M-100 medium containing 16ug / ml GA resistance. Figure 4 ). The results showed that the use of nutrient-poor M-100 medium for transformant screening and culture can not only reduce the concentration of GA, but also quickly identify positive transformants and improve the screening efficiency of transformants. Therefore, the present application uses 16ug / ml GA-resistant M-100 medium for the screening of Flammulina velutipes transformants.

[0195] The results showed that on the PDA resistant medium, the wild strain was completely inhibited, but the Flammulina velutipes transformant A could grow normally ( Figure 5 ).

[0196] Example 2 Construction of Flammulina velutipes Dan3 resistant transformant B

[0197] The remaining steps are the same as those in Example 1, except for the construction of the vector in step (2), in which the constructed vector is pAgbarG.

[0198] (2) Construction of pAgbarG vector

[0199] In order to make the identification of GA-resistant transformants easier and more visual, an expression vector (pAgbarG) was constructed in which the bar gene was fused with the green fluorescent protein (GFP) encoding gene gfp.

[0200] The gbF / gbR primer pair was artificially synthesized, and the Agbar gene fragment was amplified using the pAgbar plasmid as a template (prepared in Example 1 above), and the gfp fragment was amplified using the gfpF / gfpR primers and the pDHt-sur-tef-gfp plasmid (donated by Researcher Wang Chengshu of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences) as a template.

[0201] The amplification system was: 2×Phanta Max Master Mix (vazyme) 25 μl, 1 μl of each 10 μmol / l primer, 1 μl of genomic DNA template (10 ng / μl), and water was added to 50 μl system. PCR reaction parameters: 95°C (5 min); 30 cycles: 95°C (30 sec), 58°C (30 sec), 72°C (30 sec); 72°C (15 min). After 1.2% agarose gel electrophoresis, the Agbar fragment was recovered, about 825 bp (SEQ ID NO.17), and the gfp fragment was about 717 bp (SEQ ID NO.18).

[0202] Agbar fragment, gfp fragment and linearized pDhT-bar vector (BamHI / BcuI digestion) (BamHI / BcuI endonuclease: Thermo Scientific FastDigest) were seamlessly cloned. The kit used was EZ-HiFi Seamless Cloning Kit (GenStar, T196) of Beijing Kangrun Chengye Biotechnology Co., Ltd., and the ligation product was transformed into Escherichia coli. The transformed colonies were verified by PCR and sequenced with M13F / M13R. The plasmid verified by sequencing was named pAgbarG. ( Figure 6-7 )

[0203] Primers used to amplify Agbar fragment

[0204] gbF (SEQ ID NO.7): CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCGgbR (SEQ ID NO.8): CTCCTCGCCCTTGCTCACGATCTCGGTGACGGGCA

[0205] Primers used to amplify the gfp fragment

[0206] gfpF (SEQ ID NO.9): TGCCCGTCACCGAGATCGTGAGCAAGGGCGAGGAG

[0207] gfpR (SEQ ID NO.10):

[0208] CGGCCGCTCTAGAACTAGTCTATTACTTGTACAGTCGTCCAT

[0209] Universal primers for vector verification:

[0210] M13F (SEQ ID NO.5): CAGGGTTTCCCAGTCACG

[0211] M13R(SEQ ID NO.6):GAGCGGATAACAATTTCACAC

[0212] E. coli transformation and verification:

[0213] Take 100 μL of E. coli competent cells TOP10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) and thaw on ice for 10 minutes; add the above-mentioned ligation product, mix gently, and place on ice for 30 minutes; heat shock in a 42°C water bath for 90 seconds, and quickly cool in an ice-water mixture for 5 minutes; (clean bench) add 1 ml of LB liquid, and culture at 37°C, 180 rpm for 1 hour; centrifuge the bacterial solution at 5000 rpm for 5 minutes; (clean bench) pour out the supernatant, keep 100 μL (mix by blowing) and apply it to an LB solid plate (containing 50 μg / mL kanamycin (purchased from Sangon Biotech)), and culture it inverted at 37°C for 12-18 hours; pick 8 single colonies and streak them onto an LB solid plate (containing 50 μg / mL kanamycin), and use M13F / M13R on the vector for colony PCR verification. The PCR amplification system was: 2×Premix Taq Version (TAKARA, RR901A) 10μl, 10μmol / l primers 1μl each, colonies, water added to 20μl system. PCR reaction parameters: 95℃ (3min); 30 cycles: 95℃ (30sec), 58℃ (30sec), 72℃ (2min); 72℃ (15min). After 1.2% agarose electrophoresis, 3 samples were selected for sequencing, and plasmids were extracted from the samples with correct sequencing, and the plasmid was named pAgbarG.

[0214] (3) Agrobacterium inoculation pAgbarG vector genetic transformation (same steps as in Example 1)

[0215] (4) Agrobacterium-mediated genetic transformation of Flammulina velutipes - Obtaining Flammulina velutipes transformant B containing bar and resistant to GA

[0216] The steps are basically the same as those in (4) of Example 1, except that, because the pAgbarG vector also contains the gfp gene, the fusion expression of the bar gene and the gfp gene can endow the transformant strain with green fluorescence under excitation of a specific wavelength.

[0217] The results showed that on PDA resistant medium, the wild strain was completely inhibited, but the transformant B of Flammulina velutipes could grow ( Figure 8 A). The protein GFP encoded by the gfp gene can emit stable green fluorescence at a blue light wavelength of 450-490nm. At the same time, a portable fluorescence detector (LUYOR-3415RG excitation light source) was used to illuminate the transformed strains cultured on the PDA plate, and GFP fluorescence signals were observed to be emitted by some of the transformed strains on the PDA plate ( Figure 8 A). The results showed that the expression of bar and gfp not only gave the positive transformants resistance to GA, but also had GFP fluorescence signal.

[0218] Example 3 Analysis and verification of mitotic stability of GA-resistant transformants:

[0219] The resistant transformant strains of Flammulina velutipes Dan3 prepared in Example 1 and Example 2 were transferred to the corresponding resistance culture medium for subculture, and the process was repeated 3 times, with the recipient strain Dan3 as a control. The Flammulina velutipes strain was cultured in the dark at 25°C for 5 days. The transformants were picked and transferred to a PDA culture medium plate. After 5 consecutive transfers, they were transferred to the corresponding resistance plate. The Flammulina velutipes strain was transferred to M-100 (containing GA (16ug / ml) and PDA (containing GA (500ug / ml) selective culture medium for culture. The transformants grown on the PDA resistance plate were selected, and their genomes were extracted by the CTAB method and verified by PCR. At the same time, the untransformed recipient strain Dan3 was used as a control.

[0220] Transformant identification: The genome of the stable resistant colony during mitosis was extracted. The results showed that the transformant strain A prepared in Example 1 could amplify a target size fragment of about 546 bp (SEQ ID NO.19) using the bar-specific primers YZbarF / YZbarR, while the wild-type strain could not. Using the specific primers ActF / ActR of the Flammulina velutipes actin internal reference gene, both the transformant and the wild-type strain could amplify a fragment of about 217 bp (SEQ ID NO.21), indicating that the data amplified using the Flammulina velutipes genome is credible. This result shows that the exogenous bar gene has been integrated into the Flammulina velutipes Dan3 genome ( Fig. 9 )

[0221] The genome of the resistant transformant B prepared in Example 2 was further extracted and verified by PCR. The results showed that the transformant could amplify a 697bp (SEQ ID NO.20) fragment using the gfp gene specific primers YZgfpF / YZgfpR, while the wild type could not. The transformant could amplify a 546bp (SEQ ID NO.19) fragment using the bar specific primers YZbarF / YZbarR, while the wild type could not. Using the ActF / ActR primers, both the transformant and the wild type strain could amplify a 217bp (SEQ ID NO.21) fragment (a specific fragment of the Dan3 genome), indicating that the genome amplification results were reliable ( Figure 8 B). The above results show that GA can be used as a screening marker for genetic transformation of Flammulina velutipes, and the fusion expression construction of the resistance bar gene and green fluorescent protein is helpful for the visual screening of positive transformants in the later stage.

[0222] CTAB method for genome extraction: the mycelium was placed in a 2 ml centrifuge tube containing steel beads, and then placed in a freezing grinder (Shanghai Bannuo) for crushing. The grinder was set at 60 Hz for 60 seconds, and the tube was vibrated twice continuously. 500 ul of CTAB extract was added, mixed and incubated at 55°C for 15 min, an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added, mixed by inversion, centrifuged at 10,000 rpm for 5 min, the supernatant was taken and an equal volume of cold anhydrous ethanol was added, inverted 3-5 times, placed in a -20°C refrigerator for 30 min, centrifuged at 12,000 rpm for 10 min, the supernatant was poured out, centrifuged for 10 seconds, the liquid on the tube wall was discarded, the tube tip was aspirated dry, and the tube was opened and allowed to stand at room temperature for 5 min. After evaporation, 100 ul of ddH2O was added, and the tube was placed in a 4°C refrigerator for 3 h to dissolve the DNA precipitate.

[0223] CTAB extraction solution (200ml): CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20ml (pH 8), 0.5M EDTA 8ml. PCR amplification system: 2×Premix Taq Version (vazyme, P112) 10μl, primer pair 0.5μl, genomic DNA template 1μl (50ng), add water to 20μl system. Amplification program: 95℃ pre-denaturation 5min, 32 cycles: 95℃ 30s, 58℃ 30s, 72℃ 1min, 72℃ extension 10min.

[0224] Bar validation primers:

[0225] YZbarF(SEQ ID NO.11):AGCCCAGAACGACGCCCGGC

[0226] YZbarR(SEQ ID NO.12):GATCTCGGGTGACGGGCAGGAC

[0227] GFP validation primers:

[0228] YZgfpF(SEQ ID NO.13):GGCGAGGAGCTGTTCACCG

[0229] YZgfpR(SEQ ID NO.14):GCTCGTCCATGCCGAGAG

[0230] Primers for the internal reference gene actin of Flammulina velutipes:

[0231] ActF(SEQ ID NO.15):GATCGTATGCAGAAGGAGTTGACAC

[0232] ActR(SEQ ID NO.16):CCACTCTCGTCGTACTCTTGCTTG。

Claims

1. A method for constructing a genetic transformation system of Flammulina velutipes, characterized in that The steps include: (1) The sensitivity of Flammulina velutipes strains to glufosinate GA was analyzed, and it was determined that the antibacterial concentration of GA on Flammulina velutipes Dan3 was 500ug / ml on PDA medium and 16ug / ml on M-100 medium; (2) Construction of a vector plasmid containing the bar gene, wherein the constructed vector plasmid containing the bar gene is a pAgbar vector plasmid or a pAgbarG vector plasmid; The pAgbar vector plasmid is constructed by the following method: The Agaricus bisporus gpd promoter Agpd was amplified using the primer pair AbgpdF / AbgpdR using the PYN6981 plasmid as a template; Using pDHT-bar as template, the bar gene fragment was amplified with primer pair AbBarF / AbBarR; pDHT-bar was double-digested with BamHI / BcuI endonucleases to recover the pDHT vector backbone and obtain the linearized pDHT vector; Agpd promoter, bar fragment and linearized pDHT vector were seamlessly cloned and connected, and the connection products were transformed into E. coli. Colony PCR was performed with primers M13F / M13R to verify. The plasmid was extracted from the samples verified by PCR and named pAgbar. Among them, the primer pair used for amplification of Abgpd fragment is: AbgpdF (SEQ ID NO.1): CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG AbgpdR (SEQ ID NO.2): GCGTCGTTCTGGGCTCATGGCGATTAGCTTGTTGTGTG Primer pairs used for amplification of bar fragment: AbBarF (SEQ ID NO.3): CACACAACAAGCTAATCGCCATGAGCCCAGAACGACGC AbBarR (SEQ ID NO.4): CGGCCGCTCTAGAACTAGTTCATCAGATCTCGGTGACGGGCAG Vector verification primer pairs: M13F(SEQ ID NO.5):CAGGGTTTCCCAGTCACG M13R (SEQ ID NO.6): GAGCGGATAACAATTTCACAC; The pAgbarG vector plasmid is constructed by the following method: The Agbar gene fragment was amplified using the pAgbar plasmid as a template and the primer pair gbF / gbR; The pDHT-sur-tef-gfp plasmid was used as a template to amplify the fragment gfp with the primer pair gfpF / gfpR; The Agbar fragment and gfp fragment were seamlessly cloned with the linearized pDHT-bar vector (BamHI / BcuI digested), and the ligation products were transformed into E. coli. The transformed colonies were verified by PCR and sequenced using M13F (SEQ ID NO.5) / M13R (SEQ ID NO.6). The plasmid verified by sequencing was named pAgbarG. Primers used to amplify Agbar fragment gbF (SEQ ID NO.7): CTGCAGCCCGGGGGATCCGAAGAAGCATTAAGAGGTCCG gbR (SEQ ID NO.8): CTCCTCGCCCTTGCTCACGATCTCGGGTGACGGGCA Primers used to amplify the gfp fragment gfpF (SEQ ID NO.9): TGCCCGTCACCGAGATCGTGAGCAAGGGCGAGGAG gfpR (SEQ ID NO.10): CGGCCGCTCTAGAACTAGTctaTTACTTGTACAGCTCGTCCAT (3) Transformation of Agrobacterium with pAgbar vector or pAgbarG vector (4) Agrobacterium-mediated genetic transformation of Flammulina velutipes - Obtaining Flammulina velutipes transformants containing the bar gene and resistant to GA The monokaryotic strain of Flammulina velutipes was used as the transformation receptor and the transformation was carried out by using the fungal genetic transformation method mediated by Agrobacterium tumefaciens; the transformed Flammulina velutipes mycelium block was transferred to an M-100 medium containing 16ug / ml GA resistance and cultured at 25°C until resistant colonies appeared, thereby obtaining the desired Flammulina velutipes transformants.

2. The method for constructing a Flammulina velutipes genetic transformation system according to claim 1, wherein the Flammulina velutipes strain is the Dan3 strain.

3. The pAgbar vector or pAgbarG vector containing the bar gene prepared by the method according to any one of claims 1 or 2.

4. A Flammulina velutipes transformant containing the bar gene prepared by the method according to any one of claims 1 or 2.

5. Application of bar gene in genetic transformation of Flammulina velutipes, characterized in that The application refers to the bar gene being used as a screening marker for genetic transformation of Flammulina velutipes.

Images