Visual plant polygene editing vector and application thereof

Abstract

The invention discloses a visual plant polygene editing vector and application thereof. The invention finds that the anthocyanin synthesized by regulation and control of the RH1 gene is taken as a reporter molecule, is visible to naked eyes under natural light, and can simply and quickly indicate the generation of plant transgenosis and improve the probability of obtaining a gene editing material, so that the application of the RH1 gene as the pigment reporter gene for plant genetic transformation is determined. The method comprises the following steps: further inserting an expression cassette taking an RH1 gene or an RUBY gene as a pigment reporter gene into a plant polygene editing vector to construct a visual plant polygene editing vector; a plurality of restriction enzyme cutting sites are reserved in the reporter gene expression box, one or more exogenous genes can be inserted or replaced, multi-gene overexpression is achieved while multi-gene editing is achieved, a promoter can be replaced with promoters with different expression intensities or tissue specific expression, and expression of inserted genes is accurately regulated and controlled.

Description

Technical Field

[0001] The present invention relates to a gene editing vector, in particular to a plant multi-gene editing vector with a pigment reporter gene expression box and its application in editing plant genes or overexpressing exogenous genes, belonging to the field of visualized gene editing vectors with pigment reporter gene expression boxes and their applications. Background Art

[0002] CRISPR / Cas9 genome editing technology has become an ideal tool for crop functional genomics research and genetic improvement because of its simplicity, flexibility, efficiency and ease of operation. The tandem assembly of multiple target sgRNAs can not only improve the efficiency of single gene editing, but also edit multiple genes simultaneously for gene family analysis, signal pathway or metabolic pathway research, and analysis of complex agronomic traits.

[0003] Alfalfa (Medicago sativa) is a perennial forage grass of the genus Alfalfa in the Leguminosae family that is widely planted worldwide. It has high yield, high quality and wide adaptability, and has high economic and ecological value. Therefore, genetic breeding of alfalfa is of great significance. However, most cultivated alfalfa varieties are self-incompatible, cross-pollinated autotetraploids, and the genome is highly heterozygous, which leads to slow progress in basic research and breeding of alfalfa. Therefore, it is urgent to establish an efficient alfalfa editing system. The reported alfalfa gene editing system has problems such as low efficiency in obtaining mutants in the T0 generation or only being able to design dual targets, which need further optimization and improvement. In addition, the editing efficiency of different sgRNAs for target sites will vary greatly, and the screening of effective sgRNAs is very necessary. Compared with stable genetic transformation with long cycles and low transformation efficiency, the rooting system is simpler, faster and more efficient, and is often used to evaluate the efficiency of editing systems and sgRNAs. At present, there is a lack of a simple, efficient and stable rooting system in alfalfa, especially for evaluating editing systems and sgRNAs, and a simple and accurate screening of transgenic positive materials is needed.

[0004] Visual reporter genes are often used in genetic transformation to quickly and accurately distinguish transgenic events. Compared with traditional fluorescent proteins and β-glucuronidase (GUS), pigments produced by pigment reporter systems, such as anthocyanins and betacyanin, do not require any special equipment or chemical treatment. Transgenic materials can be observed and screened in situ with the naked eye under visible light, which can effectively reduce workload and reduce costs. The RH1 gene is also a regulatory gene for anthocyanin synthesis, which determines the formation of anthocyanin leaf scars in Medicago truncatula leaves. The RUBY gene is an artificial reporter gene generated by connecting cytochrome P450 enzyme (CYP76AD1), 1,4-dihydroxyphenylalanine (l-DOPA) dioxygenase (DODA) and betacyanin glucosyltransferase in series based on the betacyanin biosynthesis pathway through the P2A self-cleaving peptide. The RUBY gene can convert tyrosine into bright red betacyanin. At present, the naked eye visualization effect of the RUBY reporter system has been achieved in many species such as rice, corn, Arabidopsis, tomato, cotton and soybean. However, there are no reports on the use of RH1 gene or RUBY gene as a visualized reporter gene in plant genetic transformation. Summary of the invention

[0005] One of the purposes of the present invention is to provide the use of RH1 gene as a plant genetic transformation pigment reporter gene;

[0006] The second object of the present invention is to provide a visualized plant multi-gene editing vector of a pigment reporter gene expression cassette;

[0007] The third purpose of the present invention is to apply the visualized plant multi-gene editing vector to plant multi-gene editing or multi-gene overexpression and other aspects.

[0008] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0009] One aspect of the present invention is to provide the use of RH1 gene as a pigment reporter gene for plant genetic transformation; the present invention finds that anthocyanin synthesized by RH1 gene regulation is used as a reporter molecule, which is visible to the naked eye under natural light and can simply and quickly indicate whether plant transgenic occurs or not, thereby enabling RH1 gene to be used as a pigment reporter gene for plant genetic transformation; for example, an expression cassette using RH1 gene as a pigment reporter gene is constructed, and the expression cassette is inserted into a plant genetic transformation vector to obtain a plant genetic transformation vector containing a pigment reporter gene expression cassette; wherein the plant genetic transformation vector can be a plant gene overexpression vector or a plant gene editing vector; the pigment reporter gene expression cassette is obtained by operably connecting a promoter, RH1 gene and a terminator; the promoter can use different types of promoters according to the requirements for the construction of the plant genetic transformation vector, such as promoters with different expression intensities or promoters with tissue-specific expression.

[0010] In addition, one or more restriction sites for inserting foreign genes may be reserved in the RH1 gene expression cassette.

[0011] Another aspect of the present invention is to provide a visualized plant multi-gene editing vector containing a pigment reporter gene expression cassette, comprising: an sgRNA expression cassette and a Cas9 expression cassette, wherein the number of the sgRNA expression cassettes is 2 or more and the sgRNA expression cassettes are connected in series; the components of each sgRNA expression cassette include an endogenous U6 promoter of alfalfa, a target sequence sgRNA targeting a plant gene, and a terminator; the number of the target sequence sgRNA targeting a plant gene is 2 or more and tRNA is used to connect each target sequence sgRNA in series, wherein a pigment reporter gene expression cassette is inserted into the plant multi-gene editing vector.

[0012] In a preferred specific embodiment of the present invention, a pigment reporter gene expression cassette is inserted at the PmeI restriction site of the plant multi-gene editing vector.

[0013] In a preferred specific embodiment of the present invention, the pigment reporter gene expression cassette comprises: a promoter, a pigment reporter gene and a terminator; wherein the promoter is a CmYLCV promoter, and the nucleotide sequence of the CmYLCV promoter is shown in SEQ ID No.1; the terminator is an AtHSPt terminator, and the nucleotide sequence of the AtHSPt terminator is shown in SEQ ID No.3.

[0014] In a preferred embodiment of the present invention, the pigment reporter gene is the RH1 gene or the RUBY gene; wherein the nucleotide sequence of the RH1 gene is shown in SEQ ID No.2; and the nucleotide sequence of the RUBY gene is shown in SEQ ID No.4.

[0015] In a preferred embodiment of the present invention, the pigment reporter gene expression cassette contains one or more restriction sites for insertion or replacement of one or more exogenous genes; for example, the restriction site may be KpnI or BsrGI (PmeI-pCmYLCV-KpnI-RH1 / RUBY-BsrGI-AtHSPt).

[0016] In a preferred specific embodiment of the present invention, the number of the sgRNA expression cassettes is 3; the number of target sequence sgRNAs targeting plant genes in each sgRNA expression cassette is 3; wherein, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets different genes of the plant or targets the same gene of the plant; preferably, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets different genes or the same gene in the alfalfa genome; more preferably, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets the MsTFL1c gene in the alfalfa genome, the MsTFL1a gene in the alfalfa genome, or the MsTFL1b gene in the alfalfa genome, respectively.

[0017] In a preferred embodiment of the present invention, the endogenous U6 promoter of alfalfa is selected from MtU6-d1 promoter, MsU6-g1 promoter or MsU6-d3 promoter;

[0018] The method of using tRNA to connect each target sequence sgRNA in series includes: connecting a tRNA to the 5' end of each target sequence sgRNA, and connecting a sgRNA scaffold to the 3' end of the target sequence sgRNA;

[0019] The terminator is AtU6-26t terminator; a transcription start site G is connected after the promoter sequence in each sgRNA expression cassette.

[0020] In a preferred embodiment of the present invention, the plant is a legume; preferably, the legume is alfalfa; more preferably, the alfalfa is alfalfa.

[0021] Another aspect of the present invention is to apply the visualized plant multi-gene editing vector to plant multi-gene editing or plant multi-gene overexpression and other aspects.

[0022] In a preferred specific embodiment of the present invention, a visualized plant multi-gene editing vector is used for editing plant target genes, comprising: (1) designing sgRNAs with multiple targets according to the target genes of the plant; (2) constructing a visualized plant multi-gene editing vector; (3) transforming the constructed visualized plant multi-gene editing vector into tissues or cells of the target plant to obtain a transformant, and then regenerating the transformant through a plant tissue culture method to obtain a complete regenerated plant and its asexual line or its offspring, and obtaining a transgenic plant with edited target genes by observing the accumulation of pigments in the regenerated plant and identifying the genotype.

[0023] In a preferred specific embodiment of the present invention, a visualized plant multi-gene editing vector is used for overexpression of plant genes, comprising: (1) inserting a target gene or multiple target genes connected in series by a 2A cleavage peptide into a pigment reporter gene expression box by single enzyme digestion to obtain a plant multi-gene editing vector; (2) transforming the constructed visualized plant multi-gene editing vector into tissues or cells of a target plant to obtain a transformant, and then regenerating the transformant by a plant tissue culture method to obtain a complete regenerated plant and its asexual line or its progeny, and obtaining a transgenic plant overexpressing the target gene by observing the pigment accumulation of the regenerated plant and identifying the genotype.

[0024] The transformation methods described in the present invention include Agrobacterium-mediated genetic transformation, protoplast transformation, plant virus vectors, microinjection, electroporation, etc. Transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5: 81-84).

[0025] The present invention obtains a visualized plant multi-gene editing vector by inserting a pigment reporter gene expression cassette into the PmeI restriction site of the plant multi-gene editing vector. The pigment reporter gene expression cassette inserted in the present invention includes: CmYLCV promoter, RH1 gene or RUBY gene, AtHSPt terminator. Among them, the RH1 gene regulates the synthesis of anthocyanins; the RUBY gene can convert tyrosine into bright red betalain; both are visible to the naked eye under natural light, without the need for equipment or reagents, and simply and quickly indicate the occurrence of plant transgenesis, thereby increasing the probability of obtaining gene editing materials; in addition, multiple restriction sites are reserved in the reporter gene expression cassette, which can not only insert or replace one or more exogenous genes, realize multi-gene editing and multi-gene overexpression, but also replace the promoter with a promoter with different expression intensity or tissue-specific expression, and accurately regulate the expression of the inserted gene.

[0026] Definitions of terms used in this invention

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods, devices and materials are now described.

[0028] The term "sgRNA expression cassette" refers to a DNA capable of expressing a corresponding sgRNA in a plant cell, which DNA may include not only a promoter for driving the transcription of the coding sequence of the corresponding sgRNA, but also a terminator for terminating the transcription of the coding sequence of the corresponding sgRNA.

[0029] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0030] The "plurality" mentioned in the present invention generally means 2-8, preferably 2-4; the "replacement" mentioned refers to the replacement of one or more nucleotide residues with different nucleotide residues; the "deletion" mentioned refers to the reduction in the number of nucleotide residues, that is, the lack of one or more nucleotide residues therein; the "insertion" mentioned refers to the change of the nucleotide residue sequence, which results in the addition of one or more nucleotide residues relative to the natural molecule.

[0031] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0032] The term "promoter" refers to a polynucleotide molecule which in its natural state is located upstream or 5' of the translation start codon of an open reading frame (or protein coding region) and is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.

[0033] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0034] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0035] The term "gene editing vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, together with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of pHSE401-MsU6d1 related vector structure; Figure 1 -A is a schematic diagram of the pHSE401-MsU6d1-tRNA-RH1 vector structure; Figure 1 -B is a schematic diagram of the pHSE401-MsU6d1-tRNA-RUBY vector structure; Figure 1 -C is a schematic diagram of the pHSE401-MsU6-reporter-Targets vector structure;

[0037] Figure 2 Schematic diagram of the structure of pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector;

[0038] Figure 3 The expression and editing status of pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector into alfalfa to obtain hairy roots were statistically analyzed; Figure 3 -A shows the phenotype after the pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector were transformed into alfalfa; Figure 3 -B is the statistics of editing frequency of different target sites of alfalfa transformed with pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector; Figure 3 -C is the statistics of editing efficiency of different target sites of alfalfa transformed with pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector;

[0039] Figure 4Figure 4 shows the expression of pHSE401-MsU6-9T-RUBY vector in different stages of stable genetic transformation of alfalfa. Figure A shows the color development of callus at 6 to 8 weeks of induction during the callus induction stage. Figure B shows the color development of callus after differentiation into buds during the regeneration stage. Figure C shows the color development during the bud growth stage. Figure DH shows the color development during the bud growth and rooting stages. DETAILED DESCRIPTION

[0040] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the scope of protection of the present invention.

[0041] Experimental Example 1 Construction of pHSE401-MsU6d1-tRNA recombinant vector

[0042] The pHSE401-MsU6d1-tRNA vector is deposited in the laboratory of the inventor. For specific vector information, see CN118207238 A.

[0043] pEarleyGate203-RH1 was deposited in the laboratory of the inventor and used to amplify the RH1 gene.

[0044] pDIRECT_22C was purchased from addgene and used to amplify pCmYLCV and AtHSPt.

[0045] PC304 was obtained from Shaojiang Chen's laboratory and contained the D35S-RUBY-35S ter expression cassette for amplifying the RUBY gene.

[0046] The RH1 gene expression cassette was inserted into the PmeI restriction site of the pHSE401-MsU6d1-tRNA vector. The CmYLCV promoter, the CDS sequence of the RH1 gene, and the AtHSPt terminator fragment were amplified using primer combinations HSE401-PmeI-CmYLCV-F / CmYLCV-KpnI-R, CmYLCV-KpnI-RH1-F / RH1-BsrGI-HSPt-R, and BsrGI-HSPt-F / HSE401-HSPt-R, respectively. The pCmYLCV, RH1 gene, and AtHSPt fragments were connected to the PmeI-linearized pHSE401-MsU6d1-tRNA vector using a homologous recombination strategy to obtain the vector pHSE401-MsU6d1-tRNA-RH1( Figure 1 A). The nucleotide sequences of the primers used in this process are as follows:

[0047] HSE401 - PmeI - CmYLCV - F: atatatcctgtcaaacactgataGTTTAAACTGGCAGACATACTGTCCCAC;

[0048] CmYLCV - KpnI - R: GGTACCAAGCTTAGCTCTTACCTGTTTTCGT.

[0049] CmYLCV - KpnI - RH1 - F: GGTAAGAGCTAAGCTTGGTACCATGGCGA ATACAAGCGGCGT;

[0050] RH1 - BsrGI - HSPt - R: CATCTTCATCTTCATATTGTACATTAAAGATC TCGAAGAAATTCAAAATC.

[0051] BsrGI - HSPt - F: TGTACAATATGAAGATGAAGATGAAATATTTG;

[0052] HSE401 - HSPt - R: agattgtcgtttcccgccttcagCTTATCTTTAATCATATTCC ATAG.

[0053] The nucleotide sequence of the CmYLCV promoter is as follows:

[0054] ATATATCCTGTCAAACACTGATAGTTTAAACTGGCAGACATACTGTC

[0055] CCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATG

[0056] CGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTG

[0057] GTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTG

[0058] ACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTG

[0059] AAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTA

[0060] CGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGT

[0061] CTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCA

[0062] GAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGT

[0063] AGTCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAA

[0064] AGCCAAGACGACGAAAACAGGTAAGAGCTAAGCTTGGTACC(SEQ ID No.1).

[0065] The nucleotide sequence of the CDS of the RH1 gene is as follows:

[0066] GGTAAGAGCTAAGCTTGGTACCATGGCGAATACAAGCGGCGTTAGA

[0067] AAAGGTGCATGGACATATGAAGAAGACAACTGTCTCAAGGCTTACA

[0068] TTCTCAAGCATGGTGTAGGAAAATGGCATTTAATTCCTGAAAGAAC

[0069] AGGATTGAATAGATGTCGTAAAAGTTGTAGATTGAGGTGGGTAAAT

[0070] TATTTAAATCCCTACATCAACCGGGAGAATTTTTCTAAGGATGAAGT

[0071] TGATTTGATTCTAAGGTTACACAACCTCCTAGGCAATAGATGGTCAT

[0072] TGATTGCTGGAAGGCTTCCAGGTAGAACAGCTAATGATGTGAAAAA

[0073] CTATTGGAATACATATTTACGCAAGAAGGTTGAATCAGAAGCAAAA

[0074] GAAAAAGAGAAATCTAATGAAACAATGAAAGCTCATGAGGTTATTA

[0075] AACCTCGGCCTATAACTTTATCATCTCGTTCACATTTTGTTCATGATT

[0076] CAAATAAAGATCGTTATGTTCCCATATATCAAGATGATTCATCAGAG

[0077] ACTATGGTTCCAAGTCAAATTGGTGGAGATTATGCCTCTGCTGTACA

[0078] ACCAAGTCTTGGTAATAATGTCCAAACACCGTGTGCAATGTGGTCA

[0079] GACAGTTTATGGGACATGGGGAGCAGTGAGAAAATTGGCTCATGCT

[0080] CTTCATTACAAGAGGTGAACAACTTCAACATGGATTTTCCTGATGAC

[0081] TCCTTTTGGGATTTCAACTTTTCTGATTTTGAATTTCTTCGAGATCTT

[0082] TAATGTACAATATGAAGATGAAGATG(SEQ ID No.2)。

[0083] The nucleotide sequence of the AtHSPt terminator is as follows:

[0084] TGTACAATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAA

[0085] AAGCTTGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTAT

[0086] GAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCACATTAT

[0087] AATGAATAAACAAATGTTTCTATAATCCATTGTGAATGTTTTGTTGG

[0088] ATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTA

[0089] TGGAATATGATTAAAGATAAGTGAAGGCGGGAAACGACAATCT

[0090] (SEQ ID No. 3).

[0091] The RH1 gene on the pHSE401-MsU6d1-tRNA-RH1 vector was replaced with the RUBY gene. The RUBY gene fragment was amplified using the primer combination CmYLCV-KpnI-RUBY-F / RUBY-BsrGI-HSPt-R. The RUBY gene was connected to the pHSE401-MsU6d1-tRNA-RH1 vector linearized by double restriction digestion with KpnI and BsrGI using a homologous recombination strategy to obtain the vector pHSE401-MsU6d1-tRNA-RUBY ( Figure 1 B). The nucleotide sequences of the primers used in this process are as follows:

[0092] CmYLCV-KpnI-RUBY-F:GGTAAGAGCTAAGCTTGGTACCATGGA TCATGCGACCCTCGCCATGA;

[0093] Ruby-BsrGI-HSPt-R:CATCTTCATCTTCATATTGTACATCACTATCA CTGGAGGCTTGGCTCA.

[0094] The nucleotide sequence of the RUBY gene is as follows:

[0095] GGTAAGAGCTAAGCTTGGTACCATGGATCATGCGACCCTCGCCATG

[0096] ATCCTCGCGATCTGGTTCATCAGCTTCCACTTCATCAAGCTGCTGTT

[0097] CTCCCAGCAGACCACCAAGCTTGCTTCCGCCAGGACCAAAGCCGCTT

[0098] CCGATCATCGGCAACATCCTTGAGGTGGGCAAGAAGCCGCATCGGT

[0099] CCTTCGCCAACCTCGCCAAGATTCACGGCCCACTCATTTCCCTCAGA

[0100] CTCGGCTCTGTGACCACCATCGTTGTGTCCTCTGCCGACGTGGCCAA

[0101] AGAGATGTTCCTCAAGAAGGATCACCCGCTCTCCAACCGCACGATC

[0102] CCGAATAGTGTTACAGCCGGCGACCACCACAAGCTCACCATGTCTT

[0103] GGCTCCCGGTGTCTCCGAAGTGGCGCAACTTCCGCAAGATTACCGC

[0104] CGTGCATCTGCTCTCCCCACAGAGACTCGATGCCTGCCAGACATTCA

[0105] GGCACGCCAAGGTGCAGCAGCTCTACGAGTACGTTCAAGAGTGCGC

[0106] CCAGAAAGGCCAGGCCGTGGATATTGGCAAGGCCGCCTTTACGACC

[0107] AGCCTCAACCTCCTCAGCAAGCTGTTCTTCAGCGTCGAGCTGGCGCA

[0108] CCACAAGTCCCATACCAGCCAAGAGTTCAAAGAGCTGATCTGGAAC

[0109] ATCATGGAAGATATAGGCAAGCCGAACTACGCCGACTACTTCCCGA

[0110] TTCTCGGCTGCGTTGACCCATCTGGCATTAGAAGAAGGCTCGCCTGC

[0111] TCCTTCGACAAGCTGATCGCCGTGTTCCAGGGCATCATCTGCGAGAG

[0112] ACTCGCCCCAGATTCCTCCACCACAACTACCACCACCACCGACGAC

[0113] GTGCTCGATGTGCTCCTCCAGCTGTTCAAGCAGAACGAGCTGACGA

[0114] TGGGCGAGATCAACCACCTCCTCGTGGACATCTTCGACGCCGGCAC

[0115] CGATACCACATCCTCCACATTCGAGTGGGTGATGACCGAGCTGATC

[0116] CGCAATCCAGAGATGATGGAAAAGGCCCAAGAGGAAATCAAGCAG

[0117] GTCCTCGGCAAGGACAAGCAGATCCAAGAGTCCGACATCATCAACC

[0118] TGCCGTACCTCCAGGCGATCATCAAAGAGACACTCCGCCTCCATCC

[0119] GCCGACCGTGTTCTTGCTCCCAAGAAAGGCCGACACCGATGTCGAG

[0120] CTGTACGGCTACATCGTGCCGAAGGATGCCCAGATCCTCGTGAACC

[0121] TCTGGGCCATTGGCAGGGACCCAAACGCCTGGCAGAACGCCGATAT

[0122] TTTCAGCCCAGAGCGCTTCATCGGCTGCGAGATCGATGTTAAGGGC

[0123] CGCGATTTCGGCCTCCTTCCATTTGGCGCTGGCCGCAGAATTTGCCC

[0124] AGGCATGAATCTCGCCATCAGGATGCTCACCCTCATGCTCGCCACAC

[0125] TCCTCCAGTTCTTCAACTGGAAGCTCGAAGGCGACATCTCCCCGAAG

[0126] GACCTCGACATGGACGAGAAGTTCGGCATTGCGCTCCAAAAGACCA

[0127] AGCCGCTCAAGCTCATCCCGATTCCGCGCTACGGAAGCGGAGCTAC

[0128] TAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCT

[0129] GGACCTATGAAGATGAATGAACGGCGAGGACGCCAACGACCAGATG

[0130] ATCAAAGAGTCCTTCTTCATCACCCACGGCAACCCGATCCTCACCGT

[0131] CGAGGATACACATCCGCTCAGGCCGTTCTTCGAGACATGGCGCGAG

[0132] AAGATTTTCTCCAAGAAGCCGAAGGCCATCCTCATCATCTCCGGCCA

[0133] CTGGGAGACAGTGAAGCCAACCGTGAACGCCGTGCACATCAACGAC

[0134] ACCATCCACGACTTCGACGACTACCCAGCCGCCATGTACCAGTTCA

[0135] AGTACCCAGCTCCAGGCGAGCCAGAGCTTGCGAGAAAGGTGGAAG

[0136] AGATCCTCAAGAAGTCCGGGTTCGAGACAGCCGAGACAGACCAAAA

[0137] GAGGGGCCTTGATCACGGCGCCTGGGTTCCACTCATGCTCATGTATC

[0138] CAGAGGCGGACATCCCGGTGTGCCAGCTCTCAGTTCAGCCACATCT

[0139] CGACGGCACCTACCACTACAATCTCGGCAGAGCCCTCGCGCCCGCTC

[0140] AAGAATGATGGCGTGCTCATTATTGGCTCCGGCAGCGCCACACATC

[0141] CACTCGATGAGACACCGCACTACTTCGATGGTGTTGCCCCTTGGGCC

[0142] GCTGCCTTCGATTCTTGGCTTAGGAAGGCCCTCATCAACGGCCGCTT

[0143] CGAGGAAGTGAACATCTACGAGAGCAAGGCCCCGAACTGGAAGCTC

[0144] GCCCATCCATTTCCAGAGCACTTCTACCCGCTCCACGTTGTGCTCGG

[0145] CGCTGCTGGTGAAAAGTGGAAGGCCGAGCTGATCCACTCCTCCTGG

[0146] GATCATGGCACACTTTGCCACGGCTCCTACAAGTTCACCTCCGCCGG

[0147] TTCAGGTGCCACTAATTTTTCTCTCTTGAAACAGGCCGGTGACGTTG

[0148] AAGAGAACCCAGGTCCAATGACCGCCATCAAGATGAACACCAACGG

[0149] CGAGGGCGAGACACAGCACATCCTCATGATCCCGTTCATGGCGCAG

[0150] GGCCACCTCAGGCCATTTCTCGAACTCGCCATGTTCCTCTACAAGCG

[0151] CTCCCACGTGATCATCACCCTGCTCACAACTCCGCTCAACGCCGGCT

[0152] TCCTCAGGCACCTCCTTCACCACCATTCCTACTCCTCCAGCGGCATC

[0153] AGGATCGTCGAGCTGCCATTCAACTCCACCAACCACGGACTCCCAC

[0154] CGGGCATCGAGAACACCGATAAGCTCACACTCCCGCTCGTGGTGTC

[0155] CCTCTTCCATTCCACCATCAGCCTCGATCCGCACCTCCGCGATTACA

[0156] TCTCCAGGCATTTCAGCCCAGCCAGGCCACCACTCTGCGTGATCCAT

[0157] GATGTGTTCCTCGGCTGGGTTGACCAGGTGGCCAAGGATGTGGGCT

[0158] CTACAGGCGTGGTGTTCACAACAGGCGGCGCTTATGGCACATCCGC

[0159] CTACGTGTCCATCTGGAACGATCTCCCGCACCAGAACTACTCCGACG

[0160] ACCAAGAGTTCCCGCTGCCAGGCTTCCCAGAGAACCATAAGTTCCG

[0161] CAGGTCCCAGCTCCATCGGTTCCTCAGATATGCCGACGGCTCCGACG

[0162] ATTGGTCCAAGTATTTCCAGCCGCAGCTCCGCCAGTCCATGAAGTCT

[0163] TTTGGCTGGCTCTGCAACTCCGTGGAAGAGATCGAGACACTCGGCTT

[0164] CTCCATCCTCCGCAACTACACCAAGCTGCCGATCTGGGGCATCGGCC

[0165] CACTTATTGCTTCCCCAGTGCAGCACTCCTCCTCCGACAACAATTCA

[0166] ACAGGCGCCGAGTTCGTGCAGTGGCTCAGCCTCAAAGAGCCGGACT

[0167] CCGTCCTCTACATCTCCTTCGGCTCCCAGAACACGATCAGCCCGACG

[0168] CAGATGATGGAACTCGCTGCTGGCCTTGAGTCCTCCGAGAAGCCAT

[0169] TCCTCTGGGTGATCAGAGCCCCGTTCGGCTTCGACATCAACGAAGA

[0170] GATGCGCCCAGAGTGGCTGCCAGAGGGCTTTGAGGAACGCATGAAG

[0171] GTGAAGAAACAGGGCAAGCTCGTGTACAAGCTCGGCCCGCAGCTTG

[0172] AGATCCTCAACCATGAATCCATCGGCGGCTTTCTCACCCACTGCGGA

[0173] TGGAACAGCATCCTTGAGTCTCTTCGCGAGGGCGTTCCGATGCTTGG

[0174] ATGGCCACTTGCTGCCGAGCAGGCCTACAACCTCAAGTACCTCGAA

[0175] GATGAGATGGGCGTCGCGGTTGAGCTTGCTAGAGGCCTCGAAGGCG

[0176] AGATCTCCAAAGAGAAGGTCAAGCGCATCGTCGAGATGATCCTTGA

[0177] GCGCAACGAGGGCTCCAAAGGCTGGGAGATGAAGAATCGCGCCGT

[0178] GGAAATGGGCAAAAAGCTCAAGGACGCCGTGAACGAGGAAAAAGA

[0179] GCTGAAGGGCTCCTCCGTGAAGGCGATCGACGATTTCCTCGACGCC

[0180] GTCATGCAGGCCAAACTTGAGCCAAGCCTCCAGTGATGTACAATAT

[0181] GAAGATGAAGATG(SEQ ID No.4)。

[0182] pHSE401-MsU6-reporter-Targets vector Figure 1 -C, this vector can be used as a backbone to construct related vectors.

[0183] Test Example 2 Construction and identification of positive transgenic plants

[0184] 1 Construction of plant multi-gene editing vector

[0185] pHSE401-MsU6-9T, i.e., pHSE401-MsU6-tRNA-MsTFL1s (for specific construction details, see CN118207238 A), is a multi-gene editing vector that connects 9 target sgRNAs in series, and targets the knockout of 3 genes of the MsTFL1 family of alfalfa.

[0186] pHSE401-MsU6-9T-RH1 is a RH1 gene expression cassette inserted into the PmeI restriction site of pHSE401-MsU6-9T. The specific construction method is detailed in Experimental Example 1.

[0187] pHSE401-MsU6-9T-RUBY is a construct in which the RH1 gene of pHSE401-MsU6-9T-RH1 is replaced with the RUBY gene. The specific construction method is described in Experimental Example 1.

[0188] The schematic diagram of the pHSE401-MsU6-9T vector, pHSE401-MsU6-9T-RH1 vector and pHSE401-MsU6-9T-RUBY vector structure is shown in Figure 2 shown.

[0189] 2 Plant multi-gene editing vector transformation

[0190] The obtained multi-gene editing vector was transformed into Agrobacterium rhizogenes (Ar.1193) by the transformation method mediated by Agrobacterium rhizogenes, and then infected the germinated seeds of alfalfa. The transformed receptor material was Zhongmu No. 1. The specific transformation method is as follows:

[0191] (1) Biofilm preparation: After pHSE401-MsU6-9T, pHSE401-MsU6-9T-RH1 and pHSE401-MsU6-9T-RUBY were transferred into Agrobacterium rhizogenes Ar.1193, positive clones were picked and cultured in TY liquid medium at 28°C with shaking at 200 rpm overnight. 400 μL of the bacterial solution was spread on TY solid medium and cultured inverted at 28°C in the dark for 24 h.

[0192] (2) Explant preparation: Select alfalfa seeds and place them in a 10 mL centrifuge tube. Add 5% sodium hypochlorite (containing 0.02% Triton X-100) and sterilize for 20-30 min with constant shaking. Transfer the seeds to a clean bench and wash them 3-5 times with sterile water. Then spread the seeds on 1 / 2 MS solid culture medium and remove excess water. Wrap the seeds in plastic wrap and place them in a dark incubator at 25°C for germination for 36-48 h. The radicles are about 1 cm long and can be used for infection.

[0193] (3) Infection and co-cultivation of Agrobacterium rhizogenes: Add a small amount of 1 / 2 MSCO liquid culture medium to the culture dish, use tweezers to pick up a seedling with a radicle of about 1 cm in length and gently fix it, then use a scalpel to cut off about 3 mm of the root tip, then use tweezers to pick up the cut seedling and gently scratch the bacterial film so that the incision is wrapped by Agrobacterium, place the seedling infected with the bacteria on 1 / 2 MSCO solid culture medium, seal it with plastic wrap, and place it in a vertical incubator at 20°C, 16 h light / 8 h dark for 5-7 days.

[0194] (4) Selection culture: After 5-7 days of co-culture, the root tip incision was visibly enlarged, and small red spots were observed at the enlarged site for visual transformation. The root was transferred to 1 / 2 MSH solid medium (containing 100 mg / L cephalosporin antibiotics) with the selection antibiotic hygromycin B (3 mg / L) and cultured at 25°C, 16 h light / 8 h dark for 10-15 days.

[0195] The formula of the culture medium used above is as follows:

[0196] TY medium (1L): 5g of tryptone, 3g of yeast extract powder, and the balance is water. 7g of agar is added to the solid medium. After high-pressure sterilization at 121°C for 20min, 10mL of sterile calcium chloride (1M), 500μL of 25mg / mL Rif and 1mL of 50mg / mL Kan are added.

[0197] Seed germination medium 1 / 2MS (1L): Murashige & Skoog (MS) Basal Medium (M519) (PhytoTechnology Laboratories TM) 2.22 g, sucrose 15 g, balance water, pH 5.85, add 7 g agar, and sterilize by high pressure at 121°C for 20 min.

[0198] Co-culture medium 1 / 2MSCO (1L): Murashige & Skoog (MS) Basal Medium (M519) (PhytoTechnology Laboratories TM) 2.22 g, sucrose 15 g, the balance is water, pH 5.85, 7 g agar is added to the solid culture medium, after high-pressure sterilization at 121°C for 20 min, acetosyringone (100 mM) is added at a ratio of 1 / 1000.

[0199] Screening medium 1 / 2MSH (1L): Murashige & Skoog (MS) Basal Medium (M519) (PhytoTechnology Laboratories TM) 2.22g, sucrose 15g, the balance is water, pH 5.85, add 7g agar to the solid culture medium, sterilize at 121°C for 20min, then add cephalosporin antibiotics (200mg / mL) at a ratio of 1 / 2000, and add hygromycin (15mg / mL) at a ratio of 1 / 3000.

[0200] 3. Identification of positive transgenic plants

[0201] The results of transformation phenotype identification are as follows Figure 3 -A, 71.6% of the hairy roots induced by pHSE401-MsU6-9T-RH1 (abbreviated as 9T-RH1) and 77.4% of the hairy roots induced by pHSE401-MsU6-9T-RUBY (abbreviated as 9T-RUBY) accumulated anthocyanins and betalains, respectively, showing dark purple or rose red.

[0202] The transformation of pHSE401-MsU6-9T (abbreviated as 9T) without the pigment reporter gene expression cassette requires the extraction of genomic DNA and then PCR detection of transgenic positive hairy roots. The PCR reaction system is shown in Table 1. Plasmid pHSE401-MsU6-9T was used as a positive control, and the recipient material genomic DNA was used as a negative control. The primers M13F / MsU6g1-seqR were used to amplify the sgRNA module, and the target band size was 1363 bp.

[0203] The nucleotide sequence of primer M13F / MsU6g1-seqR is as follows:

[0204] M13F: TGTAAAACGACGGCCAGT;

[0205] MsU6g1-seqR:GTAGATCTCATTGATAGCTC.

[0206] Table 1 PCR amplification system

[0207]

[0208] The reaction procedure was as follows: first round: 95°C denaturation for 3 min; second round: 95°C denaturation for 15 sec, 55°C annealing for 30 sec, 72°C extension for 30 sec, 35 cycles; third round: 72°C extension for 2 min. Experimental Example 3 Plant multi-gene editing vector editing efficiency detection test

[0209] 1 Test method

[0210] Specific primers were designed near the target site of the target gene MsTFL1s genome sequence (ensuring that the target site was within 100 bp of the primer at one end), and Hi-TOM sequencing adapters were added at both ends to amplify each target site of MsTFL1s, as shown in Table 2:

[0211] Table 2 Primer sequences for amplifying each target site of MsTFL1s

[0212]

[0213] 2 Test results

[0214] The PCR product is sent to the company for Hi-TOM sequencing to analyze the mutations near the target site and determine whether editing has occurred. Figure 3 -B, all three vectors successfully induced multiple genome editing. Using the pigment reporter gene, a higher proportion of multi-target co-editing can be detected. Figure 3 -C, in the hair roots transformed by 9T, no more than 5 target sites were edited simultaneously in 77.8% of the hair roots: 14.8% (0), 33.3% (1), 11.1% (3), 3.7% (4), 14.8% (5), while in the hair roots transformed by 9T-RH1 and 9T-RUBY, 52.2% and 62.5% had at least 6 target sites edited simultaneously, respectively. For 9T, 9T-RH1 and 9T-RUBY, the percentages of transformed hair roots with 8 target sites edited simultaneously were 7.4%, 13.0% and 18.8%, respectively. It is worth noting that in the hair roots transformed by 9T-RH1, 4.4% had 9 target sites edited simultaneously.

[0215] Experimental Example 4: Stable genetic transformation experiment using pHSE401-MsU6-9T-RUBY vector to transform alfalfa leaves

[0216] The multi-gene editing vector pHSE401-MsU6-9T-RUBY obtained in Experiment 2 was transformed into Agrobacterium (AGL1) by Agrobacterium-mediated transformation, and then infected alfalfa leaves. The transformation receptor material was Zhongmu No. 1. The specific transformation steps and various culture medium formulas used refer to the literature (Fu CX, Hernandez T, Zhou CE, Wang ZY (2015) Alfalfa (Medicago sativa L.). In: Wang K (ed.) Agrobacterium Protocols. Methods Mol Biol 1223: 213-221). The experimental results are shown in Figure 4 As shown, in the late stage of callus induction 1 to 2 months after infection, a small number of calli appeared red. When they were transferred to light and began to differentiate and regenerate shoots, the color development ratio increased and the red regenerated shoots were able to take root normally.

Claims

1. Use of RH1 gene as a pigment reporter gene for plant genetic transformation; the nucleotide sequence of the RH1 gene is shown in SEQ ID No.

2.

2. A plant genetic transformation vector containing a pigment reporter gene expression cassette, characterized in that: The pigment reporter gene is the RH1 gene; the nucleotide sequence of the RH1 gene is shown in SEQ ID No.

2.

3. A visualized plant multi-gene editing vector, comprising an sgRNA expression cassette and a Cas9 expression cassette, wherein the number of the sgRNA expression cassettes is 2 or more and the sgRNA expression cassettes are connected in series; the components of each sgRNA expression cassette include an endogenous U6 promoter of alfalfa, a target sequence sgRNA targeting a plant gene, and a terminator; the number of the target sequence sgRNA targeting a plant gene is 2 or more and each target sequence sgRNA is connected in series using tRNA; characterized in that, A pigment reporter gene expression cassette is inserted into the plant multi-gene editing vector.

4. The visualized plant multi-gene editing vector according to claim 3, characterized in that: A pigment reporter gene expression cassette is inserted into the PmeI restriction site of the plant multi-gene editing vector.

5. The visualized plant multi-gene editing vector according to claim 4, characterized in that: The pigment reporter gene expression cassette comprises: a promoter, a pigment reporter gene and a terminator, wherein the pigment reporter gene is an RH1 gene or a RUBY gene; wherein the nucleotide sequence of the RH1 gene is shown in SEQ ID No.2; the nucleotide sequence of the RUBY gene is shown in SEQ ID No.4; the promoter is a CmYLCV promoter, and the nucleotide sequence of the CmYLCV promoter is shown in SEQ ID No.1; the terminator is an AtHSPt terminator, and the nucleotide sequence of the AtHSPt terminator is shown in SEQ ID No.

3.

6. The visualized plant multi-gene editing vector according to claim 3 or 4, characterized in that: The pigment reporter gene expression cassette contains one or more restriction sites for inserting or replacing one or more foreign genes; wherein the restriction site is KpnI or BsrGI.

7. The visualized plant multi-gene editing vector according to claim 3, characterized in that: The number of the sgRNA expression cassettes is 3; the number of target sequence sgRNAs targeting plant genes in each sgRNA expression cassette is 3; wherein, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets different genes of the plant or targets the same gene of the plant; preferably, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets different genes or the same gene in the alfalfa genome; more preferably, the target sequence sgRNA targeting plant genes in each sgRNA expression cassette targets the MsTFL1c gene in the alfalfa genome, the MsTFL1a gene in the alfalfa genome, or the MsTFL1b gene in the alfalfa genome, respectively.

8. The visualized plant multi-gene editing vector according to claim 3, characterized in that: The alfalfa endogenous U6 promoter is selected from the group consisting of MtU6-d1 promoter, MsU6-g1 promoter, and MsU6-d3 promoter; The method of using tRNA to connect each target sequence sgRNA in series includes: connecting a tRNA to the 5' end of each target sequence sgRNA, and connecting a sgRNA scaffold to the 3' end of the target sequence sgRNA; The terminator is AtU6-26t terminator; a transcription start site G is connected after the promoter sequence in each sgRNA expression cassette.

9. The visualized plant multi-gene editing vector according to claim 3, characterized in that: The plant is a legume; preferably, the legume is alfalfa; more preferably, the alfalfa is alfalfa.

10. Use of the visualized plant multi-gene editing vector according to any one of claims 3 to 5 in editing multiple genes in plants or expressing exogenous genes in plants.

Images