Construction method and application of GSDMB intestinal epithelial specific knock-in mouse model

Abstract

The invention discloses a construction method and application of a GSDMB intestinal epithelium specific knock-in mouse model. The construction method comprises the following steps: (1) designing gRNA according to an ROSA26 gene, constructing a Donor vector containing a GSDMB gene, introducing the gRNA and the Donor vector and Cas mRNA into a fertilized egg of a receptor mouse, transplanting the fertilized egg and Cas mRNA into a pseudopregnant mouse body for reproduction, and screening out a GSDMB gene knock-in F0-generation mouse; (2) mating and breeding the F0 generation mouse and a wild type mouse, and screening out an F1 heterozygote mouse with GSDMB knocked in; (3) carrying out inbreeding propagation on the F1 heterozygote mouse, and screening out an F2 homozygote mouse in which GSDMB is knocked; (4) the F2 homozygote mouse and the intestinal epithelium specific Vilin-Cre transgenic mouse are subjected to mating breeding, and a heterozygote mouse with GSDMB intestinal epithelium specific knock-in is screened out; and (5) carrying out inbreeding propagation on the heterozygote mouse with the GSDMB intestinal epithelium specific knock-in, and screening out the homozygote mouse with the GSDMB intestinal epithelium specific knock-in.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal model construction, and particularly relates to a construction method and application of a GSDMB intestinal epithelium-specific knock-in mouse model. Background Art

[0002] Proinflammatory cell death mediated by the Gasdermin protein family plays an important role in host defense, cytokine secretion, inflammatory diseases and tumors. Among them, Gasdermin B (GSDMB) is mainly expressed in the gastrointestinal tract, airway epithelium, lymphoid tissue and various tumors. Genome-wide association studies have shown that GSDMB polymorphism is closely related to susceptibility to asthma, inflammatory bowel disease and other chronic inflammatory diseases. GSDMB may be an important target for intervention in chronic inflammatory diseases such as tumors, asthma, and inflammatory bowel disease. GSDMB (Gasdermin B) plays an important role in intestinal diseases, especially inflammatory bowel disease (IBD). Studies have shown that the role of GSDMB in IBD is complex and multifaceted, involving not only cell pyroptosis, but also the repair of intestinal epithelium and the maintenance of barrier function. These findings provide a new perspective for the development of therapeutic strategies targeting GSDMB, which may help improve the effects of intestinal epithelial repair and inflammation resolution.

[0003] As a widely used mammalian model biological system, mice have the advantages of small size, easy maintenance and operation, short breeding cycle, and similarity to humans in genomic and physiological characteristics, and corresponding mature gene modification technology has been developed. However, GSDMB is the only Gasdermins protein that lacks a mouse homolog, which limits the current in vitro study of GSDMB in mouse disease models. The GSDMB systemic knock-in mouse model that has been established is helpful to decipher the cancer function of GSDMB in vivo and has high application value in drug screening and regulatory mechanisms targeting GSDMB. However, the GSDMB systemic knock-in mouse model cannot well simulate the clinical symptoms of patients with intestinal diseases. In order to reveal the pathogenesis of GSDMB in inflammatory bowel disease and develop effective therapeutic drugs and precise targeting methods for intestinal diseases, it is urgent to construct a GSDMB intestinal epithelial-specific knock-in mouse model. Summary of the invention

[0004] The purpose of the present invention is to provide a GSDMB intestinal epithelium-specific knock-in mouse model.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides a method for constructing a GSDMB intestinal epithelium-specific knock-in mouse model, the construction method comprising the following steps:

[0007] (1) Designing and in vitro transcribed gRNA based on the mouse ROSA26 gene, constructing a Donor vector containing the GSDMB gene, introducing the gRNA, the Donor vector containing the GSDMB gene and the Cas mRNA into the fertilized eggs of recipient mice at the same time, and then transplanting the fertilized eggs of recipient mice into pseudo-pregnant mice for reproduction, and screening the F0 generation mice with the GSDMB gene knocked in through gene identification;

[0008] (2) mating the F0 generation mice with wild-type mice, and selecting F1 heterozygous mice with GSDMB knock-in through gene identification;

[0009] (3) inbreeding the F1 heterozygous mice, and selecting F2 homozygous mice with systemic knock-in of GSDMB through gene identification;

[0010] (4) mating the F2 homozygous mice with intestinal epithelium-specific Villin-Cre transgenic mice, and selecting heterozygous mice with GSDMB intestinal epithelium-specific knock-in through gene identification;

[0011] (5) The heterozygous mice with GSDMB intestinal epithelium-specific knock-in are inbred, and homozygous mice with GSDMB intestinal epithelium-specific knock-in are selected through gene identification, which is the GSDMB intestinal epithelium-specific knock-in mouse model.

[0012] In an embodiment of the present invention, Cas mRNA translates into Cas protein in vivo, and Cas protein binds to the target site under the guidance of gRNA to cause double-stranded DNA breaks. The broken double strands are repaired using Donor as a template during the repair process, thereby achieving modification of the target gene.

[0013] According to a specific embodiment of the present invention, the nucleotide sequence of the gRNA is GGCAGGCTTAAAGGCTAACC.

[0014] According to a specific embodiment of the present invention, the sequence of the Cas mRNA is shown in SEQ ID NO: 2.

[0015] In an embodiment of the present invention, the GSDMB gene is a humanized GSDMB gene (hGSDMB).

[0016] According to a specific embodiment of the present invention, the sequence of the GSDMB gene is shown in SEQ ID NO:3.

[0017] In the embodiment of the present invention, the Donor vector containing the GSDMB gene contains a CAG promoter, a loxP-stop-loxP structure and the GSDMB gene.

[0018] According to a specific embodiment of the present invention, the Donor vector containing the GSDMB gene is mROSA26-CAG-loxp-stop-loxp-hGSDMB, and its map is as follows: Figure 1 shown.

[0019] According to a specific embodiment of the present invention, the Donor vector is a PUC ROSA26-CAG-loxp-mcherry-stop-loxp-hGSDMB-BPA vector.

[0020] In an embodiment of the present invention, the gRNA, the Donor vector and the Cas mRNA are co-injected or co-electroplated into the cytoplasm or nucleus of a fertilized mouse egg. For example, the gRNA, the Donor vector and the Cas mRNA are introduced into the fertilized egg of the recipient mouse by microinjection.

[0021] According to a specific embodiment of the present invention, the PCR primers used for gene identification in steps (1) to (5) are as follows:

[0022]

[0023]

[0024] In the embodiment of the present invention, the PCR reaction procedure used in the gene identification in steps (1) to (5) is as follows:

[0025]

[0026] According to a specific embodiment of the present invention, the PCR reaction procedure used in the gene identification in steps (1) to (5) is as follows:

[0027]

[0028] The second aspect of the present invention provides the use of the GSDMB intestinal epithelium-specific knock-in mouse model constructed by the above-mentioned construction method in studying the pathogenesis of intestinal diseases related to GSDMB regulation.

[0029] In an embodiment of the present invention, the intestinal disease includes but is not limited to inflammatory bowel disease, intestinal fibrosis or intestinal tumors.

[0030] The third aspect of the present invention also provides the use of the GSDMB intestinal epithelium-specific knock-in mouse model constructed by the above-mentioned construction method in the preparation, screening or evaluation of intestinal disease-related drugs.

[0031] In an embodiment of the present invention, the intestinal disease-related drugs include clinical experimental drugs, including but not limited to one or more drugs for treating or preventing inflammatory bowel disease, intestinal fibrosis or intestinal tumors.

[0032] Compared with the prior art, the present invention has the following advantages:

[0033] The present invention provides a method for constructing a GSDMB intestinal epithelium-specific knock-in mouse model. The constructed mouse model epithelium-specifically expresses GSDMB protein. As a tool mouse model for intestinal diseases related to GSDMB regulation, the model can be used to study the pathogenesis of intestinal diseases related to GSDMB regulation and to prepare, screen or evaluate intestinal disease-related drugs, thereby promoting the diagnosis and treatment of intestinal diseases and the development of related drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 is the map of mROSA26-CAG-loxp-stop-loxp-hGSDMB DONOR;

[0035] Figure 2 It is the map of some fragments in PUC mRosa26 CAG-MCS;

[0036] Figure 3 Electropherogram for short chain screening and identification;

[0037] Figure 4 Electropherograms for identification of gene insertion;

[0038] Figure 5 The electrophoresis diagrams are for genotyping of F1 generation, F2 generation and homozygous mice with GSDMB intestinal epithelium-specific knock-in, GSDMB flox / floxVillin-Cre;

[0039] Figure 6 Four-week-old wild-type mice (WT) and four-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre) and 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl Comparison of GSDMB expression in ileum, colon, liver and kidney of Villin-Cre;

[0040] Figure 7 Four-week-old wild-type mice (WT) and four-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre) and 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl Comparison of colon length changes in Villin-Cre;

[0041] Figure 8 Four-week-old wild-type mice (WT) and four-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre) and 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl Comparison of intestinal HE staining of Villin-Cre;

[0042] Fig. 9 Four-week-old wild-type mice (WT) and four-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre) and 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl Comparison of changes in mRNA levels of Villin-Cre). DETAILED DESCRIPTION

[0043] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0044] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0045] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0046] Unless otherwise specified, the present invention will be implemented using conventional polypeptide artificial synthesis methods, polypeptide antigen animal immunization methods, antibody purification methods, biotechnology detection methods, etc. Experimental methods without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0047] Example 1

[0048] This example provides a method for constructing a GSDMB intestinal epithelium-specific knock-in mouse model, the method comprising the following steps:

[0049] (1) Based on the mouse ROSA26 gene, gRNA was designed and transcribed in vitro, and a Donor vector containing the GSDMB gene was constructed. The gRNA, the Donor vector containing the GSDMB gene, and the Cas mRNA were simultaneously microinjected into the fertilized eggs of recipient mice. The fertilized eggs of recipient mice were then transplanted into pseudopregnant mice for reproduction, and the F0 generation mice with GSDMB gene knock-in were selected through genetic identification.

[0050] Specifically, the nucleotide sequence of the specific site-directed gRNA designed and in vitro transcribed in this embodiment is: GGCAGGCTTAAAGGCTAACC (SEQ ID NO: 1). The Cas mRNA is Cas9 mRNA, and the sequence is shown in SEQ ID NO: 2. The sequence of the GSDMB gene is shown in SEQ ID NO: 3, and the Donor vector is PUC ROSA26-CAG-loxp-mcherry-stop-loxp-hGSDMB-BPA (the gene expression cassette structure is: mROSA26-CAG-loxp-stop-loxp-hGSDMB, Figure 1 ), the construction method is as follows:

[0051] (a) Construction of PUC mRosa26 CAG-MCS1000homo-arm DONOR ( Figure 2 ): The mRosa26-1karm-out and 1000homo-arm fragments were amplified, and then homologously recombined with the backbone PUC57-Rbpsm2 EcorI / XhoI to construct a plasmid. The mouse genome or 1karm-out was used as the amplification template. The amplification primers and plasmid identification primers are shown in Table 1.

[0052] Table 1

[0053]

[0054]

[0055] The PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.

[0056] Table 2

[0057]

[0058] Table 3

[0059]

[0060] (b) Construction of PUC-hGSDMB-BPA vector, containing hGSDMB and BPA-MCS, with backbone source: PUC57-Rbpsm2EcorI / XhoI: hGSDMB amplified fragment and BPA-MCS amplified fragment were homologously recombined with pCAG-loxp-mcherry-stop-loxp-BPA / AgeI+NotI to construct pCAG-loxp-mcherry-stop-loxp-

[0061] hGSDMB-BP plasmid (abbreviated as PUC-hGSDMB-BPA vector). Amplification primers and vector identification primers are shown in Table 4, PCR reaction system is shown in Table 2, and PCR reaction program is shown in Table 3.

[0062] Table 4

[0063]

[0064] (c) Construction of PUC ROSA26-CAG-loxp-mcherry-stop-loxp-hGSDMB-BPA vector: PUC mRosa26 CAG-MCS1000homo-arm DONOR was cut with SpeI and SacI, and then treated with CIAP for subsequent DNA recombination; pInsulator-CAG-loxP-stop-loxP Pqbp1 BGH was cut with SpeI and NheI; PUC-hGSDMB-BPA vector was cut with NheI and SacI, and the above three enzyme-cut fragments were linked and transformed to form PUC ROSA26-CAG-loxp-stop-loxp-hGSDMB-BPA vector. The identification primers and sequencing primers are shown in Table 5, the PCR reaction system is referenced in Table 2, and the PCR reaction program is referenced in Table 3.

[0065] Table 5

[0066]

[0067]

[0068] In this embodiment, the recipient mouse fertilized egg is a 0.5-day recipient mouse fertilized egg, and the pseudo-pregnant mouse is a 0.5-day pseudo-pregnant female mouse. The identification primers for F0 generation mice refer to Table 5, the PCR reaction system refers to Table 2, and the PCR reaction program refers to Table 3. The electrophoresis results of the short chain screening of the 4-week F0 generation mice are shown in Figure 3 , the electrophoresis results of the insertion identification are shown in Figure 4 .

[0069] (2) The F0 generation mice were mated with wild-type mice, and the GSDMB knock-in F1 heterozygous mice were screened through gene identification;

[0070] (3) The F1 heterozygous mice were inbred and the F2 homozygous mice with systemic knock-in of GSDMB were selected through gene identification;

[0071] (4) F2 homozygous mice were mated with intestinal epithelium-specific Villin-Cre transgenic mice, and heterozygous mice with GSDMB intestinal epithelium-specific knock-in were selected through gene identification;

[0072] (5) The heterozygous mice with GSDMB intestinal epithelium-specific knock-in were inbred, and the homozygous mice with GSDMB intestinal epithelium-specific knock-in were screened out through genetic identification, which is the GSDMB intestinal epithelium-specific knock-in mouse model.

[0073] 4-week-old wild-type mice (WT), 4-week-old GSDMB knock-in F1 heterozygous mice (GSDMB fl / - ), 4-week-old F2 homozygous mice (GSDMB fl / fl ), 4-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre), 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl The electrophoresis results of Villin-Cre insertion identification are shown in Figure 5 Compared with WT mice, both heterozygous and homozygous GSDMB knock-in mice have the GSDMB gene detection results. The right figure is the identification result of the intestinal epithelium conditional knock-in of Villin-Cre, which verifies that GSDMB fl / - 、GSDMB fl / fl There is a specific knock-in for the intestinal epithelium.

[0074] 4-week-old wild-type mice (WT) and 4-week-old heterozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / - Villin-Cre) and 4-week-old homozygous mice with GSDMB intestinal epithelium-specific knock-in (GSDMB fl / fl The expression of GSDMB in the ileum, colon, liver and kidney of Villin-Cre is shown in Figure 6 , the changes in colon length are shown in Figure 7 , intestinal HE staining results are compared in Figure 8 , the changes in mRNA levels of intestinal inflammatory factors are shown in Fig. 9 .

[0075] The above results show that this example successfully constructed a tool mouse model for intestinal epithelial-specific expression of GSDMB protein, which can be used to study the pathogenesis of intestinal diseases related to GSDMB regulation and to prepare, screen or evaluate intestinal disease-related drugs, and promote the diagnosis and treatment of intestinal diseases and related drug development.

[0076] The above detailed description of the present invention is intended to enable those skilled in the art to understand the contents of the present invention and implement them, but it does not limit the protection scope of the present invention. The present invention is not limited to the above embodiments, and any equivalent changes or modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for constructing a GSDMB intestinal epithelium-specific knock-in mouse model, characterized in that: The construction method comprises the following steps: (1) Designing and in vitro transcribed gRNA based on the mouse ROSA26 gene, constructing a Donor vector containing the GSDMB gene, introducing the gRNA, the Donor vector containing the GSDMB gene and the Cas mRNA into the fertilized eggs of recipient mice at the same time, and then transplanting the fertilized eggs of recipient mice into pseudo-pregnant mice for reproduction, and screening the F0 generation mice with the GSDMB gene knocked in through gene identification; (2) mating the F0 generation mice with wild-type mice, and selecting F1 heterozygous mice with whole-body knock-in of GSDMB through gene identification; (3) inbreeding the F1 heterozygous mice, and selecting F2 homozygous mice with systemic knock-in of GSDMB through gene identification; (4) mating the F2 homozygous mice with intestinal epithelium-specific Villin-Cre transgenic mice, and selecting heterozygous mice with GSDMB intestinal epithelium-specific knock-in through gene identification; (5) The heterozygous mice with GSDMB intestinal epithelium-specific knock-in are inbred, and homozygous mice with GSDMB intestinal epithelium-specific knock-in are selected through gene identification, which is the GSDMB intestinal epithelium-specific knock-in mouse model.

2. The construction method according to claim 1, characterized in that: The nucleotide sequence of the gRNA is GGCAGGCTTAAAGGCTAACC, And / or, the sequence of the Cas mRNA is as shown in SEQ ID NO: 2, And / or, the GSDMB gene is a humanized GSDMB gene, whose sequence is shown in SEQ ID NO:

3.

3. The construction method according to claim 2, characterized in that: The Donor vector containing the GSDMB gene contains a CAG promoter, a loxP-stop-loxP structure and the GSDMB gene.

4. The construction method according to claim 3, characterized in that: The structure of the gene expression cassette of the Donor vector containing the GSDMB gene is ROSA26-CAG-loxp-stop-loxp-hGSDMB, and the Donor vector map is shown in FIG1 .

5. The construction method according to claim 4, characterized in that: The Donor vector is a PUC ROSA26-CAG-loxp-mcherry-stop-loxp-hGSDMB-BPA vector.

6. The construction method according to claim 2, characterized in that: The PCR primers used for gene identification in steps (1) to (5) are as follows: And / or, the PCR reaction procedure used in the gene identification in steps (1) to (5) is as follows:

7. Use of the GSDMB intestinal epithelium-specific knock-in mouse model constructed by the construction method according to any one of claims 1 to 6 in studying the inventive mechanism of intestinal diseases related to GSDMB regulation.

8. The use according to claim 7, characterized in that: The intestinal diseases include inflammatory bowel disease, intestinal fibrosis or intestinal tumors.

9. Use of the GSDMB intestinal epithelium-specific knock-in mouse model constructed by the construction method according to any one of claims 1 to 6 in the preparation, screening or evaluation of intestinal disease-related drugs.

10. The use according to claim 9, characterized in that: The intestinal disease-related drugs include one or more drugs for treating or preventing inflammatory bowel disease, intestinal fibrosis or intestinal tumors.

Images