Construction method and application of INPP5E gene knockout animal model

Abstract

The invention discloses a construction method and application of an INPP5E gene knockout animal model, and provides a good basis for researching embryonic neurodevelopment and pathogenesis of fiberopathy. The method comprises the following steps: (1) determining specific target sites usgRNA4 and dsgRNA1 of an INPP5E gene, and carrying out in-vitro transcription on the specific target sites and Cas9 nuclease to obtain mRNA; (2) carrying out micro-injection on the active usgRNA4, dsgRNA1 and Cas9RNA into a fertilized egg of the mouse to obtain an INPP5E gene knockout mouse, wherein the usgRNA4, the dsgRNA1 and the Cas9RNA are subjected to micro-injection; the usgRNA4 is as shown in SEQ ID NO. 1, and the dsgRNA1 is as shown in SEQ ID NO. 2.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a method for constructing an INPP5E gene knockout animal model, and application of the INPP5E gene knockout animal model in embryonic neural development and ciliopathy. Background Art

[0002] The inositol polyphosphate-5-phosphatase IV (INPP5E) gene is located on human chromosome 9q34.3, contains 10 exons, 3984 bp, and encodes a protein INPP5E composed of 644 amino acids and a molecular weight of 72 kDa, belonging to the 5-phosphatase family. It is a key enzyme in phosphatidylinositol metabolism, has a variety of important biological functions, and is a key signaling molecule in many intracellular signal transduction pathways. Studies have shown that the INPP5E gene plays an important role in the embryonic neural development process. At the same time, this gene is also an important ciliopathy gene. Many ciliopathy are often accompanied by neural tube defect phenotypes, such as Meckel-Gruber syndrome (MKS), Joubert syndrome (JBTS) and Bardet-Biedl syndrome (BBS). There are neural developmental defects in the clinical manifestations; brain bulge is a common feature of MKS and JBTS.

[0003] However, relevant research on INPP5E is still very limited, and the construction of a gene knockout mouse model can provide a basis for studying the pathogenesis of the above diseases.

[0004] The INPP5E gene is located on the antisense strand of mouse chromosome 2 and has seven transcripts. Gene knockout mouse models can provide a basis for studying the pathogenesis.

[0005] Chinese patent document CN107043787A discloses a method for constructing a MARF1 site-directed mutation mouse model based on CRISPR / Cas9. Chinese patent document CN104293831A discloses a method for establishing a hypertensive mouse model based on CRISPR / Cas9 gene knockout technology. Chinese patent document CN105950639A discloses a method for preparing a Staphylococcus aureus CRISPR / Cas9 system and its application in constructing a genetically modified mouse model. Chinese patent document CN106172238A discloses a method for establishing a miR-124 gene knockout mouse animal model using CRISPR / Cas9 gene knockout technology. However, there is no report on the construction method of the INPP5E gene knockout mouse animal model. Summary of the invention

[0006] In order to overcome the defects of the prior art, the technical problem to be solved by the present invention is to provide a method for constructing an INPP5E gene knockout animal model, which provides a good basis for studying embryonic neural development and the pathogenesis of ciliary diseases.

[0007] The technical solution of the present invention is: a method for constructing such an INPP5E gene knockout animal model, which comprises the following steps:

[0008] (1) Determine the specific target site of INPP5E gene, usgRNA4 and dsgRNA1, and transcribe them into mRNA in vitro with Cas9 nuclease;

[0009] (2) Active usgRNA4, dsgRNA1, and Cas9 RNA were microinjected into mouse fertilized eggs to obtain INPP5E gene knockout mice;

[0010] The usgRNA4 is shown as SEQ ID NO.1, and the dsgRNA1 is shown as SEQ ID NO.2.

[0011] The beneficial technical effects of the present invention are as follows:

[0012] The present invention successfully constructed INPP5E gene knockout mice for the first time, providing a good basis for studying embryonic neural development and the pathogenesis of ciliary diseases.

[0013] Also provided is an application of the INPP5E gene knockout animal model for purposes other than disease diagnosis and treatment, the application comprising: using the INPP5E gene knockout animal model obtained by the construction method to study embryonic neural development and ciliopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1Shown is the gel electrophoresis diagram for genotyping of INPP5E-KO F0 mice born on April 21. M: INPP5E-KO mouse 3752-3777 tail lysate mixture; N (negative control): C57 mouse tail lysate; B (blank control): sterile water; F0 positive mice: 3756, 3762.

[0015] Figure 2 Shown is the gel electrophoresis diagram for genotyping of INPP5E-KO F0 mice born on May 1. N (negative control): C57 mouse tail lysate; B (blank control): sterile water; F0 positive mice: 3836, 3840.

[0016] Figure 3 Shown are the upstream sequencing results of 3756 and 3762.

[0017] Figure 4 Displayed are the upstream sequencing results of 3836 and 3840.

[0018] Figure 5 Displayed are the downstream sequencing results of 3756 and 3762.

[0019] Figure 6 Displayed are the downstream sequencing results of 3836 and 3840.

[0020] Figure 7 Shown is the gel electrophoresis diagram for genotyping of INPP5E-KO F0 mice born on August 13. N (negative control): C57 mouse tail lysate; B (blank control): sterile water; F0 positive mice: 5141, 5143, 5149, 5150.

[0021] Figure 8 Displayed are the upstream sequencing results of 5141, 5143, 5149, and 5150.

[0022] Fig. 9 Displayed are the downstream sequencing results of 5141, 5143, 5149, and 5150.

[0023] Fig.10 Shown are gel electrophoresis images of genotype identification of INPP5E-KO F0 mice born on August 25 and August 27. P (positive control): INPP5E-KO mouse 5141 tail lysate; N (negative control): C57 mouse tail lysate; B (blank control): sterile water; F0 positive mice: 5270, 5271.

[0024] Fig.11 Displayed are the upstream sequencing results of 5270 and 5271.

[0025] Fig.12Displayed are the downstream sequencing results of 5270 and 5271.

[0026] Fig.13 Shown is the gel electrophoresis diagram for the identification of INPP5E-KO F1 mouse genotype. P (positive control): INPP5E-KO mouse 3836 tail lysate; N (negative control): C57 mouse tail lysate; B (blank control): sterile water; among them, F1 positive mice: 6189.

[0027] Fig.14 Shown is the 6189 upstream sequencing primer.

[0028] Fig.15 Shown are 6189 downstream sequencing primers.

[0029] Fig.16 Shown is the gel electrophoresis diagram for genotyping of INPP5E-KO F2 mice. N (negative control): C57 mouse tail lysate; B (blank control): sterile water; F2 positive mice: 7050, 7052, 7055.

[0030] Fig.17 Displayed are the upstream sequencing results of 7050, 7052, and 7055.

[0031] Fig.18 Displayed are the downstream sequencing results of 7050, 7052, and 7055. DETAILED DESCRIPTION

[0032] The method for constructing the INPP5E gene knockout animal model comprises the following steps:

[0033] (1) Determine the specific target site of INPP5E gene, usgRNA4 and dsgRNA1, and transcribe them into mRNA in vitro with Cas9 nuclease;

[0034] (2) Active usgRNA4, dsgRNA1, and Cas9 RNA were microinjected into mouse fertilized eggs to obtain INPP5E knockout mice;

[0035] The usgRNA4 is shown as SEQ ID NO.1, and the dsgRNA1 is shown as SEQ ID NO.2.

[0036] The beneficial technical effects of the present invention are as follows:

[0037] The present invention successfully constructed INPP5E gene knockout mice for the first time, providing a good basis for studying embryonic neural development and the pathogenesis of ciliary diseases.

[0038] Preferably, the step (2) comprises the following sub-steps:

[0039] (2.1) Inducing ovulation and in vitro fertilization of mice, and cultivating fertilized eggs;

[0040] (2.2) Microinjecting active usgRNA4, dsgRNA1 and Cas9 RNA into mouse fertilized eggs;

[0041] (2.3) In vitro culture of fertilized eggs, implantation into recipients, and cultivation of targeted gene-modified animals.

[0042] Preferably, the step (2.2) comprises the following sub-steps:

[0043] (2.2.1) The fertilized eggs that survived the injection were transplanted into pseudo-pregnant female mice to produce mice, which are the F0 generation mice;

[0044] (2.2.2) Extract DNA from the tail of F0 mice, amplify by PCR and send the product for sequencing;

[0045] (2.2.3) The positive F0 generation mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice;

[0046] (2.2.4) F1 heterozygous mice are hybridized to obtain F2 homozygous mice, which are the mouse animal model.

[0047] Preferably, in the step (2.2.2), the PCR amplification is carried out using

[0048] Primer pair INPP5E-newKOUF+INPP5E-KO-DR; the sequence of primer INPP5E-newKOUF is shown in SEQ ID NO.3; the sequence of primer INPP5E-KO-DR is shown in SEQ ID NO.4.

[0049] Preferably, in the step (2.2.3), 683+9 bp bases are deleted from the INPP5E gene of the positive F0 generation mice.

[0050] Preferably, in the step (2.2.3), the base sequence of the INPP5E gene deleted in the positive F0 generation mouse is as shown in SEQ ID NO.5.

[0051] Preferably, in the step (2.2.4), the genome sequence of the F2 generation homozygous mouse is as SEQ ID NO.6.

[0052] Preferably, PCR detection is performed on F2 mice using primers INPP5E-newKOUF+INPP5E-KO-DR to identify F2 homozygous mice; the sequence of primer INPP5E-newKOUF is shown in SEQ ID NO.3; the sequence of primer INPP5E-KO-DR is shown in SEQ ID NO.4.

[0053] SEQ ID NO.1 is: GGGCCAGGAAGTGGTTGGCA CGG

[0054] SEQ ID NO.2 is: TGCATGCTCCGCAGCCTACCG GGG

[0055] SEQ ID NO.3 is: TGGTTTTGTCCCGTAGCTGG

[0056] SEQ ID NO.4 is: ATTGTGCGTCATTCTGCTGTG

[0057] SEQ ID NO.5 is (taking No. 5149 F0 generation mouse as an example):

[0058] 5'CCACTGGGTTTGCAGCAGGGCAGATGGGAGCTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAAGTCCT

[0059] (CCGTGCCAACCACTTCCTGGCCCTTACTGAGCTGTGAGAAGCTGATAGATGGCTAGGCCTGCTCTGTGTATCGAAGTTGGCCTTTGCACCTAGACTGCAGAGAGCTTCCCATCCGCTGCAGTTGTTGACCTTGGCTGCTCCTATCACTGTCTCCTGGGGGGGAGCTGCTACCCAGCTGCGATTCTGTCTGGAAGGGGACGCAAACAAGGGAGGCCCTATCCTGTCCTAGAGCCCATCCATTTGTCTGCAAATCAGAGCAGATGAGGGGAGGCCAGCACCAATGTATTCTTTTACCACGTGCCCAGGGGATGTCACTACCCGGTTTGATGAGGTCTTCTGGTTTGGGGACTTCAACTTCCGCCTGAGTGGTGGACGAGTGGCTGTGGAGGCCTTCCTGAAGCAGAAACCTGAGGTGGATGTGCTGGCTCTCCTCCAACACGACCAGCTCACCCGGGAGATGAAGAAAGGTGAGTGGCCTGAGGAGCAGCACCTCAGGCATGGCCGGCCCTCCCTGACTCTCCTGTGTTGCAGGGTCCATCTTCAGGGGCTTTGAGGAGGCAGAGATTCACTTTCTTCCATCCTACAAGTTTGACATTGGGAAGGACACCTACGACAGCACCTCCAAGCAAAGGACACCCTCCTACACAGTGAGTATGTAACTTCAGCCTGACCTCAGGACTCCT)GCCAACCACAGCTCATGTCAAGCATGTAGGACTGACGCTCGGCACACAGCAGCCAGCCAGGTTAGCCAGCCTAGAACGTATCAGTCCTGAGGCCAGTGACTGCATGCTCG(CAGCCTACC)

[0060] GGGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAGAGTCACTCTGGAGCCCA 3’

[0061] Note: The sequences in parentheses are deleted sequences

[0062] SEQ ID NO.6 is:

[0063]

[0064] Also provided is an application of the INPP5E gene knockout animal model for purposes other than disease diagnosis and treatment, the application comprising: using the INPP5E gene knockout animal model obtained by the construction method to study embryonic neural development and ciliopathy.

[0065] The embodiments of the present invention are described in detail below.

[0066] Only INPP5E-202 and 205 of the INPP5E gene encode complete proteins. The total length of the coding sequence of exons 7 and 8 of the transcript INPP5E-205 (corresponding to exons 8 and 9 of the INPP5E-202 transcript) is 278bp, which is not an integer multiple of 3, so exons 7-8 of INPP5E-205 were selected as the object of CKO. When the Cre recombinase is expressed, exons 7-8 are deleted in the INPP5E gene CKO mice, resulting in a frameshift mutation in the amino acids encoded by them, thus achieving the knockout of the INPP5E gene.

[0067] The mouse INPP5E gene-specific sgRNA (single-guide RNA) was used to mediate the Cas9 nuclease to cut the genome at intron 6, resulting in specific DSBs (Double-Stranded Breaks). Exogenous Donor DNA was used as a template for repair through the HR (Homologous recombination) pathway, adding LoxP sequences on both sides of exons 7 and 8 of INPP5E-205.

[0068] The identification primers are shown in Table 1.

[0069] Table 1

[0070] Primer Sequence(5'-3') INPP5E-KO-UF TTGGTTTCTTAGCGTGGAGGA INPP5E-KO-DR ATTGTGCGTCATTCTGCTGTG INPP5E-newKOUF TGGTTTTGTCCCGTAGCTGG INPP5E-KO-DR ATTGTGCGTCATTCTGCTGTG

[0071] The present invention provides a research basis for in-depth research on the pathogenesis and behavioral exploration of INPP5E gene in mouse embryonic neural development, offspring growth, adult and elderly stages, and provides a research model for studying the molecular mechanism of inositol metabolism disorders and ciliopathy. The experimental results of the experimental group and the control group are given below, such as PCR test results, gene sequencing results, etc.

[0072] 1. F0 identification

[0073] (1) The first and second batches of F0

[0074] Figure 1The gel electrophoresis diagram for the genotype identification of the first batch of INPP5E-KO F0 mice was shown. Among them, M: INPP5E-KO mouse 3752-3777 mouse tail lysate mixture; N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0075] Figure 2 Shown is the gel electrophoresis diagram for genotyping of the second batch of INPP5E-KO F0 mice. Among them, N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0076] Figure 3 The upstream sequencing results are shown as PCR identification results, wherein the PCR identification results show that the sizes of bands 3756, 3762, 3836 and 3840 are about 690 bp, all of which are positive mice.

[0077] Figure 4 The downstream sequencing results of the PCR identification results are shown, wherein the PCR identification results show that the sizes of bands 3756, 3762, 3836 and 3840 are about 690 bp, all of which are positive mice.

[0078] The sequencing results showed that mice No. 3756, 3762, 3836 and 3840 were all positive mice, and the specific deletion sequences were as follows:

[0079] 3756#:

[0080] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGACG{del 7871bp}

[0081] GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAGAGTC

[0082] 3762#:

[0083] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGACGCC{del7867bp}

[0084] CGGGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAGAGTCACTCTGGAG

[0085] 3836#

[0086] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGAC{insA del 7868

[0087] bp}AGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAGAGTC

[0088] 3840#

[0089] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGA{insA del 7872

[0090] bp}GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAG AGTC

[0091] These four mice were sequenced, and the sequencing results showed that all four mice were knockout-positive mice.

[0092] (2) The third batch of animal models

[0093] Figure 5 Shown is the gel electrophoresis diagram for genotyping of the third batch of INPP5E-KO F0 mice, where N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0094] Figure 6 The upstream sequencing results of the PCR identification results are shown, wherein the PCR identification results show that 5141, 5143, 5149 and 5150 have a band of about 650 bp in size, indicating positive mice.

[0095] Figure 7 The downstream sequencing results of the PCR identification results are shown, wherein the PCR identification results show that 5141, 5143, 5149 and 5150 have a band of about 650 bp in size, indicating positive mice.

[0096] The sequencing results showed that mice No. 5141, 5143, 5149 and 5150 were all positive mice, and the specific deletion sequences were as follows:

[0097] 5141#

[0098] CTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAAGTCCTCCG{del800bp}GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGA

[0099] 5143#

[0100] AGCTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAAGTCCTCCGTG CC{del 794

[0101] bp}CGGGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGT

[0102] 5149#

[0103] GGGAGCTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAAGTCCT{del683

[0104] bp}GCCAACCACAGCTCATGTCAAGCATGTAGGACTGACGCTCGGCAC A CAGCAGCCAGCCAGGTTAGCCAGCCTAGAACGTATCAGTCCTGAGGCC AGTGACTGCATGCTCG{del 9

[0105] bp}GGGGTGGAGGATAGTGCTCTGAATGCA

[0106] 5150#

[0107] GGAGCTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAAGTCC{ins GT del 790

[0108] bp}CCGGGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGT

[0109] These four mice were sequenced, and the sequencing results showed that all four mice were knockout-positive mice.

[0110] (3) The fourth batch of animal models

[0111] Figure 8 The gel electrophoresis diagram for genotyping of the fourth batch of INPP5E-KO F0 mice is shown. Among them, P (positive control): INPP5E-KO mouse 5141 tail lysate; N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0112] Fig. 9 The upstream sequencing results of the PCR identification results are shown, wherein the PCR identification results show that the bands of about 650 bp at 5270 and 71 are positive mice.

[0113] Fig.10 The downstream sequencing results of the PCR identification results are shown, wherein the PCR identification results show that the bands of about 650 bp at 5270 and 71 are positive mice.

[0114] The sequencing results showed that mice No. 5270 and No. 5271 were both positive mice, and the specific deletion sequences were as follows:

[0115] AGATTCATGGAGTCCTCAAGACTGAAATAGCCACTGGGTTTGCAG CAGGGCAGATGGGAGCTCACAAGGTCCAGTGGCTTGGCTTGTCCTCAA GTCCTCCG{del 800bp}

[0116] GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGA

[0117] GAGTCACTCTGGAGCCCATCTGCCTGGCACTAGGTGAGAACAAGTGGC

[0118] AA

[0119] The two mice were sequenced, and the sequencing results showed that both mice were knockout-positive mice.

[0120] 2. F1 generation identification

[0121] When the positive F0 mice reach sexual maturity, they can be mated together with C57BL / 6J, 5141, 5143, 5149 and 5150 can be mated together with C57BL / 6J, and 5270 and 5271 can be mated together with C57BL / 6J.

[0122] Fig.11 Shown is the gel electrophoresis diagram for the identification of the genotype of INPP5E-KO F1 mice. Among them, P (positive control): INPP5E-KO mouse 3836 mouse tail lysate; N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0123] Fig.12 Shown are the sequencing results for mouse No. 6189.

[0124] The PCR identification results showed that 6189 might be a positive mouse. We sequenced this mouse, and the sequencing results showed that this mouse was a knockout positive mouse.

[0125] The sequencing results showed that mouse No. 6189 was a positive mouse, and the specific missing sequences were as follows:

[0126] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGA{insA del7872

[0127] bp}GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAG AGT

[0128] 3. Identification of F2 Generation

[0129] The 6189 positive mice obtained were placed in cages after they reached sexual maturity. Fig.13 Shown is the gel electrophoresis diagram for genotyping of INPP5E-KO F2 mice, where N (negative control): C57 mouse tail lysate; B (blank control): sterile water.

[0130] Fig.14 The upstream sequencing results of the PCR identification results are shown, among which the mouse is numbered 7050, 7052, and 7055.

[0131] Fig.15 Shown are the downstream sequencing results of the PCR identification results, where the mice are numbered 7050, 7052, and 7055.

[0132] The sequencing results showed that mice No. 7050, 7052, and 7055 were all positive mice, and the specific deletion sequences were as follows:

[0133] CCAGGACATTTAGACACCAGTTAACCCACTGGACCAAGA{insA del 7872

[0134] bp}GGGGTGGAGGATAGTGCTCTGAATGCATTACTGGCCACGGTGAG AGTC

[0135] In summary, the INPP5E gene knockout animal model was successfully constructed, and positive knockout offspring were successfully bred.

[0136] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the protection scope of the technical solution of the present invention.

Claims

1. A method for constructing an INPP5E gene knockout animal model, characterized in that: It includes the following steps: (1) Determine the specific target site of INPP5E gene, usgRNA4 and dsgRNA1, and transcribe them into mRNA in vitro with Cas9 nuclease; (2) Active usgRNA4, dsgRNA1, and Cas9 RNA were microinjected into mouse fertilized eggs to obtain INPP5E knockout mice; The usgRNA4 is shown as SEQ ID NO.1, and the dsgRNA1 is shown as SEQ ID NO.

2.

2. The method for constructing an INPP5E gene knockout animal model according to claim 1, characterized in that: The step (2) comprises the following sub-steps: (2.1) Inducing ovulation and in vitro fertilization of mice, and cultivating fertilized eggs; (2.2) Microinjecting active usgRNA4, dsgRNA1 and Cas9 RNA into mouse fertilized eggs; (2.3) In vitro culture of fertilized eggs, implantation into recipients, and cultivation of targeted gene-modified animals.

3. The method for constructing an INPP5E gene knockout animal model according to claim 2, characterized in that: The step (2.2) comprises the following sub-steps: (2.2.1) The fertilized eggs that survived the injection were transplanted into pseudo-pregnant female mice to produce mice, which are the F0 generation mice; (2.2.2) Extract DNA from the tail of F0 mice, amplify by PCR and send the product for sequencing; (2.2.3) The positive F0 generation mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice; (2.2.4) F1 heterozygous mice are hybridized to obtain F2 homozygous mice, which are the mouse animal model.

4. The method for constructing an INPP5E gene knockout animal model according to claim 3, characterized in that: In the step (2.2.2), the PCR amplification is carried out using INPP5E-newKOUF+INPP5E-KO-DR primer pair; the sequence of primer INPP5E-newKOUF is shown in SEQ ID NO.3; The sequence of primer INPP5E-KO-DR is shown in SEQ ID NO.

4.

5. The method for constructing an INPP5E gene knockout animal model according to claim 4, characterized in that: In the step (2.2.3), 683+9 bp bases were deleted from the INPP5E gene of the positive F0 generation mice.

6. The method for constructing an INPP5E gene knockout animal model according to claim 5, characterized in that: In the step (2.2.3), the base sequence of the INPP5E gene deleted in the positive F0 generation mouse is shown in SEQ ID NO.

5.

7. The method for constructing an INPP5E gene knockout animal model according to claim 6, characterized in that: In the step (2.2.4), the genome sequence of the F2 generation homozygous mouse is as shown in SEQ ID NO.

6.

8. The method for constructing an INPP5E gene knockout animal model according to claim 7, characterized in that: The F2 mice were tested by PCR using primers INPP5E-newKOUF+INPP5E-KO-DR to identify homozygous F2 mice; the sequence of primer INPP5E-newKOUF is shown in SEQ ID NO.3; the sequence of primer INPP5E-KO-DR is shown in SEQ ID NO. Shown in NO.

4.

9. Application of INPP5E gene knockout animal model for purposes other than disease diagnosis and treatment, characterized in that: The application includes: using the INPP5E gene knockout animal model obtained by the construction method according to any one of claims 1 to 8 to study embryonic neural development and ciliopathy.

Images