SNP molecular markers related to WSSV tolerance of procambarus clarkii and application of SNP molecular markers

Abstract

The invention relates to a group of related SNP molecular markers influencing WSSV tolerance of procambarus clarkii and application thereof. According to the invention, 11 SNP (Single Nucleotide Polymorphism) loci obviously related to WSSV (White Spot Syndrome Virus) tolerance are obtained from a procambarus clarkii population. Furthermore, a correlation analysis result between the HO-1 gene and the procambarus clarkia tolerance WSSV is verified through an activity difference displayed by a point mutation luciferase reporter vector of the procambarus clarkia HO-1 gene, finally four SNP molecular markers beneficial to the procambarus clarkia WSSV tolerance character are screened out, and the breeding process of the procambarus clarkia tolerance WSSV variety is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection, and in particular relates to a group of SNP molecular markers related to WSSV tolerance of Procambarus clarkii and applications thereof. Background Art

[0002] Procambarus clarkii is commonly known as crayfish. In recent years, the scale of Procambarus clarkii farming has been growing and has become an important freshwater economic shrimp. Epidemiological surveys show that Procambarus clarkii in different regions and different farming models generally carry WSSV, and WSSV-carrying individuals can be detected throughout the year, threatening the healthy farming of Procambarus clarkii. Once shrimps and crabs are infected with WSSV, the mortality rate within 3-10 days is as high as 80%-100%.

[0003] The immune system of vertebrates includes innate immunity and adaptive immunity, while invertebrates lack T and B lymphocytes. Therefore, they cannot resist pathogen invasion through highly specific adaptive immunity. The redox system plays an important role in protecting Procambarus clarkii from pathogens and improving virus tolerance. HO-1 is a downstream target protein of Nrf2, which can degrade heme to release biliverdin, CO and Fe 2+ .

[0004] The luciferase reporter gene system refers to a method of indirectly screening potential regulatory factors that affect the expression of target genes and quantifying their regulatory activity by quantifying the bioluminescence emitted by luciferase-catalyzed oxidation of luciferin to oxyluciferin. A reporter gene plasmid is constructed, such as pGL3-basic, which inserts a specific fragment of the target gene promoter in front of the luciferase expression sequence. The expression of luciferase is proportional to the intensity of the transcription factor. The traditional luciferase reporter vector does not insert the untranslated region of the complete target gene, but only intercepts a small sequence to construct it upstream of the luciferase gene. This structural composition is quite different from the actual situation in the body, so the screened regulatory factors often cannot play a role under physiological conditions in the body.

[0005] Single nucleotide polymorphism (SNPs) refers to sequence polymorphism caused by a single A, T, C, or G in a gene DNA sequence. Most SNPs are distributed in the non-coding region of genes, do not encode proteins, and have no effect on individual phenotypes, but such SNPs are often important resources for studying species evolution and population genetic variation. SNPs have been widely used in many fields such as molecular genetics, biological evolution, and disease-related gene localization research, and play an important role. However, there are few studies on molecular markers of Procambarus clarkii. The development of new molecular markers related to WSSV tolerance can provide favorable support for the breeding of Procambarus clarkii. Summary of the invention

[0006] The problem solved by the present invention is to verify the results of association analysis between the point mutation luciferase reporter vectors of the HO-1 gene of Procambarus clarkii and the WSSV tolerance of Procambarus clarkii through the activity differences shown by them, and further verify whether they can be used as molecular markers for auxiliary selection in molecular breeding of Procambarus clarkii, thereby accelerating the breeding process of Procambarus clarkii WSSV-tolerant varieties.

[0007] The present invention develops HO-1 gene SNP sites in combination with whole genome resequencing data, and constructs a pGL3-HO-1pro vector inserted into the untranslated region of the complete target gene. The BSA sequencing results found 12 SNP mutation sites in the 5' end regulatory region of the HO-1 gene of Procambarus clarkii, of which 11 SNP sites were significantly associated with WSSV tolerance in the Procambarus clarkii population. Four favorable SNP molecular markers associated with WSSV tolerance traits were screened out through transcriptional activity detection of the HO-1 gene point mutation luciferase reporter vector.

[0008] The present invention is achieved through the following technical solutions:

[0009] The method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the HO-1 gene of Procambarus clarkii comprises the following steps:

[0010] (1) Using the whole genome DNA of Procambarus clarkii containing the HO-1 gene as a template, primer pair P was used to amplify the 5' regulatory region of the Procambarus clarkii HO-1 gene;

[0011] (2) performing gel excision, recovery and purification of the amplified product of step (1);

[0012] (3) digesting the purified product of step (2) and the luciferase reporter gene vector pGL3-Basic plasmid with restriction endonucleases NheI and XhoI, respectively;

[0013] (4) recovering and purifying the digestion product in step (3) by gel cutting;

[0014] (5) using T4 DNA ligase to connect the purified products in step (4);

[0015] (6) The ligation product in step (5) was transformed into DH5α Escherichia coli competent cells, and the selected single clone was triple-verified by bacterial liquid PCR, double enzyme digestion identification, and sequencing;

[0016] Plasmid pGL3-HO-1pro represents a recombinant plasmid in which the promoter region is correctly inserted into the reporter gene plasmid (pGL3-Basic) (lowercase letters gtaccgagctcttacgcgtg represent the partial sequence of the pGL3-Basic plasmid, uppercase letters represent the promoter region, underlined ATG represents the promoter, and underlined letters represent the mutation site from the first letter of the promoter to the regulatory region). Its information is as follows:

[0017] gtaccgagctcttacgcgtgTTAGTGCCAGA G CTATGCTGT G AGGATAG A TT T AAGGAACTGGACCTCACAAAA A CAGACGACAGAAGAAACAGGGAAGATATGATCACAAATATACAAAA T AC TG ATG G GAATAGACAAG G TGGACAAGGACAGCCTCTTTAAGTTAAGAGAAAGCAGAACAAGAGGAAAGTGGAAACAAATGAGTTGAATATAAGGAAATACTGAACAAATATACCCTGTACAAATGGAATGCATTAGGACGTAATGTGGTGGAGGCAAACTCCATAGTTTCAAATTAGA TATGATTGAGTCCAACACGTACAGGAGCCTACGCATCAGTTGATTGCCGGTTGTGAGGCGGAGCCAAAGAACCGAAGCTCAACCTCCGAAAGCCCAATTAGGTGTGTACTGTGTACAGTTCTACATCGCACAGATGTCTCCGCCCCGACCTGTATCGTATC CAAAATTCCCGCCTCACATTTCCCATTCTTAGCGGCCGTGGCCTGAAGGATGAACCGCGTTACGTCGTCCTGTGTCTGACGTTCCGCTCCCTGCAGGCCACACATAGACGTCTGTAACCAGTGCGGGTCGGGCCTGTAGGGCATCCTACTTGTTCGTCTGGATTCTTTAACTACAAGCTCGATATTTTTTTCTACCACAGACGTCGCCATACATTAACAATGCTAACCAGCATATTTACATTTTCTTCTATCCTACATGGACAGGGTTAGAGATTTGTCAAACATACAGTGTATGGATTTATTGAATAATCAACCACAGAAGGTGATTGTAGTGCTTTTAAAATGCTAGGCTAAGCTACATACGTAGTTAGTTTAGTTTAGTTCATTTATTATGCACCCCATACCCATC C atg gctgcaaaggtggaagttccttttacaaagcagatgcgagatgttaccagagatcgagatctgcgatctaagt(SEQ ID NO:1)

[0018] (7) Design mutation primers based on the sequencing results, use fast high-fidelity DNA polymerase, and use the plasmid in (6) as a template to transform the non-mutant strain into the mutant strain.

[0019] (8) The plasmid in step (7) was transferred into 293T cells, 1000ng of point mutation luciferase reporter vector, 100ng of internal reference plasmid vector pRL-TK, 1uL PEI, 100μL of serum-free DMEM medium, and the non-mutated pGL3-HO-1pro vector was used as a control. After 12 hours of plasmid transfection, the cells were treated with H2O2, COPPIX, and poly(I:C) for 12 hours respectively. The normal group was not treated from 24 hours after transfection. When collecting the samples, the cells were rinsed twice with PBS, and then the dual luciferase activity was detected according to the dual luciferase detection kit.

[0020] (9) comparing the transcriptional activity of the point mutation luciferase reporter vector in step (8) with the results of the association analysis of WSSV tolerance, and interpreting the results of the association analysis from the level of transcriptional activity;

[0021] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the HO-1 gene of Procambarus clarkii as described in the above technical scheme, the PCR system in step (7) is: 2 μL of each forward / reverse mutation primer (10 μM), 1 μL of 50 ng / μL pGL3-HO-1pro non-mutant plasmid, 10 μL of 5×FastAlteration Buffer, 1 μL of FastAlteration DNAPolymerase, and 50 μL of RNase-Free ddH2O. The PCR amplification reaction program is: pre-denaturation at 95°C for 2 min; 18 cycles of denaturation at 94°C for 20 s, annealing at 55°C for 10 s, extension at 68°C for 2.5 min; and extension at 72°C for 5 min. The PCR product is digested with Dpn1 enzyme (20 U / μL) at 37°C for 1 h to digest the plasmid template.

[0022] According to the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the HO-1 gene of Procambarus clarkii as described in the above technical scheme, there are twelve SNP sites in the 5' regulatory region of the HO-1 gene of Procambarus clarkii: g.mut / -1366C>T, mut / -1775C>A, mut / -2097G>A, mut / -2109G>T, mut / -2113G>T, mut / -2114T>C, mut / -2117T>C, mut / -2164A>T, mut / -2186T>G, mut / -2189A>G, mut / -2197G>T and mut / -2207G>A (corresponding to Chr. >T; Chr2.48015134C>A; Chr2.48015456G>A; Chr2.48015468G>T; Chr2.48015472G>T; Chr2.48015473T>C; Chr2.48015476T>C; Chr2.48015523A>T; Chr2.48015545T>G; Chr2.48015548A>G; Chr2.48015556G>T; Chr2.48015566G>A, reference genome version: GCF_040958095.1), of which eleven SNP sites were significantly associated with WSSV tolerance in the Procambarus clarkii population.

[0023] SPSS 22.0 software was used for data processing, and the chi-square test was used to test the significant differences between genotypes and WSSV tolerance traits. The fragment containing the SNP site was amplified, and the mutant vector was directly sequenced.

[0024] The primer sequences are PcHO-1proF1: AGCCCAAGCTACCATGATAAG (SEQ ID NO: 2), PcHO-1proR1: GAACTGTACACAGTACACACC (SEQ ID NO: 3);

[0025] PcHO-1proF2:TTAGTGCCAGAGCTATGCTGTGA (SEQ ID NO:4), PcHO-1proR2:TCTCTGGTAACATCTCGCAT (SEQ ID NO:5).

[0026] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the HO-1 gene of Procambarus clarkii as described in the above technical scheme, the transfection system used in step (8) for transferring the plasmid into 293T cells is: 1000ng of the point mutation luciferase reporter vector, 100ng of the internal reference plasmid vector pRL-TK, 1uL PEI, and 100uL of serum-free DMEM culture medium.

[0027] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the HO-1 gene of Procambarus clarkii as described in the above technical scheme, 12 hours after the plasmid was transferred into 293T cells in step (8), the cells were treated with 1ug / mL poly(I:C), 500uMH2O2, and 100uM COPPIX for 12 hours respectively, and the other group was not treated after transfection.

[0028] Specifically, the SNP molecular markers related to WSSV tolerance and / or antioxidant capacity in Procambarus clarkii include: -1775C>A, -2117T>C, -2164A>T or -2197G>T located in the 5' regulatory region of the HO-1 gene of Procambarus clarkii, which are located at positions 464, 122, 75 and 42 of the nucleotide sequence shown in SEQ ID NO:1, respectively.

[0029] Further, -1775C>A, -2117T>C, -2164A>T and -2197G>T are favorable markers for the tolerance of Procambarus clarkii to WSSV, that is, when the 464th position of the sequence shown in SEQ ID NO:1 is A, and / or the 122nd position is C, and / or the 75th position is T, and / or the 42nd position is T, the Procambarus clarkii individual exhibits the traits of being more tolerant to WSSV and / or having high antioxidant capacity.

[0030] The present invention also provides a primer set for detecting the SNP molecular marker, including primers as shown in SEQ ID NO: 2-5: PcHO-1proF1: AGCCCAAGCTACCATGATAAG, PcHO-1pro R1: GAACTGTACACAGTACACACC; PcHO-1proF2: TTAGTGCCAGAGCTATGC TGTGA, PcHO-1proR2: TCTCTGGTAACATCTCGCAT.

[0031] The present invention also provides a kit for detecting the SNP molecular marker, comprising the above primer set.

[0032] The present invention also provides the use of the SNP molecular marker, primer set or kit in any of the following:

[0033] A1) characterizing the WSSV tolerance and / or antioxidant capacity of Procambarus clarkii;

[0034] A2) preparing products for identifying WSSV tolerance and / or antioxidant capacity of Procambarus clarkii;

[0035] A3) Breeding of crayfish strains that are tolerant to WSSV and / or have high antioxidant capacity;

[0036] A4) preparing and cultivating WSSV-tolerant and / or high antioxidant capacity varieties of crayfish;

[0037] A5) Screening for species or individuals of Procambarus clarkii that are resistant to WSSV and / or have high antioxidant capacity;

[0038] A6) Prepare and screen varieties or individual products of Procambarus clarkii for tolerance to WSSV and / or high antioxidant capacity.

[0039] The present invention also provides a method for identifying, screening and / or breeding WSSV-tolerant and / or high antioxidant capacity varieties of Procambarus clarkii, using the primer set or kit to detect the SNP molecular markers in the sample, selecting any one or more of the detection results of -1775C>A, -2117T>C, -2164A>T or -2197G>T, and obtaining Procambarus clarkii individuals or parents with more WSSV tolerance traits and / or high antioxidant capacity; that is, when any one or more of the above four SNP sites mutate, the WSSV tolerance and antioxidant capacity of Procambarus clarkii are significantly improved. .

[0040] The beneficial effects of the present invention include:

[0041] 1. The eukaryotic expression vector (pGL3-HO-1pro) of the 5' regulatory region of the Procambarus clarkii HO-1 gene and the mutant luciferase reporter vector were constructed.

[0042] 2. Eleven SNP molecular markers related to WSSV tolerance in Procambarus clarkii were discovered. The SNP sites were located in the 5' regulatory region of the PcHO-1 gene, among which -1775C>A, -2117T>C, -2164A>T and -2197G>T were favorable markers for WSSV tolerance in Procambarus clarkii.

[0043] 3. Provided are primer sequences for amplifying the molecular markers, including primers PcHO-1proF1, PcHO-1proR1 (-1775C>A, -2117T>C, -2164A>T); PcHO-1proF2, PcHO-1pro R2 (-2197G>T). BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0045] Figure 1The WSSV viral loads of individuals with high WSSV tolerance and low WSSV tolerance in the natural population of Procambarus clarkii in the embodiment;

[0046] Figure 2 The MDA content and T-AOC level in the hepatopancreas of individuals with high / low WSSV viral load in the natural population of Procambarus clarkii in the example;

[0047] Figure 3 The mRNA transcription levels of PcNrf2, Pckeap1 and PcHO-1 in the hepatopancreas of individuals with high / low WSSV viral load in the natural population of Procambarus clarkii in the example;

[0048] Figure 4 The PCR amplification product (2296 bp) of the 5' end regulatory region of the HO-1 gene of Procambarus clarkii in the embodiment;

[0049] Figure 5 In the embodiment, the 5' regulatory region of the HO-1 gene of Procambarus clarkii was amplified by PCR using the pGL3-HO-1pro reporter vector as a template;

[0050] Figure 6 The pGL3-HO-1pro reporter vector in the example was digested and identified by Nhe1 and XhoI;

[0051] Figure 7 In the example, the constructed HO-1 mutant luciferase reporter vector was used as a template to PCR amplify the 5' end regulatory region of the HO-1 gene of Procambarus clarkii;

[0052] Figure 8 The HO-1 mutant luciferase reporter vector in the example was digested and identified by Nhe1 and XhoI;

[0053] Fig. 9 These are the experimental results of luciferase activity detection of pGL3-HO-1pro and mutant luciferase reporter vector in the examples. DETAILED DESCRIPTION

[0054] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0055] To facilitate the understanding of the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments.

[0056] Example

[0057] HO-1 and its products have antioxidant function and play an important role in virus tolerance. According to analysis, the WSSV viral load of crayfish in natural populations is different. Individuals with extremely low viral copy numbers (Low) and individuals with extremely high viral copy numbers (High) were selected for BSA sequencing ( Figure 1 ). Body redox level ( Figure 2 ) and the transcription of Nrf2 / HO-1 signaling pathway were different ( Figure 3 ).

[0058] The present invention combines the whole genome resequencing data of the laboratory to develop the SNP sites of the HO-1 gene: the Low group is a natural population with low WSSV tolerance, and the High group is a natural population with high WSSV tolerance. The company performed BSA sequencing on the DNA of the two groups of individuals, and the results showed that 12 SNP mutation sites were found in the 5' regulatory region of the HO-1 gene of Procambarus clarkii, of which 11 SNP sites were significantly correlated with WSSV tolerance in the Procambarus clarkii population.

[0059] Table 1. The frequencies of 12 SNPs in the HO-1 gene of Procambarus clarkii

[0060]

[0061]

[0062] The invention obtains the 5' end regulatory region of the HO-1 gene of Procambarus clarkii by PCR amplification, purifies and digests the amplified product, connects it to a luciferase reporter gene vector pGL3-Basic, constructs a mutation vector, transfects the point mutation luciferase reporter vector into 293T cells, measures its transcriptional activity by a dual fluorescence reporter system kit, and compares it with the association analysis result to achieve the purpose of verifying the association analysis result.

[0063] 1. Construction of HO-1 gene eukaryotic expression vector and point mutation luciferase reporter vector.

[0064] 1.1 Construction of HO-1 gene eukaryotic expression vector (pGL3-HO-1pro)

[0065] The whole genome DNA of Procambarus clarkii containing the HO-1 gene (NC_091151.1) was used as a template, and a primer pair was used to amplify the 5' regulatory region of the Procambarus clarkii HO-1 gene, wherein the NheI restriction site was introduced into the 5' primer, and the XhoI restriction site was introduced into the 3' primer. The PCR reaction primers were designed as follows (the underline indicates the introduced restriction site):

[0066] Upstream primer F: CG GCTAGC CGTAGTGCCAGAGCTATGCTGT 30bp;

[0067] Downstream primer R: CC CTCGAG GGTAGGGTATCACTAATGTTG 29 bp.

[0068] PCR amplification system: 1 μL of Procambarus clarkii whole genome DNA (100 ng / mL), 0.5 μL of PrimerF (100 μmol / L), 0.5 μL of PrimerR (100 μmol / L), 10 μL of 2×MasterMix, 8 μL of ddH2O, a total of 20 μL.

[0069] PCR amplification parameters: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 60 s; and extension at 72°C for 10 min.

[0070] The PCR products were recovered and subjected to 1% agarose gel electrophoresis. Figure 4 As shown, lane M is a marker, and lanes 1-2 show the amplified HO-1 gene 5' end regulatory region fragment of the expected size (2296 bp).

[0071] The large fragment recovered after double digestion of plasmid pGL3-Basic with NheI and XhoI was used to establish a T4 ligase ligation system with the HO-1 gene fragment amplified by PCR after the same double digestion, and the ligation was carried out at 16°C overnight. After the ligation was completed, the ligation product was transformed into competent cells DH5α, and after culturing in a 37°C incubator for 12 hours, a single clone colony was picked and inoculated into LB culture medium containing 100 mg / L of ampicillin, and cultured at 37°C on a shaker. After shaking and culturing overnight, the plasmid was extracted. The vector size was identified by 1% agarose gel electrophoresis ( Figure 5 ), and the plasmid with the correct size was identified by digestion with Nhe1 and XhoI ( Figure 6 ), and the plasmid verified by enzyme digestion was sent to Qingke Biotechnology for full sequence sequencing verification.

[0072] 1.2 Construction of HO-1 mutant luciferase reporter vector

[0073] Based on the dual luciferase reporter gene vector pGL3-HO-1pro, site-directed mutagenesis was performed at the corresponding sites in Table 1 to construct mut / -1366C>T, mut / -1775C>A, mut / -2097G>A, mut / -2109G>T, mut / -2113G>T, mut / -2114T>C, mut / -2117T>C, mut / -2164A>T, mut / -2186T>G, mut / -2189A>G, mut / -2197G>T and mut / -2207G>A (Chr2.48014725C>T; Chr2.48015134C>A; Chr2.48015456G>A; Chr2.48015468G>T; Chr2.48015472G>G; Chr2. Chr2.48015473T>C;Chr2.48015476T>C;Chr2.48015523A>T;Chr2.48015545T>G;Chr2.48015548A>G;Chr2.48015556G>T;Chr2.48015566G>A,, reference genome version: GCF_040958095.1) 12 mutation vectors. All mutation vectors were sent to Qingke Bio for full sequence verification. The primer sequences used for mutation are as follows (the underlined bases are the introduced mutation bases).

[0074] mut / -1366C>TF:CATACCCATC T TGTGGGCGGTAGTGGAAAGG; R: GTAAAATAATACGTGGGGTATGGGTAG A ACACCCGCCA mut / -1775C>AF:GTATCGTATC A AAAATTCCCGCCTCACATTTC; R: CAGAGGCGGGGCTGGACATAGCATAG T TTTTAAGGGC mut / -2097G>AF:GGGAATAGACAAG A TGGACAAGGACAGCCTCTTTAAG; R: TGTTTTATGACTACCCTTATCTGTTC T ACCTGTTCCT mut / -2109G>TF:AATACTGATG T GAATAGACAAGGTGGACAAGGAC; R: CTAGGTGTTTATATGTTTTATGACTAC A CTTATCTGTTC mut / -2113G>TF:TACAAAATACTT ATGGGAATAGACAAGGTGGACA;

[0075] R:TATACTAGTGTTTATATGTTTTATGA A TACCCTTATCT mut / -2114T>CF:ATACAAAATAC C GATGGGAATAGACAAGGTGGA;

[0076] R:CTCTATACTAGTGTTTATATGTTTTATG G CTACCCTTAT mut / -2117T>CF:ATATACAAAA C ACTGATGGGAATAGACAAGGTGGAC;R:CCTTCTATACTAGTGTTTATATGTTTT G TGACTACCCT mut / -2164A>TF:GACCTCACAAAA T CAGACGACAGAAGAAACAGGGAAG;R:CCTATCTAAATTCCTTGACCTGGAGTGTTTT A GTCTGCTGTC mut / -2186T>GF:GTATATAGATT G AAGGAACTGGACCTCACAAAAAC;R:TCGATACGACACTCCATATATCTAA C TTCCTTGACCT mut / -2189A>GF:GTGAGGATAG G TTTAAGGAACTGGACCTCACAAAA;R:CTCGATACGACACTCCTATC C AAATTCCTTGAC mut / -2197G>TF:GCTATGCTGT T AGGATAGATTTAAGGAACTGGACC;R:AATCACGGTCTCGATACGACA A TCCTATCTAAA mut / -2207G>AF:TTAGTGCCAGA A CTATGCTGTGAGGATAGATTTAAG;R:ATCGTGATATCTAATCACGGTCT T GATACGACACTC

[0077] PCR amplification system: 2 μL each of forward / reverse mutation primers (10 μM), 1 μL of 50 ng / μL pGL3-HO-1pro non-mutation plasmid, 10 μL of 5×FastAlteration Buffer, 1 μL of FastAlteration DNA Polymerase, add RNase-Free ddH2O to 50 μL.

[0078] PCR amplification parameters: pre-denaturation at 95°C for 2 min; 18 cycles of denaturation at 94°C for 20 s, annealing at 55°C for 10 s, extension at 68°C for 2.5 min; and extension at 72°C for 5 min.

[0079] Dpn1 enzyme (20U / μL) was used to digest the plasmid template at 37°C for 1 h.

[0080] Enzyme digestion system: PCR product 50μL, Dpn 1 restriction enzyme (20U / μL), Total Volume 51μL.

[0081] The digestion product was transformed into competent cells DH5α, and after culturing in a 37°C incubator for 12 hours, a single clone was picked and inoculated into LB culture medium containing 100 mg / L ampicillin, and cultured on a shaker at 37°C. After shaking and culturing overnight, the plasmid was extracted. The vector size was identified by 1% agarose gel electrophoresis ( Figure 7 ), and the plasmid with the correct size was digested with XhoI for restriction digestion identification ( Figure 8 ), and the plasmid verified by enzyme digestion was sent to Qingke Biotechnology for full sequence sequencing verification.

[0082] Therein, a fragment containing the SNP site is amplified and the mutant vector is directly sequenced.

[0083] The upstream primer sequence PcHO-1proF1: AGCCCAAGCTACCATGATAAG (SEQ ID NO: 2);

[0084] The downstream primer sequence PcHO-1proR1:GAACTGTACACAGTACACACC (SEQ ID NO: 3);

[0085] The downstream primer sequence PcHO-1proF2: TTAGTGCCAGAGCTATGCTGTGA (SEQ ID NO: 4);

[0086] The downstream primer sequence PcHO-1proR2: TCTCTGGTAACATCTCGCAT (SEQ ID NO: 5).

[0087] 2. Transfection of point mutation luciferase reporter vector of Procambarus clarkii HO-1 gene and determination of relative transcriptional activity

[0088] 2.1 The transfection system was: 1000ng point mutation luciferase reporter vector, 100ng internal reference plasmid vector pRL-TK, 1uL PEI, 100uL serum-free DMEM medium. The unmutated pGL3-HO-1pro vector was used as a control. After 12 hours of transfection, the cells were treated with poly I:C (which can be recognized by the host's pattern recognition receptors as a pathogen-associated molecular pattern, activating HO-1 and antioxidant factors such as SOD), H2O2 (inducing cell oxidative damage, providing a high oxidative environment and activating HO-1), and COPPIX (an effective specific HO-1 inducer) for 12 hours, and one group was always untreated (normal).

[0089] 2.2 24 hours after transfection, collect cells according to the instructions of the dual fluorescence reporter system kit and use a detector to measure the fluorescence activity.

[0090] The ratio of the firefly fluorescence value to the Renilla fluorescence value was used as the relative fluorescence activity of the group, and the test results were statistically analyzed using the software GraphPad Prism 7;

[0091] The results of luciferase activity assay are shown in Fig. 9 As shown in the figure, in the four groups of experiments, compared with pGL3-HO-1pro, the relative luciferase expression activities of mut / -1366C>T, mut / -2097G>A, mut / -2109G>T, mut / -2113G>T, mut / -2114T>C, mut / -2186T>G, mut / -2189A>G and mut / -2207G>A were basically unchanged. The relative luciferase expression activities of mut / -1775C>A, mut / -2117T>C, mut / -2164A>T and mut / -2197G>T showed a significant upward trend (P<0.05).

[0092] 3. Verification of the relative activity of the HO-1 gene point mutation luciferase reporter vector on the results of the association analysis

[0093] According to https: / / bioinfo.life.hust.edu.cn / AnimalTFDB / #! / , the transcription factor binding sites of different SNPs were predicted; the χ2 value and P value were calculated using SPSS26.0.

[0094] Table 2. Results of association analysis between SNP sites of HO-1 gene and WSSV tolerance

[0095]

[0096]

[0097] The results in Table 2 show that 12 SNP sites were obtained in the 5' regulatory region of the HO-1 gene in the Procambarus clarkii population, of which 11 were significantly associated with WSSV tolerance. The prediction results of transcription factor binding sites showed that the SNP sites were associated with immune regulatory factors such as IRF1, MAF and SPI1, and their mechanisms can be further explored.

[0098] Combined with the results of relative transcriptional activity of different mutation sites: mut / -1775C>A, mut / -2117T>C, mut / -2164A>T and mut / -2197G>T had higher relative transcriptional activity. Compared with pGL3-HO-1pro, the relative luciferase expression activity of mut / -1366C>T, mut / -2097G>A, mut / -2109G>T, mut / -2113G>T, mut / -2114T>C, mut / -2186T>G, mut / -2189A>G and mut / -2207G>A had basically no change. We can see that mut / -1775C>A, mut / -2117T>C, mut / -2164A>T and mut / -2197G>T are significantly correlated with WSSV traits, and the relative luciferase expression activity shows a significant upward trend (P<0.05).

[0099] That is, mutations occurred in the mut / -1775C>A, mut / -2117T>C, mut / -2164A>T and mut / -2197G>T sites in the 5' regulatory region of the HO-1 gene in Procambarus clarkii. The mutations affected the binding of transcription factors to the promoter region, enhanced gene expression, and thereby enhanced the antioxidant properties and tolerance of Procambarus clarkii to WSSV.

[0100] Therefore, WSSV tolerance and antioxidant properties can be selected by selecting crayfish with corresponding mutations in the mut / -1775C>A, mut / -2117T>C, mut / -2164A>T and mut / -2197G>T sites in the 5' regulatory region of the HO-1 gene.

[0101] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with WSSV tolerance and / or antioxidant capacity in Procambarus clarkii, characterized in that: include: -1775C>A, -2117T>C, -2164A>T or -2197G>T located in the 5' regulatory region of the HO-1 gene of Procambarus clarkii are respectively located at the 464th, 122nd, 75th and 42nd positions of the nucleotide sequence shown in SEQ ID NO:

1.

2. The SNP molecular marker according to claim 1, characterized in that: When position 464 of the sequence shown in SEQ ID NO: 1 is A, and / or position 122 is C, and / or position 75 is T, and / or position 42 is T, the crayfish individual exhibits traits of greater tolerance to WSSV and / or high antioxidant capacity.

3. A primer set for detecting the SNP molecular marker according to any one of claims 1-2, characterized in that: The primers included are as shown in SEQ ID NO: 2-5: PcHO-1proF1: AGCCCAAGCTACCATGATA AG, PcHO-1proR1: GAACTGTACACAGTACACACC; PcHO-1proF2: TTAGTGC CAGAGCTATGCTGTGA, PcHO-1proR2: TCTCTGGTAACATCTCGCAT.

4. A kit for detecting the SNP molecular marker according to any one of claims 1-2, characterized in that: Comprising the primer set of claim 3.

5. Use of the SNP molecular marker according to any one of claims 1 to 2, the primer set according to claim 3 or the kit according to claim 4 in any of the following: A1) Identification of WSSV tolerance and / or antioxidant capacity of Procambarus clarkii; A2) preparing products for characterizing the WSSV tolerance and / or antioxidant capacity of Procambarus clarkii; A3) Breeding of crayfish strains that are tolerant to WSSV and / or have high antioxidant capacity; A4) preparing and cultivating WSSV-tolerant and / or high antioxidant capacity varieties of crayfish; A5) Screening for species or individuals of Procambarus clarkii that are resistant to WSSV and / or have high antioxidant capacity; A6) Prepare and screen varieties or individual products of Procambarus clarkii for tolerance to WSSV and / or high antioxidant capacity.

6. A method for identifying, screening and / or breeding WSSV-tolerant and / or high antioxidant capacity crayfish species, characterized in that: The sample is tested for the SNP molecular markers of any one of claims 1-2 using the primer set of claim 3 or the kit of claim 4, and any one or more of the test results of -1775C>A, -2117T>C, -2164A>T or -2197G>T are selected to obtain Procambarus clarkii individuals or parents that are more tolerant to WSSV traits and / or have high antioxidant capacity.

Images