Kit and method for detecting klebsiella pneumoniae and drug-resistant gene of klebsiella pneumoniae

Abstract

The invention relates to the technical field of biology, in particular to a kit and a method for detecting klebsiella pneumoniae and a drug-resistant gene of the klebsiella pneumoniae. The kit comprises a nucleic acid amplification reagent, a reference substance and a standard substance, and the nucleic acid amplification reagent contains primers with nucleotide sequences as shown in SEQ ID NO: 1-SEQ ID NO: 6 and probes as shown in SEQ ID NO: 7-SEQ ID NO: 9. Compared with traditional bacterial drug resistance detection, the detection kit and the method can simultaneously detect klebsiella pneumoniae and two multi-drug resistance genes, increase the detection speed and reduce the labor cost, and have the advantages of simplicity, rapidness, high sensitivity, strong specificity and the like.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a kit and a method for detecting Klebsiella pneumoniae and drug-resistant genes thereof. Background Art

[0002] Klebsiella pneumoniae is a zoonotic pathogen that mainly infects the blood, respiratory tract, urinary tract and digestive tract of humans and animals, and can cause symptoms such as meningitis, pneumonia, enteritis, and sepsis. It is reported that the clinical morbidity and mortality of Klebsiella pneumoniae infection are high, and are mainly distributed in various intensive care units such as respiratory medicine departments. In order to treat and prevent the harm caused by bacteria, a large number of antibiotics are used in animals, agriculture, and health care. Bacteria have gradually developed drug resistance under the selection pressure of broad-spectrum antibiotics for a long time, and the disease is becoming more and more serious and complex, which hinders the treatment and prevention of bacterial diseases and has become an important problem faced by veterinary and human medicine clinics. Klebsiella pneumoniae, as a common pathogenic and infectious bacteria with drug resistance second only to Escherichia coli, deserves attention.

[0003] In recent years, with the clinical use of new-generation β-lactams (penicillins, cephalosporins, carbapenems, and monobactams), β-lactamases have become widely diversified. Class A serine β-lactamases are the most abundant, with more than 500 enzymes, including the most clinically significant extended-spectrum β-lactamases (ESBLs), namely TEM, CTX-M, and SHV-type enzymes. Although SHV enzymes do not have the explosive spread of CTX-M-type variants, they have been found in several Enterobacteriaceae outside the typical clinical hosts Klebsiella pneumoniae and Escherichia coli, as well as in different environments. The variability of SHV-type enzyme alleles is increasing, with more than 190 variants registered to date on NCBI, and their importance cannot be ignored.

[0004] Tigecycline belongs to a new class of glycine tetracycline antibiotics. Since the discovery of the plasmid-mediated high-level tigecycline resistance gene tet (X3 / X4) in 2019, tet (X4)-positive strains have spread globally. Although tigecycline is currently only approved for clinical use in humans, the tet (X4) gene has been detected in edible animals, retail meat, aquatic animals, wildlife and the environment, which greatly limits the use of tigecycline. In addition, many plasmids carrying tet (X4) have strong horizontal transfer capabilities, which means that plasmid-mediated tigecycline resistance genes can spread rapidly between different bacteria, posing a potential threat to public health.

[0005] The traditional culture identification method and drug resistance gene detection of Klebsiella pneumoniae require at least 2-3 days, with a long experimental cycle and complicated operation. In view of this, the present invention is proposed. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a kit and method for detecting Klebsiella pneumoniae and its drug-resistant genes.

[0007] The present invention provides a kit for detecting Klebsiella pneumoniae and its drug resistance gene, the kit comprising a nucleic acid amplification reagent, a reference substance and a standard substance, wherein the nucleic acid amplification reagent comprises a primer having a nucleotide sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 6, and a probe having a nucleotide sequence as shown in SEQ ID NO: 7 to SEQ ID NO: 9. Optionally, the 5' end of the nucleotide sequence shown in SEQ ID NO: 7 is labeled with FAM and the 3' end is labeled with BHQ-1, the 5' end of the nucleotide sequence shown in SEQ ID NO: 8 is labeled with HEX and the 3' end is labeled with BHQ-1, and the 5' end of the nucleotide sequence shown in SEQ ID NO: 9 is labeled with Cy5 and the 3' end is labeled with BHQ-3.

[0008] The present invention provides a multiplex fluorescence quantitative PCR method for detecting drug-resistant genes, comprising the following steps:

[0009] S1, extracting bacterial genomic DNA from the sample to be tested to obtain template DNA in the sample to be tested;

[0010] S2, preparing fluorescent quantitative PCR reaction system;

[0011] S3. Fluorescence quantitative PCR amplification: 95°C for 15 min; 95°C for 10 sec, 60°C for 30 sec, 45 times in total, and collecting the fluorescence signal of the template DNA in the second step of each cycle; a positive result was determined as Ct≤30.

[0012] S4. Use the reference substance to prepare a standard curve to obtain the concentration of the drug-resistant gene in the sample to be tested.

[0013] The present invention provides a primer and a probe for detecting a drug-resistant gene, wherein the nucleotide sequences of the primers are shown in SEQ ID NO: 1 to SEQ ID NO: 6, and the nucleotide sequences of the probes are shown in SEQ ID NO: 7 to SEQ ID NO: 9. Optionally, the 5' end of the nucleotide sequence shown in SEQ ID NO: 7 is labeled with FAM and the 3' end is labeled with BHQ-1, the 5' end of the nucleotide sequence shown in SEQ ID NO: 8 is labeled with HEX and the 3' end is labeled with BHQ-1, and the 5' end of the nucleotide sequence shown in SEQ ID NO: 9 is labeled with Cy5 and the 3' end is labeled with BHQ-3.

[0014] The technical solution provided by the embodiment of the present invention has the following advantages compared with the prior art:

[0015] Compared with traditional bacterial resistance detection, the detection kit and method of the present invention can simultaneously detect Klebsiella pneumoniae and two multidrug resistance genes, accelerate the detection speed, reduce labor costs, and have the advantages of simplicity, rapidity, high sensitivity, strong specificity, etc.

[0016] The detection kit and the detection method of the present invention can simultaneously determine whether it is Klebsiella pneumoniae and whether it is resistant to beta-lactams and tigecycline. The detection time only takes one hour, and rapid detection can be achieved.

[0017] The minimum DNA detection limit of the detection kit and detection method of the present invention is 10 2 copies / μL, which can be used for clinical testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the amplification map of the Khe target gene;

[0019] Figure 2 Amplification diagram of tet(x4) target gene

[0020] Figure 3 For blaSHV purposes;

[0021] Figures 4 to 6 Amplification plots of the genes shown;

[0022] Figure 7 This is a triple TaqMan fluorescence quantitative PCR specific amplification curve, where: 1. Mixed standard; 2. Klebsiella pneumoniae containing SHV; 3. Klebsiella pneumoniae containing tet(x4); 4. Escherichia coli containing tet(x4); 5. Escherichia coli containing SHV and tet(x4); 6. Escherichia coli containing SHV; 7. Klebsiella pneumoniae quality control bacteria (ATCC35657); 8. Escherichia coli quality control bacteria (ATCC25922); 9. ddH2O;

[0023] FIG8 is the result of triple fluorescence quantitative PCR sensitivity experiment, wherein: a: Khe gene; b: tet (x4) gene; c: blaSHV gene;

[0024] FIG9 is the result of a common PCR sensitivity experiment, wherein: Figure 9a is the Khe gene, Figure 9b is the tet(x4) gene, Fig.9c is blaSHV gene, M is DL2000plus; 1-9 are original solution, 10 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times, 10 6 times, 10 7times, 10 8 times. DETAILED DESCRIPTION

[0025] In order to more clearly understand the above-mentioned objectives, features and advantages of the present invention, the scheme of the present invention will be further described below. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0026] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein; it is obvious that the embodiments in the specification are only part of the embodiments of the present invention, rather than all of the embodiments.

[0027] The embodiment of the present invention provides a kit for detecting Klebsiella pneumoniae and its drug resistance gene, the kit comprising a nucleic acid amplification reagent, a control substance and a reference substance. The nucleic acid amplification reagent contains primers with nucleotide sequences as shown in SEQ ID NO:1 to SEQ ID NO:6 and probes with nucleotide sequences as shown in SEQ ID NO:7 to SEQ ID NO:9.

[0028] The present invention refers to the gene sequences of Khe, blaSHV, and tet (x4) registered in GenBank, and designs 3 pairs of specific primers and 3 probes through screening experiments for their conserved regions. The sequences of the primers and probes are specifically shown in Table 1.

[0029] Table 1

[0030]

[0031] The designed three pairs of specific primers were used for PCR and sequencing comparison, and then commissioned to a biological company for synthesis.

[0032] As a preferred technical solution of the multiplex fluorescent quantitative PCR kit of the embodiment of the present invention, the volumes of primers and probes in the nucleic acid amplification reagent are shown in Table 2:

[0033] Table 2

[0034] serial number concentration Volume range Preferred volume SEQ ID NO:1 10μmol / L 0.4~0.8μL 0.6μL SEQ ID NO:2 10μmol / L 0.4~0.8μL 0.6μL SEQ ID NO:3 10μmol / L 0.8~1.2μL 1μL SEQ ID NO:4 10μmol / L 0.8~1.2μL 1μL SEQ ID NO:5 10μmol / L 1~1.4μL 1.2μL SEQ ID NO:6 10μmol / L 1~1.4μL 1.2μL SEQ ID NO:7 10μmol / L 0.1~0.3μL 0.2μL SEQ ID NO:8 10μmol / L 0.1~0.3μL 0.2μL SEQ ID NO:9 10μmol / L 0.2~0.4μL 0.3μL

[0035] As a preferred technical solution of the multiplex fluorescent quantitative PCR kit of an embodiment of the present invention, the control substances include a positive control substance and a negative control substance; the positive control substance contains a mixture of three mutant plasmids with nucleotide sequences such as SEQ ID NO: 10 to SEQ ID NO: 12 in equal proportions; the negative control substance is process water.

[0036] Specifically, the blaSHV plasmid sequence is as follows:

[0037] ttaactccctgttagccaccctgccgctggcggtacacgccagcccgcagccgcttgagcaaattaaacaaagcgaaagccagctgtcgggccgcgtaggcat

[0038] gatagaaatggatctggccagcggccgcacgctgaccgcctggcgcgccgatgaacgctttcccatgatgagcacctttaaagtagtgctctgcggcgcagtgc

[0039] tggcgcgggtggatgccggtgacgaacaactggagcgaaagatccactatcgccagcaggatctggtggactactcgccggtcagcgaaaaacaccttgccg

[0040] acggcatgacggtcggcgaactctgtgccgccgccattaccatgagcgataacagcgccgccaatctgctgctggccaccgtcggcggccccgcaggattgac

[0041] tgcctttttgcgccagatcggcgacaacgtcacccgccttgaccgctgggaaacggaactgaatgaggcgcttcccggcgacgcccgcgacaccactaccccg

[0042] gccagcatgccgcgaccctgcgcaagctgctgaccagccagcgtctgagcgcccgttcgcaacggcagctgctgcagtggatggtggacgatcgggtcgccg

[0043] gaccgttgatccgctccgtgctgccggcgggctggtttatcgccgataagaccggagctggcgagcggggtgcgcgcggcattgtcgccctgcttggcccgaa

[0044] taacaaagcagagcgcattgtggtgattacctgggcggggatacac

[0045] The sequence of the Khe plasmid is as follows:

[0046] tctacttatcccgacagcccggagcgtttttcaatcggcgcgccgctggggcgaggtttacgtctcaaccggctggggatccaccacgagcggctgccgcccgg

[0047] gcggcgcacctcttatccacacgcggagagcgatgaggaagagttcatctacgtgctggagggctatccggaagtgtggataaacggctatctctggaagctgg

[0048] agcccggcgacagcgtgggttttcccgctggtaccggcatctgccacacctttctcaataacaccgagcaggaaattcgtctgctggtggtgggcgaggccaac

[0049] aagaagtacaaccgcatttattacccgctcaatcccggctatgccgcgacgcgccaggatcgttgggttgaccatccgccgcagttttcggtccacaa

[0050] The sequence of the tet(X4) plasmid is as follows:

[0051] gcgctacgctacggcatagacgtttcagtttacgaaagagacaacgaccgagaggcaagaatttttggtggaacccttgacctacacaaaggttcaggtcaggaa

[0052] gcaatgaaaaaagcgggattgttacaaacttattatgacttagccttaccaatgggtgtaaatattgctgatgaaaaaggcaatattttatccacaaaaaatgtaaagc

[0053] ccgaaaatcgatttgacaatcctgaaataaacagaaatgacttaagggctatcttgttgaatagtttagaaaacgacacggttatttgggatagaaaacttgttat

[0054] gcttgaacctggtaagaagaagtggacactaacttttgagaataaaccgagtgaaacagcagatctggttattattgccaatggtggaatgtctaaagtaagaaaatt

[0055] tgttaccgacacggaggttgaagaaacaggtactttcaatatacaagccgatattcatcatccagaggtgaactgtcctggattttttcagctatgcaatggaaaccg

[0056] gctaatggctgctcatcaaggtaatttattatttgcgaatcctaataataatggtgcattgcattttggaataagttttaaaacacctgatgaatggaaaaaccaaacgca

[0057] ggtagattttcaaaacagaaatagtgtcgttgattttcttctgaaagaattttccgattgggacgaacgctacaaagaactgattcgtgtgacatcatcttttgtagggtta

[0058] gcgacacgaatatttcccttaggtaagtcttggaaaagtaagcgtccattacccataacgatgatggagatgctgctcattgagcctc

[0059] As a preferred technical solution of the multiplex fluorescent quantitative PCR kit of the embodiment of the present invention, the standard comprises a mixture of mutant plasmids of gradient concentrations mixed in equal proportions; the concentrations of the mutant plasmid mixture are: 10 2 copies / μL, 10 3 copies / μL, 10 4 copies / μL, 10 5 copies / μL, 10 6 copies / μL, 10 7 copies / μL, 10 8 copies / μL, 10 9 copies / μL.

[0060] As a preferred technical solution of the multiplex fluorescence quantitative PCR kit of the embodiment of the present invention, the nucleic acid amplification reagent also contains 2×M5 GoldStar TaqMan Mixture.

[0061] The present invention also provides a multiplex fluorescence quantitative PCR method for detecting drug-resistant genes, comprising the following steps:

[0062] S1, extracting bacterial genomic DNA from the sample to be tested to obtain template DNA in the sample to be tested;

[0063] S2, preparing fluorescent quantitative PCR reaction system;

[0064] S3. Fluorescence quantitative PCR amplification: 95°C for 15 min; 95°C for 10 sec, 60°C for 30 sec, for a total of 45 times, and collecting the fluorescence signal of the template DNA in the second step of each cycle; a positive result was determined as Ct≤30.

[0065] S4. Use the reference substance to prepare a standard curve to obtain the concentration of the drug-resistant gene in the sample to be tested.

[0066] As a preferred technical solution of the multiplex fluorescent quantitative PCR method for detecting drug-resistant genes in an embodiment of the present invention, the fluorescent quantitative PCR reaction system contains 10 μL of 2×M5 GoldStar TaqMan Mixture, 0.4-0.8 μL, 0.4-0.8 μL, 0.8-1.2 μL, 0.8-1.2 μL, 1-1.4 μL, and 1-1.4 μL of the primers shown in SEQ ID NO:1 to SEQ ID NO:6 at a concentration of 10 μmol / L, respectively; 0.1-0.3 μL, 0.1-0.3 μL, 0.2-0.4 μL of the probes shown in SEQ ID NO:7 to SEQ ID NO:9 at a concentration of 10 μmol / L, respectively, and 1 μL of template, and ultrapure water is added to 20 μL.

[0067] Preferably, the fluorescent quantitative PCR reaction system contains 10 μL of 2×M5 GoldStar TaqMan Mixture, 0.6 μL, 0.6 μL, 1 μL, 1 μL, 1.2 μL, and 1.2 μL of the primers shown in SEQ ID NO:1 to SEQ ID NO:6 at a concentration of 10 μmol / L, respectively; 0.2 μL, 0.2 μL, 0.3 μL of the probes shown in SEQ ID NO:7 to SEQ ID NO:9 at a concentration of 10 μmol / L, respectively, and 1 μL of template, and ultrapure water is added to 20 μL.

[0068] The present invention also provides a primer and a probe for detecting drug-resistant genes, wherein the nucleotide sequences of the primers are shown in SEQ ID NO: 1 to SEQ ID NO: 6, and the nucleotide sequences of the probes are shown in SEQ ID NO: 7 to SEQ ID NO: 9. Preferably, the nucleotide sequence shown in SEQ ID NO: 7 is labeled with FAM at the 5' end and BHQ-1 at the 3' end, the nucleotide sequence shown in SEQ ID NO: 8 is labeled with HEX at the 5' end and -BHQ-1 at the 3' end, and the nucleotide sequence shown in SEQ ID NO: 9 is labeled with Cy5 at the 5' end and -BHQ-3 at the 3' end.

[0069] The embodiment of the present invention designs three pairs of primers and probes according to the sequences of Klebsiella pneumoniae Khe gene, tet (x4) resistance gene, and blaSHV resistance gene, respectively, and amplifies them under the same reaction system and procedure. The established triple fluorescence quantitative PCR method has the advantage of strong specificity. It only targets Khe, tet (x4) and blaSHV genes, and no other genes are detected and there is no interference between each other. In addition, the triple fluorescence quantitative PCR amplification is performed under optimized conditions. The correlation coefficient of the standard curve drawn between the copy number (X) of the diluted template and the Cq value (Y) in the 10-fold dilution gradient interval is above 0.99, with a good fit and a good linear relationship. In addition, the coefficient of variation is less than 2%, which also shows that the method has good repeatability. The minimum DNA detection limit is 10 2 copies / μL, which can be used for clinical testing.

[0070] Example

[0071] The reagents used in the examples are all commercially available.

[0072] Material:

[0073] Bacterial strains and samples: Klebsiella pneumoniae quality control bacteria (ATCC35657) and Escherichia coli quality control bacteria (ATCC25922) were purchased from Qingdao Haibo Biotechnology Co., Ltd.; Klebsiella pneumoniae and Escherichia coli were isolated, identified and preserved by the Hebei Provincial Animal Husbandry and Veterinary Research Institute in Zhangjiakou, Xinji, Anguo and Gaoyang, Hebei Province.

[0074] Molecular biology reagents: Bacterial DNA extraction kit was purchased from Beijing Zhuocheng Huisheng Biotechnology Co., Ltd.; 2×M5 HiPer HiFi PCR mix, agarose, nucleic acid dye, M5aDL2000 DNAMaker, 2×M5 GoldStarTaqMan Mixture, gel recovery kit, M5 Plasmid Miniprep plus Kit were all purchased from Beijing Juhemei Biotechnology Co., Ltd.; DH5α competent cells were purchased from Beijing Solaibao Technology Co., Ltd.; PND18T vector was purchased from Beijing Baoriyi Biotechnology Co., Ltd.

[0075] Main instruments: Constant temperature shaking incubator, purchased from American Jingqi Co., Ltd.; K5500 ultra-micro spectrophotometer, purchased from Chongqing Kaiao Biotechnology Co., Ltd.; heated metal bath, purchased from Shanghai Luogen Automation Technology Co., Ltd.; ordinary PCR instrument, purchased from Hangzhou Biori Technology Co., Ltd.; DYY-8C electrophoresis instrument, purchased from Beijing Liuyi Biotechnology Co., Ltd.; electrophoresis gel imaging analysis system, purchased from Shanghai Lingcheng Biotechnology Co., Ltd.; LightCycler 96Instrument, purchased from Roche Co., Ltd., Switzerland.

[0076] Example 1

[0077] A multiplex fluorescence quantitative PCR kit for detecting drug resistance genes, the composition of which is shown in Table 3:

[0078] Table 3:

[0079]

[0080]

[0081] The method of using the kit is:

[0082] S1. Extract bacterial genomic DNA from the sample to be tested, referring to the instructions of a commercially available extraction kit;

[0083] S2. Prepare the fluorescence quantitative PCR reaction system; the details are shown in Table 4:

[0084] Table 4

[0085]

[0086] S3, Fluorescence quantitative PCR amplification: 95℃15min; 95℃10sec, 60℃30sec, 45 times in total, and collect the fluorescent signal of template DNA in the second step of each cycle; positive result is judged as Ct≤30, when Ct value>30, the randomness of the reaction increases, the repeatability test error increases, and it may be accompanied by the influence of non-specific products;

[0087] S4. Use the standard substance to prepare a standard curve to obtain the concentration of the drug-resistant gene in the sample to be tested.

[0088] The preparation method of the standard curve is as follows: using the standard group as a template, preparing the reaction system as shown in Table 4, performing reaction amplification according to the fluorescence quantitative PCR method shown in S3, and drawing a standard curve.

[0089] Example 2

[0090] The plasmid construction method is as follows:

[0091] 1. DNA extraction

[0092] The isolated Klebsiella pneumoniae was extracted with a bacterial DNA extraction kit and stored in a -20°C refrigerator for later use.

[0093] 2. Target gene amplification

[0094] The bacterial DNA was amplified using the Khe, blaSHV, and tet (x4) primers shown in Table 5 to obtain the target fragment. The annealing temperatures of the Khe, blaSHV, and tet (x4) primers were 58°C, 58°C, and 52°C, respectively. The reaction system and procedure are shown in Table 6.

[0095] Table 5: PCR primer sequences

[0096]

[0097]

[0098] Table 6: Reaction system and procedure

[0099]

[0100] The PCR primers shown in Table 5 were used to amplify the Khe, blaSHV, and tet (x4) genes, and target bands appeared at 419, 771, and 909 bp, respectively. The experimental results are shown in Figure 1-Figure 3 shown.

[0101] 3. Recovery and purification of target gene

[0102] Prepare 1.5% agarose gel, add PCR products to the gel loading wells, and perform electrophoresis. Observe the electrophoresis results under a gel electrophoresis imager, and cut out the target gene fragment under ultraviolet light.

[0103] Take a 1.5 mL EP tube, weigh the empty tube and record the weight, put the excised target fragments into the corresponding tubes, and weigh them again to calculate the weight of the target fragments.

[0104] Perform gel recovery according to the gel recovery kit.

[0105] After gel recovery, perform agarose gel electrophoresis again (sample volume: 1 μL gene product + 1 μL Loading Buffer), observe the electrophoresis results, and determine whether the target gene has been recovered.

[0106] 4. Target gene connection

[0107] The DNA recovered from the gel was connected to the PMD-18T vector. The system and conditions are shown in Table 7.

[0108] Table 7: Reaction system and procedure

[0109]

[0110] 5. Target gene transformation

[0111] Take out the DH5α competent cells from the -80℃ refrigerator and immediately put them on ice to melt. Take 5μL of the ligation product and add it to 100μL of DH5α competent cells and put them on ice for 30min. Heat shock in a water bath at 42℃ for 90s and put them on ice again for 2min. Add 1mL of anti-antibody LB liquid culture medium (see materials for preparation method), put it in a shaker at 37℃, 200r / min, and shake the bacteria for 1h. Centrifuge at 5000r / min for 5min, discard part of the supernatant (about 800μL), blow and mix the remaining liquid to resuspend the bacteria. Pipette 100μL and drop it on the solid LB culture medium containing ampicillin (PBAD18 / AMP), and use a coating rod to evenly spread the plate. Put it upright for 30min, wait for the bacteria to completely settle, and culture it at 37℃ for 16h. Pick up round colonies with clear edges and add them to LB liquid culture medium containing AMP resistance (ratio: 1 ml LB liquid culture medium + 1 μL AMP); culture at 37°C, 180 r / min for 14 h.

[0112] 6. Plasmid extraction

[0113] The plasmid was extracted according to the instructions of the plasmid extraction kit.

[0114] 7. Plasmid identification

[0115] The above recombinant plasmids were amplified by PCR according to the system in Table 6 and the primers in Table 5, and the results were observed by agarose gel electrophoresis. The correct ones were sent to Beijing Bioengineering Co., Ltd. for sequencing, and the sequencing results were analyzed by NCBI BLAST.

[0116] The results showed that the three recombinant plasmids had a sequence homology of more than 99% with those registered on NCBI, proving that the recombinant plasmid Khe, blaSHV, and tet (x4) standards were successfully constructed.

[0117] 8. Plasmid concentration determination and copy number calculation

[0118] The concentration of the correct recombinant plasmid was determined using a K5500 micro-spectrophotometer and the copy number was calculated. The copy number calculation formula is as follows: Copy number = [6.02 × 10 23 ×Plasmid concentration (ng / μL)×10 -9 ] / [DNALength×660]

[0119] Table 8: Plasmid standard concentration and copy number

[0120] Gene Plasmid concentration (ng / μL) Copy number (copies / μL) Khe 166.89 <![CDATA[3.633×10 11 ]]> blaSHV 162.79 <![CDATA[1.633×10 11 ]]> tet(x4) 143.78 <![CDATA[1.701×10 11 ]]>

[0121] Example 3

[0122] This example is used to illustrate the linear relationship of the standard curve:

[0123] The constructed Khe gene, blaSHV resistance gene, and tet (x4) resistance gene positive plasmid standards were mixed in equal amounts and diluted to 10 9 ~10 2 The three replicates were used as the positive template and ddH2O as the negative template. The amplification was performed using the triple fluorescence quantitative PCR method conditions of Example 1. A standard curve was established between the copy number of the diluted template (X) and the Cq average value (Y). The experimental results are shown in Figures 4 to 6 shown.

[0124] According to the results, the correlation coefficient R2 is above 0.99.

[0125] Embodiment 4:

[0126] This example illustrates the optimization process of annealing temperature:

[0127] The annealing temperatures were set to seven temperature gradients of 55°C, 56°C, 57°C, 58°C, 59°C, 60°C and 61°C, and the amplification was performed using the initial reaction system and program shown in Table 9. The experimental results are shown in Table 10.

[0128] Table 9: Triple fluorescence quantitative PCR initial reaction system and procedures

[0129]

[0130] Table 10: Amplification results of the initial reaction system of triple fluorescence quantitative PCR

[0131] Cq average 55℃ 56℃ 57℃ 58℃ 59℃ 60℃ 61℃ Khe 12.84 13.27 13.52 13.72 13.32 13.1 13.95 blaSHV 15.33 15.3 16.06 14.87 16.29 14.8、 15.24 tet(x4) 17.84 17.34 18.31 18.62 18.76 15.58 16.51

[0132] The Cq average values ​​at each temperature were analyzed, and the temperature with high fluorescence intensity, most stable data and smooth curve was selected as the optimal annealing temperature. Comprehensive consideration showed that 60°C was the optimal annealing temperature for the triple fluorescence quantitative PCR method.

[0133] Embodiment 5:

[0134] This example illustrates the optimization process of primer and probe concentrations:

[0135] According to the Khe, blaSHV, tet (x4) reaction system and procedure shown in Table 9, the positive plasmid of the above embodiment was used as a template to perform triple fluorescence quantitative PCR reaction. Using the optimized optimal annealing temperature, the upstream and downstream primers corresponding to the Khe gene, blaSHV resistance gene, and tet (x4) resistance gene were mixed, and five gradients of 0.4 μL, 0.6 μL, 0.8 μL, 1.0 μL, and 1.2 μL were taken, and five gradients of 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL, and 0.6 μL of probe were taken, and the primer and probe concentrations were optimized for a total of 25 combinations according to the matrix arrangement method, and three replicates were used in each group. The results are shown in Tables 11 to 13.

[0136] Table 11: Optimization of the Cq average value of the gene Khe triple fluorescence quantitative system

[0137]

[0138] Table 12: Optimization of Cq average values ​​of the triple fluorescence quantitative system for drug resistance gene tet (x4)

[0139]

[0140] Table 13: Optimization of Cq average values ​​of the triple fluorescence quantitative system for the drug resistance gene blaSHV

[0141]

[0142] Based on the fluorescence intensity, Cq average value, and amplification curve smoothness, the concentrations of upstream and downstream primers of Khe gene were selected to be 0.6 μL (10 μmol / L), the concentrations of upstream and downstream primers of tet (x4) resistance gene were selected to be 1.0 μL (10 μmol / L), and the concentrations of upstream and downstream primers of blaSHV resistance gene were selected to be 1.2 μL (10 μmol / L). The concentrations of Khe gene and tet (x4) resistance gene probes were 0.2 μL (10 μmol / L), and the concentrations of blaSHV resistance gene probes were 0.3 μL (10 μmol / L).

[0143] Example 6

[0144] This example is used to illustrate the specificity and sensitivity test

[0145] 1. Specificity experiment

[0146] The three plasmids carrying Khe, blaSHV and tet (x4) targeting DNA fragments prepared in Example 2 were mixed in a ratio of 1:1:1 as a positive control; ddH20 was used as a negative control; Escherichia coli containing blaSHV and tet (x4) resistance genes, Klebsiella pneumoniae containing blaSHV resistance genes, Klebsiella pneumoniae containing tet (x4) resistance genes, Escherichia coli containing resistance genes tet (x4); Escherichia coli containing resistance genes blaSHV; DNA of Escherichia coli quality control bacteria (ATCC25922) and Klebsiella pneumoniae quality control bacteria (ATCC35657) were used as templates, and triple fluorescence quantitative PCR amplification was performed using the reaction procedure and system of Example 1 to evaluate the specificity of the method. The experimental results are shown in Tables 14 and 14. Figure 7 shown.

[0147] Table 14: Triple fluorescence quantitative PCR specific amplification results

[0148] DNA template Khe gene tet(x4) resistance gene blaSHV resistance gene Mixed Standards + + + Klebsiella pneumoniae containing SHV + － + Klebsiella pneumoniae containing tet(x4) + + － Escherichia coli containing tet(x4) － + － Escherichia coli containing SHV and tet(x4) － + + E. coli containing SHV － － + Klebsiella pneumoniae quality control bacteria (ATCC35657) + － － Escherichia coli quality control bacteria (ATCC25922) － － － <![CDATA[ddH2O]]> － － －

[0149] The results showed that the established triple fluorescence quantitative PCR method could correctly detect the mixed standard, Escherichia coli carrying blaSHV and tet (x4) resistance genes, Klebsiella pneumoniae carrying blaSHV resistance genes, Klebsiella pneumoniae carrying tet (x4) resistance genes, Escherichia coli containing resistance genes tet (x4), Escherichia coli containing resistance genes blaSHV, and Klebsiella pneumoniae quality control bacteria (ATCC35657) DNA, and there was no amplification curve of Escherichia coli quality control bacteria (ATCC25922) DNA and ddH2O. There was no interference between them, indicating that the established triple fluorescence quantitative PCR method had good specificity.

[0150] 2. Sensitivity test

[0151] p-mcr-1、p-bla NDM-1 and p-cfr were diluted 10-fold, with the concentrations of p-mcr-1 (10.79×10 2 ~10.79×10 9 )copies / μL、p-bla NDM-1 is (11.32×10 2 ~11.32×10 9 )copies / μL and p-cfr is (7.52×10 2 ~7.52×10 9) copies / μL were used as a template for triple fluorescence quantitative PCR amplification. A 1:1:1 mixture of the constructed Khe, blaSHV, and tet(x4) positive plasmid standards was used as a template, and ddH2O was used as a negative control. The kit and method of Example 1 were used to perform the experiment, and the results are shown in FIG8 .

[0152] The plasmid was added at 10 9 -10 0 The double dilution was amplified by ordinary PCR and repeated three times, and the results are shown in Figure 9.

[0153] The triple TaqMan fluorescence quantitative PCR method amplified the Khe gene, blaSHV resistance gene and tet (x4) resistance gene detection with a minimum detection limit of 10 2 The minimum detection limit of Khe gene detection in the common PCR method is 10 4 The minimum copy number of blaSHV gene detection is 10 5 copies / μL. The minimum copy number for tet(x4) gene detection is 10 5 Compared with the common PCR method, the triple TaqMan fluorescence quantitative PCR method is 100 times more sensitive for Khe gene detection, 1000 times more sensitive for blaSHV gene detection, and 1000 times more sensitive for tet(x4) gene detection.

[0154] Example 7

[0155] This example is used for the results of repetitive experiments:

[0156] The diluted mixed plasmid standard was taken with a plasmid content of 10 6 ~10 4 The standard of 100 copies / μL was used as a template, and three replicates were made with three plasmid contents for intra-group repeatability experiments to obtain the intra-group variation coefficient. The three plasmid content standards were used as a group, and three independent replicates were performed for inter-group repeatability experiments to obtain the inter-group variation coefficient.

[0157] Take 10 of the positive plasmid standards of Khe, blaSHV, and tet (x4) 6 ~10 4 The optimized triple TaqMan fluorescence quantitative PCR method was used to perform inter-group and intra-group repeatability experiments. The experimental results are shown in Table 15.

[0158] Table 15: Triple fluorescence quantitative PCR repeatability experimental results

[0159]

[0160] The Cq values ​​of each concentration were analyzed, and the results showed that the coefficient of variation within and between groups was less than 2%, indicating that the method had good repeatability.

[0161] Example 9

[0162] This example is used to illustrate the technical effects obtained by clinical testing:

[0163] Klebsiella pneumoniae was isolated from 600 samples from some areas of Hebei Province, including 238 suspected Klebsiella pneumoniae. The triple fluorescence quantitative PCR detection method established in this study was compared with the conventional PCR method.

[0164] A total of 600 samples of pharyngeal swabs, anal swabs, feces and environmental swabs collected from pig farms in Xinji, Anguo, Zhangjiakou, Qian'an and Shunping areas of Tangshan were isolated and cultured for Klebsiella pneumoniae, including 238 suspected Klebsiella pneumoniae. The established triple fluorescence quantitative method and ordinary PCR method were used to detect suspected Klebsiella pneumoniae, and the experimental results are shown in Table 16. Among them, the triple method detected 82 Khe gene samples, 37 tet (x4) resistance gene samples, 43 blaSHV resistance gene samples, 7 samples containing Khe and tet (x4) genes, and 19 samples containing Khe and blaSHV genes. The ordinary PCR method detected 74 Khe gene samples, 20 tet (x4) resistance gene samples, 31 blaSHV resistance gene samples, 2 samples containing Khe and tet (x4) genes, and 10 samples containing Khe and blaSHV genes.

[0165] Table 15: Sample detection results of triple fluorescence quantitative PCR and common PCR

[0166] Gene Triple fluorescence PCR method Detection rate PCR method Detection rate Khe 82 / 238 34.45％ 74 / 238 31.09％ blaSHV 43 / 238 18.07％ 31 / 238 13.03％ tet(x4) 37 / 238 15.55％ 20 / 238 8.4％ Khe and tet (x4) 7 / 238 2.94％ 2 / 238 0.84％ Khe and blaSHV 19 / 238 7.98％ 12 / 238 5.04％

[0167] The results showed that the triple TaqMan fluorescence quantitative PCR detection method had a higher detection rate than the ordinary PCR method.

[0168] Example 10

[0169] This example is used to illustrate the process of primer screening:

[0170] According to the NCBI search for Khe gene, tet (X4) and blaSHV resistance gene sequences, Primer Premier 5 was used to design Khe (numbered 1-10), tet (X4) (numbered 11-20) and blaSHV (numbered 21-30) primers. After simulation screening, upstream and downstream primers without hairpin structure, dimer, cross-dimer, mismatch and suitable reaction temperature were selected. The sequences are shown in Table 16 below, and fluorescent modification was performed.

[0171] Table 16: Primer design and simulation results

[0172]

[0173]

[0174]

[0175] According to the above experimental results, there are cross-dimers in the blaSHV (21-30) primers, but according to PrimerPremier 5, they are not serious cross-dimers and have no effect on the experiment. Therefore, the primer pairs No. 10, 20 and 26 were selected.

[0176] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments described herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A kit for detecting Klebsiella pneumoniae and its drug resistance gene, characterized in that: The kit includes a nucleic acid amplification reagent, a reference substance and a standard substance, wherein the nucleic acid amplification reagent contains primers with nucleotide sequences as shown in SEQ ID NO:1 to SEQ ID NO:6 and probes with nucleotide sequences as shown in SEQ ID NO:7 to SEQ ID NO:

9.

2. The kit according to claim 1, characterized in that The nucleotide sequence shown in SEQ ID NO:7 was labeled with FAM at its 5' end and BHQ-1 at its 3' end, the nucleotide sequence shown in SEQ ID NO:8 was labeled with HEX at its 5' end and BHQ-1 at its 3' end, and the nucleotide sequence shown in SEQ ID NO:9 was labeled with Cy5 at its 5' end and BHQ-3 at its 3' end.

3. The kit according to claim 1, characterized in that In the nucleic acid amplification reagent, The volumes of the primers shown in SEQ ID NO: 1 to SEQ ID NO: 6 at a concentration of 10 μmol / L are 0.4 to 0.8 μL, 0.4 to 0.8 μL, 0.8 to 1.2 μL, 0.8 to 1.2 μL, 1 to 1.4 μL, and 1 to 1.4 μL, respectively; preferably, the volumes of the primers shown in SEQ ID NO: 1 to SEQ ID NO: 6 at a concentration of 10 μmol / L are 0.6 μL, 0.6 μL, 1 μL, 1 μL, 1.2 μL, and 1.2 μL, respectively; The volumes of the probes shown in SEQ ID NO:7 to SEQ ID NO:9 at a concentration of 10 μmol / L are 0.1 to 0.3 μL, 0.1 to 0.3 μL, and 0.2 to 0.4 μL, respectively; preferably, the volumes of the probes shown in SEQ ID NO:7 to SEQ ID NO:9 at a concentration of 10 μmol / L are 0.2 μL, 0.2 μL, and 0.3 μL, respectively.

4. The kit according to claim 1, characterized in that The control substances include positive control substances and negative control substances; The positive control contains a mixture of three mutant plasmids with nucleotide sequences as shown in SEQ ID NO: 10 to SEQ ID NO: 12 in equal proportions; The negative control substance is process water.

5. The kit according to claim 1, characterized in that The standard comprises a mixture of mutant plasmids of gradient concentrations mixed in equal proportions; The concentrations of the mutant plasmid mixtures were: 10 2 copies / μL, 10 3 copies / μL, 10 4 copies / μL, 10 5 copies / μL, 10 6 copies / μL, 10 7 copies / μL, 10 8 copies / μL, 10 9 copies / μL.

6. The kit according to claim 1, characterized in that The nucleic acid amplification reagent also contains 2×M5 GoldStar TaqMan Mixture.

7. A method for detecting Klebsiella pneumoniae and its drug resistance gene, characterized in that: The following steps are involved: S1, extracting bacterial genomic DNA from the sample to be tested to obtain template DNA in the sample to be tested; S2, preparing fluorescent quantitative PCR reaction system; S3. Fluorescence quantitative PCR amplification: 95°C for 15 min; 95°C for 10 sec, 60°C for 30 sec, 45 times in total, and collecting the fluorescence signal of the template DNA in the second step of each cycle; a positive result was determined as Ct≤30. S4. Prepare a standard curve using a reference substance to obtain the concentration of the drug-resistant gene in the sample to be tested.

8. The method according to claim 7, characterized in that The fluorescent quantitative PCR reaction system contains 10 μL of 2×M5GoldStar TaqMan Mixture, 0.4-0.8 μL, 0.4-0.8 μL, 0.8-1.2 μL, 0.8-1.2 μL, 1-1.4 μL, and 1-1.4 μL of the primers shown in SEQ ID NO:1 to SEQ ID NO:6 at a concentration of 10 μmol / L, respectively; 0.1-0.3 μL, 0.1-0.3 μL, 0.2-0.4 μL of the probes shown in SEQ ID NO:7 to SEQ ID NO:9 at a concentration of 10 μmol / L, respectively, 1 μL of template, and ultrapure water is added to 20 μL.

9. A primer and a probe for detecting Klebsiella pneumoniae and its drug resistance gene, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:1 to SEQ ID NO:6, and the nucleotide sequences of the probes are shown in SEQ ID NO:7 to SEQ ID NO:

9.

10. The primer and probe according to claim 9, characterized in that: The nucleotide sequence shown in SEQ ID NO:7 was labeled with FAM at its 5' end and BHQ-1 at its 3' end, the nucleotide sequence shown in SEQ ID NO:8 was labeled with HEX at its 5' end and BHQ-1 at its 3' end, and the nucleotide sequence shown in SEQ ID NO:9 was labeled with Cy5 at its 5' end and BHQ-3 at its 3' end.

Images