Composition and method for detecting Lawsonia intracellularis based on fluorescence RAA and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to a composition and method for detecting Lawsonia intracellularis based on fluorescence RAA and application. The composition comprises an RAA primer pair and a probe which are used for detecting Lawsonia intracellularis, the nucleotide sequence of an upstream primer is as shown in SEQ ID NO.3, the nucleotide sequence of a downstream primer is as shown in SEQ ID NO.4, and the nucleotide sequence of the probe is as shown in SEQ ID NO.7. A target sequence aspA gene with high conservative property is selected to design a primer pair and a probe with high specificity and amplification efficiency, the RAA amplification technology is innovatively combined to detect pig intestinal disease diarrhea caused by Lawsonia intracellularis, and the primer pair and the probe have the advantages of being simple in method, high in amplification efficiency, good in specificity, good in repeatability and accurate and reliable in detection result.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a composition, method and application for detecting intracellular Lawsonia spp. based on fluorescent RAA. Background Art

[0002] Porcine proliferative enteropathy (PPE) is a swine intestinal disease caused by Lawsonia intracellularis (LI) infection. It is mainly divided into two clinical forms: acute and chronic. It is common in pig-raising areas. The acute form mainly occurs in pigs aged 4-12 months, characterized by intestinal mucosal bleeding and sudden death; the chronic form mainly occurs in nursery pigs and fattening pigs aged 6-20 weeks, characterized by watery diarrhea and hyperplasia of immature intestinal epithelial cells in the crypts of the ileum and cecum mucosa, resulting in reduced feed conversion rate and slowed growth rate of pigs, causing serious economic losses to the pig industry.

[0003] LI belongs to the Desulfovibrio family, a Gram-negative bacterium with a curved, rod-shaped, comma-shaped or S-shaped shape. Currently, there is only one species of Lawsonia intracellularis in pigs. The complete genomes published in the NCBI database are N343 and PHE / MN1-00, which contain 1719014 base pairs, distributed in 1 small chromosome and 3 plasmids, and the gene sequence is relatively conservative. The AspA gene encodes aspartate ammonia-lyase, which plays an important role in the metabolic process of bacteria. In the method of detecting Lawsonia intracellularis, the aspA gene is used as an important target, especially in the qPCR method, it is used as a highly specific and sensitive target gene to facilitate the detection and quantification of Lawsonia intracellularis in clinical samples.

[0004] Common pathogen detection methods for intracellular Lawsonia include polymerase chain reaction (PCR), fluorescent PCR, indirect immunofluorescence assay (IFA), immunoperoxide single cell assay (IMPA), enzyme-linked immunosorbent assay (ELISA), etc. Although these detection methods are highly sensitive, they are highly dependent on instruments such as fluorescent PCR / PCR instruments and microplate readers, and the operation is cumbersome and the detection cost is high. For example, the invention patent with publication number CN102453762B discloses a kit and method for detecting intracellular Lawsonia, a pathogen of porcine proliferative enteropathy, the kit includes primers for amplifying DNA fragments of the sample to be tested from the extracted sample DNA and: upstream primer: 5'GAGCACGATTACAAATTGCTTCA3'; downstream primer: 5'TGCTATCTCTGCTGCATGTAATGA3'; also includes a fluorescent quantitative PCR primer probe, the nucleotide sequence of which is: 5'-TCCCTGCACCTCCTTGAATACAATCCACA-3'.

[0005] Therefore, establishing a simpler LI detection technology to achieve fast, convenient and low-cost detection will play an important role in the prevention and control of PPE epidemics. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide a composition for detecting Lawsonia intracellularis.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] A composition for detecting intracellular Lawsonia, comprising a RAA primer pair and a probe for detecting intracellular Lawsonia; the primer pair comprises an upstream primer whose nucleotide sequence is shown in SEQ ID NO.3 and a downstream primer whose nucleotide sequence is shown in SEQ ID NO.4; the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0009] Furthermore, the probe is modified with FAM at the 5'-end, C3 Spacer at the 3'-end, and THF / spacer and BHQ in the middle.

[0010] Furthermore, the composition uses the aspA gene of Lawsonia intracellularis as a detection target, and its nucleotide sequence is shown in SEQ ID NO.1.

[0011] A second object of the present invention is to provide a kit for detecting intracellular Lawsonia spp. using fluorescent RAA.

[0012] To achieve the above object, the present invention adopts the following technical solutions:

[0013] A kit for detecting intracellular Lawsonia spp. with fluorescent RAA, the kit comprising the aforementioned composition.

[0014] Furthermore, the kit also comprises a positive standard plasmid of Lawsonia intracellularis.

[0015] Furthermore, the kit consists of 25.0 μL of ABuffer, 2.0 μL of the upstream primer, 2.0 μL of the downstream primer, 0.6 μL of the probe, 12.9 μL of DEPC water, 5.0 μL of standard plasmid, and 2.5 μL of B Buffer.

[0016] Preferably, the concentration of the upstream primer is 10 μM, the concentration of the downstream primer is 10 μM, and the concentration of the probe is 10 μM.

[0017] A third object of the present invention is to provide a method for detecting intracellular Lawsonia solani for non-disease diagnosis purposes based on fluorescent RAA.

[0018] To achieve the above object, the present invention adopts the following technical solutions:

[0019] The method for detecting intracellular Lawsoniae for non-disease diagnosis purposes based on fluorescent RAA comprises the following steps:

[0020] (1) Extracting DNA from the sample to be tested;

[0021] (2) using the sample DNA to be tested as a template, performing fluorescent RAA amplification using the aforementioned kit to obtain an amplification curve;

[0022] (3) Determine whether the sample to be tested contains intracellular Lawsonia spp. according to the amplified CT value.

[0023] Furthermore, if the amplified CT value is >36, the result is negative, indicating that the sample to be tested does not contain intracellular Lawsonia spp.; if the amplified CT value is ≤36, the result is positive, indicating that the sample to be tested contains intracellular Lawsonia spp.

[0024] Furthermore, the fluorescent RAA amplification reaction conditions are: amplification at 39-42° C. for 18-25 min.

[0025] Preferably, the fluorescent RAA amplification reaction conditions are: amplification at 42° C. for 20 min.

[0026] Furthermore, the sample to be tested includes any one or more of a pig feces sample, a pig intestinal content sample, and a pig intestinal tissue sample.

[0027] Recombinase-mediated isothermal nucleic acid amplification (RAA) technology can usually quickly complete the amplification reaction within 30 minutes under a constant temperature of 37 to 42°C. Compared with traditional detection methods, it not only shortens the reaction time, but also greatly reduces the detection cost. The present invention selects the target sequence aspA gene with high conservatism to design specific primer pairs and probes with high amplification efficiency, and uses fluorescent RAA to detect porcine intracellular Lawsonia suis. The method is simple to operate, low in cost, high in amplification efficiency, good in specificity, high in sensitivity, good in repeatability, good in temperature range applicability, accurate and reliable in detection results, and is suitable for the detection of different types of samples. It has potential effectiveness and application prospects in the detection of porcine diarrhea pathogens.

[0028] A fourth object of the present invention is to provide a use of the aforementioned composition as or in the preparation of a product for detecting Lawsonia intracellularis infection in pigs.

[0029] The beneficial effects of the present invention are:

[0030] 1) Good specificity: In the method of the present invention, only LI nucleic acid can be amplified without being interfered by nucleic acids of other viruses (including PoRV, PDCoV, TGEV, PEDV, PRRSV, ASFV, PCV2, CSFV, etc.) and bacteria (including Escherichia coli, Staphylococcus aureus, Clostridium perfringens, etc.), and the detection results are accurate and reliable;

[0031] 2) Good amplification efficiency;

[0032] 3) The detection method is fast and efficient: the detection time is about 20 minutes;

[0033] 4) High sensitivity: The minimum detection limit reaches 1.0×10 1 copies / μL, which helps detect low viral load samples and makes the detection method more practical;

[0034] 5) Good repeatability: The fluorescent RAA amplification detection method and kit established in the present invention show good consistency in the repeatability of the amplification reaction, and the detection method is stable and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The figure shows the results of primer screening electrophoresis, where 1 is DNA molecule Marker DL1500, 2 is F1 / R1, 3 is F2 / R2, 4 is F1 / R2, and 5 is F2 / R1;

[0036] Figure 2 The figure is the result of fluorescence RAA amplification, where 1 is the positive control of the kit, 2-5 are the amplification results of the F2 / R1 combination primers, and 6 is the negative control;

[0037] Figure 3 The results of the fluorescence RAA sensitivity test are shown in Figure 1-7, where 1-7 represent different concentrations of standard plasmid templates, and 1-7 are 1.0×10 6 copies / L, 1.0×10 5 copies / L, 1.0×10 4 copies / L, 1.0×10 3 copies / L, 1.0×10 2 copies / L, 1.0×10 1 copies / L, 1.0×10 0 copies / L; 8 for negative control;

[0038] Figure 4 This is a graph of the fluorescent RAA specificity test results, where 1 represents the LI sample;

[0039] Figure 5 The results of the fluorescence RAA repeatability test are shown in Figure 1, where 1-3 represent plasmid 1.0×10 3 3 copies / μL, 4-6 represents 1.0×10 1 copies / μL were repeated three times, and 7 represented the negative control;

[0040] Figure 6 This is the result diagram of fluorescent RAA detection of clinical samples, where: Figure 6 -A is a diagram of the test results of stool samples, in which 1 is a positive control of the vaccine strain, 2, 3, 4, 5 are stool clinical samples, and 6 is a negative control; Figure 6 -B is a graph showing the test results of intestinal content samples, in which 1 is a positive control of the vaccine strain, 2, 3, 4, and 5 are clinical samples of intestinal contents, and 6 is a negative control; Figure 6 -C is the test result diagram of intestinal samples, in which 1 is the positive control of vaccine strain, 2, 3, 4, 5 are intestinal clinical samples, and 6 is the negative control. DETAILED DESCRIPTION

[0041] The technical solution of the present invention will be further described clearly and completely in conjunction with specific embodiments below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work belong to the protection scope of the present invention.

[0042] Example 1. Establishment of LI fluorescence RAA detection method

[0043] 1. Selection of target aspA gene sequence for LI detection

[0044] LI is an obligate intracellular parasitic bacterium that mainly parasitizes in intestinal mucosal epithelial cells and causes proliferative enteritis in pigs. Taking aspA as the detection target, the aspA gene sequence of strain N343 was downloaded from the GenBank database, sequence alignment was performed, and conservative fragments were screened. Finally, the 417bp sequence was confirmed as the detection target region. The specific sequence is shown in SEQ ID NO.1.

[0045] 2. Primer design and screening

[0046] (1) Preparation of positive standards

[0047] The conservative sequence (417 bp) of the aspA gene of the LI-N343 strain was used as a template and was commissioned to be synthesized by Shanghai Bioengineering Engineering Co., Ltd. and cloned into a vector (pUC57 vector) to obtain a recombinant plasmid (pUC57-vector-LI-aspA) containing the target fragment. The recombinant plasmid was transformed into E. coli DH5α and cultured. The recombinant plasmid was amplified and extracted as a positive standard. The obtained plasmid was measured for plasmid concentration (85.1±0.4 ng / μL) using an ultra-micro UV spectrophotometer and the copy number was calculated. The original concentration was diluted in a 10× gradient to prepare 1.0×10 -10 ~1.0×10 0 copies / μL, stored at -20℃ for future use.

[0048] (2) Design of RAA amplification primers for the aspA gene

[0049] Using the conservative sequence (417 bp) of the aspA gene of the LI-N343 strain as a template, two pairs of primers were designed using RAA primer design software, and their specificity was verified by BLAST. The primer sequences are shown in Table 1. The RAA primers were divided into four groups: F1 / R1, F1 / R2, F2 / R1, and F2 / R2.

[0050] Table 1. RAA primer sequence list

[0051] name Primer sequence (5'→3') LI-RAA-F1 SEQ ID NO.2 LI-RAA-F2 SEQ ID NO.3 LI-RAA-R1 SEQ ID NO.4 LI-RAA-R2 SEQ ID NO.5

[0052] (3) Screening of specific primer pairs

[0053] The standard plasmid was used as the positive standard and amplified according to the instructions of the RAA nucleic acid amplification kit. The reaction system was 25 μL Buffer A, 13.5 μL DEPC water, 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 2.5 μL Buffer B, and 5 μL positive standard. The reaction conditions were 42°C for 20 minutes. After the amplification, the amplified product was purified with a mixed solution of chloroform and phenol (the volume ratio of chloroform to phenol was 1:1), and the purified product was analyzed by 3% agarose gel electrophoresis. The results are shown in Figure 1 As shown in the figure, through the observation and analysis of the electrophoresis of the RAA amplification product, it can be seen that the four primer pairs in the combination can amplify the target bands, and the bands are all specific bands. On this basis, the gray value analysis of the amplified fragments found that the target band of the RAA product electrophoresis of the primer combination of band 5 (F2 / R1) was bright and showed specific amplification. Therefore, the F2 / R1 primer pair was selected as the primer pair for the subsequent fluorescent RAA reaction, and the amplified sequence is shown in SEQ ID NO.6 (165bp).

[0054] 3. Establishment of LI fluorescence RAA detection method and verification of its effectiveness

[0055] (1) Design and synthesis of fluorescent RAA detection probes

[0056] According to the screening results of basic RAA primers, a probe primer suitable for fluorescent RAA was designed and synthesized for the amplified target fragment. The probe was modified with FAM at the 5'-end, C3 Spacer at the 3'-end, and THF / spacer and BHQ in the middle, as shown in Table 2. It was synthesized by Sangon Biotech (Shanghai) Co., Ltd. for future use.

[0057] Table 2. RAA probe sequence list

[0058]

[0059] (2) Effectiveness of fluorescent RAA amplification

[0060] The standard plasmid was used as the positive standard and amplified according to the instructions of the RAA nucleic acid amplification kit (fluorescence type). The reaction system is shown in Table 3. After the reaction mixture was fully mixed, the obtained reaction system was placed in a constant temperature fluorescence PCR instrument and RAA amplification was performed immediately. The reaction conditions were: 42℃ amplification for 20 minutes. The results are shown in Table 3. Figure 2 As shown, the F2 / R1 primer pair produced a distinct amplification curve in the fluorescent RAA reaction, indicating that the primer pair exhibited good amplification efficiency in the LI fluorescent RAA detection method. This result shows that the F2 / R1 primer pair can be used to quickly and accurately detect LI nucleic acids.

[0061] Table 3. Fluorescence RAA amplification reaction system

[0062] Reaction system components Dosage (μL) ABuffer 25.0μL Upstream primer (LI-RAA-F2, 10 μM) 2.0μL Downstream primer (LI-RAA-R1, 10 μM) 2.0μL Probe (LI-Probe-A, 10 μM) 0.6μL DEPC water 12.9μL Standard plasmid 5.0μL BBuffer 2.5μL Total volume 50.0μL

[0063] Example 2. Fluorescent RAA Detection Method for Lawsonia intracellularis

[0064] (1) Extracting DNA from the sample to be tested;

[0065] (2) Using the sample DNA to be tested as a template, fluorescent RAA amplification was performed; the fluorescent RAA amplification reaction system included: ABuffer 25.0 μL, upstream primer (LI-RAA-F2, 10 μM) 2.0 μL, downstream primer (LI-RAA-R1, 10 μM) 2.0 μL, probe (LI-Probe-A, 10 μM) 0.6 μL, DEPC water 12.9 μL, standard plasmid 5.0 μL, B Buffer 2.5 μL, totaling 50.0 μL; reaction conditions: amplification at 42°C for 20 min; and an amplification curve was obtained.

[0066] (3) Determine whether the sample to be tested contains intracellular Lawsoniae according to the amplified CT value. If the amplified CT value is >36, the result is negative, indicating that the sample to be tested does not contain intracellular Lawsoniae; if the amplified CT value is ≤36, the result is positive, indicating that the sample to be tested contains intracellular Lawsoniae.

[0067] Example 2. Verification of sensitivity, specificity and repeatability of LI fluorescence RAA detection method

[0068] (1) Fluorescent RAA amplification sensitivity test

[0069] The positive standard plasmid (original concentration 1.0×10 10 copies / μL) was diluted 10×. Then, 1.0×10 6 ~1.0×10 0 The fluorescent RAA amplification reaction was carried out according to the fluorescent RAA amplification reaction system in Example 2, and the reaction conditions were 42°C for 20 min. The results are shown in Figure 2. Figure 3 As shown in Figure 2, the minimum template concentration for detection using this fluorescent RAA detection method is 1.0×10 1 This result highlights the excellent performance of this method in terms of amplification efficiency. This also further proves that the F2 / R1 primer pair can efficiently bind to the target LI nucleic acid, thus achieving highly sensitive detection.

[0070] (2) Fluorescent RAA amplification specificity test

[0071] Porcine rotavirus (PoRV), porcine deltacoronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), and blue ear virus (PRRSV) were preserved in this laboratory; African swine fever virus (ASFV), porcine circovirus (PCV2), and inactivated classical swine fever virus (CSFV) were donated by Chongqing Aolong Biological Products Co., Ltd. For bacteria: Lawsonia intracellularis (LI), Escherichia coli (CVCC1524), Staphylococcus aureus, and Clostridium perfringens were preserved in this laboratory. The genomes (DNA or RNA) of the above pathogens were extracted using the DNA / RNA nucleic acid extraction kit and reverse transcribed. The fluorescent RAA reaction system and reaction conditions are the same as those in "(1) Fluorescent RAA amplification sensitivity test", and the results are shown in the table below. Figure 4 As shown, only the LI positive samples showed obvious amplification curves. This indicates that this method can effectively detect LI positive templates, while other viral and bacterial nucleic acid templates are not detected. This shows that this method selects the aspA gene of LI as the detection target, and the designed primers and probes are reasonable and efficient, so that the fluorescent RAA detection method established on this basis has good specificity.

[0072] (3) Fluorescence RAA amplification repeatability test

[0073] The fluorescent RAA amplification reaction system was prepared according to "(1) Fluorescent RAA amplification sensitivity test". The standard plasmid template concentration was 1.0×10 3 copies / μL and 1.0×10 1 The reaction conditions were 42℃ for 20min, with 3 replicates. The results were as follows: Figure 5 As shown. After three replicates, a clear amplification curve was observed in each replicate. This indicates that the established fluorescent RAA amplification detection technology shows good consistency in the repeatability of the amplification reaction.

[0074] Example 3. Detection of clinical samples

[0075] The present invention aims to develop a detection method for diarrhea caused by intracellular Lawsonia intracellularis, a porcine intestinal disease. Therefore, fecal samples, intestinal content samples, intestinal tissues and LI vaccine strain samples are collected from diarrheal pigs. The fecal samples and intestinal contents are thoroughly vortexed with 1×PBS and then centrifuged. The intestinal tissue samples are fully ground. The LI vaccine strain does not require pretreatment. A genome extraction kit is used to extract nucleic acids to obtain samples that can be used for subsequent analysis. After nucleic acid extraction from all samples, they are mixed according to the fluorescent RAA reaction system in Example 2 and then subjected to RAA fluorescent amplification reaction. The reaction conditions are 42°C for 20 minutes to detect the target sequence. The results are as follows. Figure 6As shown in the experimental results, it can be seen that the fluorescent RAA detection method developed in the present invention provides a feasible solution for the detection of Lawsonia intracellularis in pigs and can be applied to different types of samples, which shows that the method has potential effectiveness and application prospects in the detection of pig diarrhea pathogens.

Claims

1. A composition for detecting Lawsonia intracellularis, characterized in that: The composition comprises a RAA primer pair and a probe for detecting intracellular Lawsonia; the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4; the nucleotide sequence of the probe is shown in SEQ ID NO.

7.

2. The composition according to claim 1, characterized in that The probe is modified with FAM at the 5'-end, C3Spacer at the 3'-end, and THF / spacer and BHQ in the middle.

3. The composition according to claim 1, characterized in that The composition uses the aspA gene of intracellular Lawsonia spp as a detection target, and the nucleotide sequence thereof is shown in SEQ ID NO.

1.

4. A kit for detecting intracellular Lawsonia spp. by fluorescent RAA, characterized in that: The kit contains the composition according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also contains a Lawsonia intracellularis positive standard plasmid.

6. The kit according to claim 4, characterized in that The kit consists of 25.0 μL of ABuffer, 2.0 μL of the upstream primer, 2.0 μL of the downstream primer, 0.6 μL of the probe, 12.9 μL of DEPC water, 5.0 μL of standard plasmid, and 2.5 μL of BBuffer.

7. A method for detecting intracellular Lawsoniae for non-disease diagnosis purposes based on fluorescent RAA, characterized in that: The steps include: (1) Extracting DNA from the sample to be tested; (2) using the sample DNA to be tested as a template, performing fluorescent RAA amplification using the kit described in any one of claims 4 to 6 to obtain an amplification curve; (3) Determine whether the sample to be tested contains intracellular Lawsonia spp. according to the amplified CT value.

8. The method according to claim 7, characterized in that The fluorescent RAA amplification reaction conditions are: amplification at 39-42° C. for 18-25 min.

9. The method according to claim 7, characterized in that: The sample to be tested includes any one or more of a pig feces sample, a pig intestinal content sample, and a pig intestinal tissue sample.

10. Use of the composition according to any one of claims 1 to 3 as or in the preparation of a product for detecting Lawsonia intracellularis infection in pigs.

Images