Specific primer for detecting acinetobacter belelii and application of specific primer

Abstract

The invention discloses a specific primer for detecting acinetobacter belelii and an application of the specific primer. The specific primer comprises bayllyi-F and bayllyi-R. The specific primer comprises the bayllyi-F and the bayllyi-R. The primer provided by the invention is used for PCR (Polymerase Chain Reaction) amplification and is subjected to 1.2% agarose gel electrophoresis and Sanger sequencing, and a 370 bp clear and single DNA (Deoxyribose Nucleic Acid) strip exists. According to the present invention, the PCR detection is performed on the acinetobacter belelii, the accuracy rate is 100%, the time consumption is only 3 h, and the method can be successfully used in the conjugational transfer experiment of the acinetobacter belelii ADP1. The method for detecting the acinetobacter belelii by adopting the specific primer of the acinetobacter belelii, provided by the invention, is simple to operate, efficient and high in accuracy.

Description

Technical Field

[0001] The present invention relates to the detection of Acinetobacter, and in particular to a specific primer for detecting Acinetobacter bellii and an application thereof. Background Art

[0002] Acinetobacter is a type of aerobic Gram-negative bacteria, with up to 116 species, widely distributed in humans, animals and the natural environment. As an important global conditional pathogen, Acinetobacter often has a multi-drug resistant phenotype. Data from the China Antimicrobial Resistance Monitoring Network also show that the resistance rate of this type of strain is rising year by year. Among them, Acinetobacter belli has a very strong ability to capture exogenous DNA, which is particularly worthy of attention. For example, Acinetobacter belli ADP1 has become one of the commonly used receptor bacteria in the laboratory, used to determine the ability of horizontal gene transfer, including carbapenem resistance genes bla NDM and tigecycline resistance gene tet (X).

[0003] Currently, the classic method for identifying bacteria is to classify them based on their physiological and biochemical characteristics, but this method is costly and time-consuming. rpoB Gene sequencing is also a common method for identifying bacteria, but there are many species of Acinetobacter, and there is a lack of significant gene sequence differences between them, which poses a high risk of misjudgment. In contrast, the PCR detection technology using specific primers is not only simple to operate, efficient and low-cost, but also solves the defect of misjudgment of sequence alignment. However, no reports on specific PCR primers and their applications for Acinetobacter belyliani have been found so far. Summary of the invention

[0004] In view of the problem that there is currently a lack of specific PCR primers for Acinetobacter belylianis, the present invention provides a specific primer for detecting Acinetobacter belylianis and its application. The specific primer can efficiently detect Acinetobacter belylianis and promote the rapid detection of this type of pathogen.

[0005] In order to achieve the above object, the present invention provides a specific primer for detecting Acinetobacter belyliani, which comprises: baylyi-F:TTGCTTCACCCGCCAAAATG baylyi-R: TTCTTGGCCTGTACGCATCA.

[0006] The second aspect of the present invention provides the use of the above-mentioned specific primers in the preparation of products for detecting Acinetobacter belli.

[0007] Preferably, the article of manufacture is a kit.

[0008] The third aspect of the present invention provides the use of the above-mentioned specific primers in detecting Acinetobacter belli.

[0009] A fourth aspect of the present invention provides a method for detecting Acinetobacter belli, comprising the following steps: S1, using the above-mentioned specific primers to perform PCR amplification on the genomic DNA of the strain to be tested; S2. If a clear and single DNA band of 370 bp is found in the gel electrophoresis test results, the strain is confirmed to be Acinetobacter belli.

[0010] Specifically, in step S1, the minimum detection concentration of genomic DNA was 1.504×10 -6 ng / μL.

[0011] Through the above technical solution, the present invention achieves the following beneficial effects: 1. The primers of the present invention were used for PCR amplification, and after 1.2% agarose gel electrophoresis and Sanger sequencing, a clear and single DNA band of 370 bp was present. The PCR detection of Acinetobacter belyliani was performed with an accuracy of 100%, and the time consumption was only 3 h, and it was successfully applied to the conjugation transfer experiment of ADP1 of Acinetobacter belyliani.

[0012] 2. The specific detection method for Acinetobacter belli provided by the present invention is simple to operate, efficient and has high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is the matching result of the primers baylyi-F and baylyi-R and the gene template in Example 1; Figure 2 is the Blastn comparison result of the measured PCR product sequence and the gene template in Example 1; Figure 3 is the optimum annealing temperature determination result of Acinetobacter belieri specific primer in Example 2; Figure 4 is the stability result of the Acinetobacter beilii specific primer in Example 3; Figure 5 This is the result of PCR detection limit determination of Acinetobacter belli genomic DNA in Example 4. DETAILED DESCRIPTION

[0014] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0015] Example 1 Design and verification of primers for Acinetobacter belli (1) Design specific primers A total of 21 strains of Acinetobacter baylyii were collected from the NCBI database and laboratory storage. Combined with the quality control assessment of the bacterial whole genome and the average nucleotide consistency analysis, 17 strains met the standards. Based on the specific homologous genes of the 17 strains of Acinetobacter baylyii (564 bp, encoding a domain protein), the specific primers baylyi-F (TTGCTTCACCCGCCAAAATG) and baylyi-R (TTCTTGGCCTGTACGCATCA) of Acinetobacter baylyii were designed using the Primer-BLAST online website. SnapGene Version 6.0.2 was used to confirm that the primer sequences were completely bound to the corresponding gene templates ( Figure 1 ).

[0016] (2) Preparation of DNA template The three zones of Acinetobacter belyliani ADP1 were streaked onto an LB agar plate without antibiotics and cultured at 37 °C for 18 h. A 10 μL disposable inoculation loop was used to scrape a half-ring of bacterial lawn into 500 μL of normal saline, and the supernatant was removed by centrifugation. The genomic DNA was extracted according to the operating procedures of the Tiangen Bacteria Genomic DNA Extraction Kit, and then the concentration was determined by a micro-UV spectrophotometer to be 201.801 ng / μL, and the DNA was stored in a -20 °C refrigerator for later use.

[0017] (3) Establishment of PCR detection method for Acinetobacter belli PCR system: 2 × Taq Master Mix (Novozymes), 12.5 μL; DNA template, 1 μL; upstream and downstream primers, 1 μL each; sterile water, 9.5 μL.

[0018] PCR program: 94°C pre-denaturation for 3 min, (94°C denaturation for 30 s, 57.5°C annealing for 30 s, 72°C extension for 1 min) × 35 cycles, 72°C final extension for 10 min, and storage at 16°C.

[0019] (4) Determination of PCR amplification results 10 μL of PCR product was taken for 1.2% agarose gel electrophoresis and photographed using a Tanon 2500 gel imager, showing a clear and single electrophoresis band. The PCR amplification product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing, and the actual PCR product sequence size was 370 bp: GATTGATGCAAGTCAGCCAAATTGATGATTTACTGCGCCAATCTCTCACAGAACTTTCGCCTTACTATGACAAGCAAGCCGAACAGATTATTCTCAATATTACCAAATCTACGACACTTAACGACAAAGAAAGACAAGCAGCGACACAATTGAGTCAACTCATGCGTGATTCAAGTACTCAAATT ATCAGTAATCCAAAAACCCACAGGCTATTGAAGATATTTACTTAAAAACCTATACAGAGGAAGAAGTACAAGCCAGCATCAAGTTTTTAAAAACACCTGAAGGGCAATCAATTACTCGCAAAAATGCAAAAATGATGGGTGAACTTTCTGAATACATGATGCGTACAGGCCAAGAAAAAAAATT.

[0020] In addition, the comparison results between the measured sequence and the gene template are also consistent with expectations and are the same gene ( Figure 2 ).

[0021] Example 2 Determination of the optimal annealing temperature Using the genomic DNA of Acinetobacter belieri ADP1 as a template, PCR amplification was performed according to the PCR system and procedure established in (3) of Example 1. The annealing temperature gradient was set to 46 ℃, 47.6 ℃, 49.3 ℃, 50.9 ℃, 52.5 ℃, 54.2 ℃, 55.8 ℃, 57.5 ℃, 59.1 ℃, 60.7 ℃, 62.4 ℃ and 64 ℃, and three parallels were set for each temperature. 10 μL of PCR product was aspirated for 1.2% agarose gel electrophoresis and Tanon 2500 gel imager detection, with an exposure time of 1 s. Finally, the gray value of the results was analyzed using ImageJ Version 1.54m software. The results are shown in Figure 2. Figure 3 As shown, the optimum annealing temperature is 57.5 ℃.

[0022] Example 3 Determination of primer stability The specific primers for Acinetobacter belieri were placed at room temperature, 4 ℃ and -20 ℃, and samples were taken on the 1st, 3rd, 5th, 7th and 10th days, and PCR amplification was performed at 57.5 ℃, with three parallels set at each temperature. 10 μL of PCR product was subjected to 1.2% agarose gel electrophoresis, and then detected using a Tanon 2500 gel imager with an exposure time of 1S. Finally, grayscale analysis software ImageJ Version 1.54m was used for analysis. The results are shown in Figure 2. Figure 4 As shown in the figure, -20 ℃ low temperature condition is more conducive to maintaining the stability of primers.

[0023] Example 4 Determination of the minimum detection limit The genomic DNA of Acinetobacter belieri ADP1 was diluted two-fold using sterile water to a final concentration of 1.879×10 -7 ng / μL. Then, the diluted genome was used as a template for PCR amplification at 57.5°C. Figure 5 It can be seen that dilution 2 -27 After that, the target gene band disappeared, and the minimum detection limit of genomic DNA was 1.504×10 -6 ng / μL.

[0024] Example 5 Accuracy of PCR detection of Acinetobacter belli bacterial liquid A total of 80 strains were tested, including 11 strains of Acinetobacter beri, 20 strains of Escherichia coli, 19 strains of Acinetobacter variable, 8 strains of Acinetobacter tomnema, 6 strains of Acinetobacter indica, 4 strains of Acinetobacter shenmenii, 2 strains of Acinetobacter sichuanensis, 2 strains of Acinetobacter lvivovii, 2 strains of Acinetobacter pseudolvivovii, 2 strains of Acinetobacter amis, 1 strain of George Waters of Farson, 1 strain of Klebsiella pneumoniae, 1 strain of Salmonella and 1 strain of Acinetobacter baumannii. 1 μL of fresh bacterial solution was taken as template for PCR amplification at 57.5 ℃. 10 μL of PCR product was taken for 1.2% agarose gel electrophoresis, and then photographed on a Tanon 2500 gel imager with an exposure time of 1 S. The entire detection process took only 3 h. The results are shown in Table 1. Acinetobacter beri had a clear and single band of 370 bp, while other strains had no bands and were negative. The accuracy of PCR detection of Acinetobacter beri bacterial solution was 100%.

[0025] Table 1 Detection results of specific primers for Acinetobacter belli

[0026] Example 6 Application of Acinetobacter belyliani-specific primers—conjugative transfer experiment The rifampicin-resistant Acinetobacter belieri ADP1 was used as the recipient bacteria, and the tigecycline-resistant tet (X3) positive Acinetobacter amis JXZ5-1 was used as the donor bacteria, and the membrane conjugation transfer experiment was performed at a volume ratio of 3:1. The specific primers baylyi-F / baylyi-R were used to obtain the tetThe results showed that the strains grown on the double-drug plate had a specific band of 370 bp, which were all conjugants.

[0027] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0028] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0029] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A specific primer for detecting Acinetobacter belli, characterized in that: include: baylyi-F:TTGCTTCACCCGCCAAAATG baylyi-R: TTCTTGGCCTGTACGCATCA.

2. Use of the specific primers described in claim 1 in preparing products for detecting Acinetobacter belli.

3. The use according to claim 2, characterized in that: The product is a kit.

4. Use of the specific primers described in claim 1 in detecting Acinetobacter belli.

5. A method for detecting Acinetobacter belli, characterized in that: The steps include: S1. Perform PCR amplification on the genomic DNA of the strain to be tested using the specific primers described in claim 1; S2. If a clear and single DNA band of 370 bp is found in the gel electrophoresis test results, the strain is confirmed to be Acinetobacter belli.

6. The detection method according to claim 5, characterized in that In step S1, the minimum detection concentration of genomic DNA was 1.504×10 -6 ng / μL.

Images