Transgenic maize event LP111-2 and detection method thereof

Abstract

The invention belongs to the technical field of plant breeding, and relates to a transgenic maize event LP111-2 and a detection method thereof. The invention provides a nucleic acid molecule for detecting a transgenic maize event LP111-2, the sequence of the nucleic acid molecule is as shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5 or one or more groups of complementary sequences thereof, the nucleic acid molecule is derived from the transgenic maize event LP111-2, and the sequence of the nucleic acid molecule is as shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5 or one or more groups of complementary sequences thereof. Maize seeds comprising the transgenic maize event LP111-2 have been preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO: P202430. Maize plants comprising the transgenic maize event LP111-2 of the present invention have the following advantages: free of economic losses due to lepidoptera pests; an agricultural herbicide containing glyphosate can be applied to corn crops; the corn yield is not reduced; and the breeding efficiency is enhanced, and the molecular marker can be used for tracking transgenic insertion fragments in a breeding population and a progeny thereof.

Description

Technical Field

[0001] The invention belongs to the technical field of plant breeding and relates to a transgenic corn event LP111-2 and a detection method thereof. Background Art

[0002] Corn (Zea mays L.) is a major food crop in many parts of the world. Biotechnology has been applied to corn to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in corn production, especially resistance to lepidopteran insects (such as corn borers, cotton bollworms, fall armyworms, armyworms, etc.). Corn resistance to lepidopteran insects can be obtained by expressing lepidopteran insect resistance genes in corn plants through transgenic methods. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicides. Corn tolerance to glyphosate herbicides can be obtained by expressing glyphosate herbicide tolerance genes (such as epsps) in corn plants through transgenic methods.

[0003] It is known that the expression of foreign genes in plants is affected by their chromosomal location, which may be due to chromatin structure (such as heterochromatin) or the proximity of transcriptional regulatory elements (such as enhancers) to the integration site. For this reason, it is usually necessary to screen a large number of events before it is possible to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of the transgene between different plant tissues, which is manifested in the fact that the actual expression pattern may not be consistent with the expression pattern expected from the transcriptional regulatory elements in the introduced gene construct. Therefore, it is usually necessary to generate hundreds or thousands of different events and screen them for a single event that has the expected transgene expression level and expression pattern for commercialization purposes. Such transformation events have excellent resistance to lepidopteran pests (such as Asian corn borer, fall armyworm, oriental armyworm, fall armyworm, cotton bollworm, cutworm and peach borer, etc.) and glyphosate herbicide without affecting corn yield. Conventional breeding methods can be used to backcross transgenic traits to other genetic backgrounds through hybridization. The offspring produced by this hybridization method retain the transgenic expression characteristics and trait performance of the original transformant. The application of this strategy model can ensure reliable gene expression in many varieties, with stable resistance to lepidopteran pests (such as Asian corn borer, fall armyworm, oriental armyworm, fall armyworm, cotton bollworm, cutworm and peach borer, etc.) and glyphosate herbicide, so that these varieties are protected from major lepidopteran pests, have a broad spectrum of weed control capabilities, and can adapt well to local growth conditions.

[0004] It will be useful to be able to detect the presence of a specific event to determine whether the offspring of sexual hybridization includes the target gene. In addition, the method for detecting a specific event will also help to comply with relevant laws and regulations, such as food derived from recombinant crops needs to be formally approved and marked before being put on the market. It is possible to detect the presence of transgenic by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization utilizing polynucleotide probes. These detection methods usually focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the transgenic DNA inserted is known, otherwise the above-mentioned method cannot be used to distinguish different events, particularly those events produced with the same DNA construct. Therefore, a pair of primers that often utilize the junction site of the T-DNA and flanking DNA inserted across to identify transgenic specific events by PCR, specifically the first primer contained in the flanking sequence and the second primer containing the inserted sequence. Summary of the invention

[0005] The purpose of the present invention is to provide a transgenic corn event LP111-2 and a nucleic acid sequence and a detection method for detecting the LP111-2 event of a corn plant, which can accurately and quickly identify whether a biological sample contains a specific transgenic corn event LP111-2 DNA molecule.

[0006] To achieve the above-mentioned object, the present invention provides a nucleic acid molecule for detecting transgenic corn event LP111-2, the sequence of the nucleic acid molecule comprising a sequence selected from any one of sequences SEQ ID NO: 1-5 and complementary sequences thereof, the nucleic acid molecule is derived from a transgenic corn plant, seed or cell comprising transgenic corn event LP111-2, the corn seeds comprising the transgenic corn event LP111-2 have been deposited with the China Center for Type Culture Collection (abbreviated as CCTCC, address: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University Collection Center, Postal Code 430072), classified and named: corn seed LP111-2 (Zea mays L.LP111-2), and the deposit date is November 25, 2024.

[0007] In some embodiments, the sequence of the nucleic acid molecule is shown in one or more groups of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQID NO:5 or their complementary sequences, and the nucleic acid molecule is derived from the transgenic corn event LP111-2. The corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:P202430.

[0008] In some embodiments, the nucleic acid molecule is derived from a plant, seed, or cell comprising transgenic corn event LP111-2.

[0009] In some embodiments of the present invention, the present invention provides a nucleic acid molecule comprising at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0010] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic corn event LP111-2, and the SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the corn insertion site and the DNA sequence at the 5' end of the insertion sequence. The presence of the transgenic corn event LP111-2 can be identified by including the SEQ ID NO:1 or its complementary sequence. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic corn event LP111-2, and the SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the insertion sequence and the flanking genomic DNA sequence of the corn insertion site. The presence of the transgenic corn event LP111-2 can be identified by including the SEQ ID NO:2 or its complementary sequence.

[0011] The nucleic acid molecule provided by the present invention can be at least 11 or more continuous polynucleotides (first nucleic acid sequence) of any part of the transgenic insertion sequence in the SEQ ID NO:3 or its complementary sequence, or at least 11 or more continuous polynucleotides (second nucleic acid sequence) of any part of the 5' flanking corn genomic DNA region in the SEQ ID NO:3 or its complementary sequence. The nucleic acid molecule can further be homologous to or complementary to a part of the SEQ ID NO:3 that includes the complete SEQ ID NO:1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in the DNA amplification method for producing an amplified product. When the amplified product produced in the DNA amplification method using the DNA primer pair is an amplified product including SEQ ID NO:1, the presence of the transgenic corn event LP111-2 or its progeny can be diagnosed. It is well known to those skilled in the art that the first and second nucleic acid sequences do not have to be composed only of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe and primer can be at least about 17 to about 50 or more consecutive nucleotides in length. The SEQ ID NO:3 or its complementary sequence is a 938-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic corn event LP111-2. The SEQ ID NO:3 or its complementary sequence consists of a 439-nucleotide corn flanking genomic DNA sequence (nucleotides 1-439 of SEQ ID NO:3), a 382-nucleotide pLP111 construct DNA sequence (nucleotides 440-821 of SEQ ID NO:3) and a 117-nucleotide 3'-end DNA sequence of the Nos terminator (nucleotides 822-938 of SEQ ID NO:3). The presence of the transgenic corn event LP111-2 can be identified by containing the SEQ ID NO:3 or its complementary sequence.

[0012] The nucleic acid molecule may be at least 11 or more consecutive polynucleotides of any part of the transgenic insertion sequence in SEQ ID NO: 4 or its complementary sequence (third nucleic acid sequence), or at least 11 or more consecutive nucleotides of any part of the 3' flanking maize genomic DNA region in SEQ ID NO: 4 or its complementary sequence (fourth nucleic acid sequence). The nucleic acid molecule may further be homologous to or complementary to the complete SEQ ID NO: 2.

[0013] A portion of SEQ ID NO: 4. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for producing an amplification product.

[0014] When the DNA primer pair generates an amplification product in the DNA amplification method that includes SEQ ID NO: 2, the presence of transgenic corn event LP111-2 or its progeny can be diagnosed. SEQ ID NO: 4 or its complementary sequence is a 952-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in transgenic corn event LP111-2, and the SEQ ID NO: 4 or its complementary sequence consists of a 53-nucleotide tNos (nopaline synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO: 4), a 196-nucleotide pLP111 construct DNA sequence (nucleotides 54-249 of SEQ ID NO: 4), and a 585-nucleotide maize integration site flanking genomic DNA sequence (nucleotides 250-952 of SEQ ID NO: 4). The presence of SEQ ID NO: 4 or its complementary sequence can be identified as the presence of transgenic corn event LP111-2.

[0015] The SEQ ID NO: 5 or its complementary sequence is a sequence of 21864 nucleotides in length that characterizes the transgenic corn event LP111-2, and the specific genome and genetic elements contained therein are shown in Table 1. The presence of the transgenic corn event LP111-2 can be identified by the presence of the SEQ ID NO: 5 or its complementary sequence.

[0016] Table 1 Genome and genetic elements contained in SEQ ID NO:5

[0017]

[0018] The nucleic acid molecule can be used in a DNA amplification method to produce an amplification product, and the presence of the transgenic corn event LP111-2 or its progeny in a biological sample can be diagnosed by detecting the amplification product; the nucleic acid molecule can be used in a nucleotide detection method to detect the presence of the transgenic corn event LP111-2 or its progeny in a biological sample.

[0019] The present invention provides a DNA primer pair, comprising a first primer and a second primer, when the first primer and the second primer are used together with DNA containing transgenic corn event LP111-2 for an amplification reaction, an amplicon of the transgenic corn event LP111-2 in a detection sample is generated;

[0020] The first primer is selected from SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 9 or SEQ ID NO: 13; or the first primer is selected from SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from SEQ ID NO: 11 or SEQ ID NO: 14;

[0021] The corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

[0022] In some embodiments of the present invention, the amplification product includes at least 11 consecutive nucleotides in SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO: 4 or its complementary sequence.

[0023] Furthermore, the amplification product includes consecutive nucleotides at positions 1-11 or positions 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or positions 12-22 in SEQ ID NO: 2 or its complementary sequence.

[0024] Furthermore, the amplification product includes SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, or SEQ ID NO: 7 or its complementary sequence.

[0025] The present invention also provides a DNA probe comprising a fragment of SEQ ID NO: 5 or its complementary sequence, wherein the DNA probe hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO: 1-5 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from SEQ ID NO: 1-5 or its complementary sequence under stringent hybridization conditions.

[0026] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0027] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0028] In some embodiments, the probe includes at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the probe includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO:2 or its complementary sequence.

[0029] The present invention also provides a marker nucleic acid molecule, which comprises a fragment of SEQ ID NO:5 or its complementary sequence, and the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO:1-5 or its complementary sequence under stringent hybridization conditions and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from SEQ ID NO:1-5 or its complementary sequence under stringent hybridization conditions.

[0030] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO: 1 or its complement, SEQ ID NO: 2 or its complement, SEQ ID NO: 6 or its complement, and SEQ ID NO: 7 or its complement.

[0031] In one embodiment, the marker nucleic acid molecule includes at least 11 consecutive nucleotides of SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides of SEQ ID NO: 4 or its complementary sequence;

[0032] In some embodiments, the marker nucleic acid molecule includes consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides 1-11 or 12-22 in SEQ ID NO: 2 or its complementary sequence.

[0033] Furthermore, the present invention provides a method for detecting the presence of DNA of transgenic corn event LP111-2 in a sample, comprising:

[0034] (1) contacting the sample to be tested with the DNA primer pair in a nucleic acid amplification reaction;

[0035] (2) performing a nucleic acid amplification reaction;

[0036] (3) detecting the presence of amplification products;

[0037] The amplified product includes a nucleic acid sequence of SEQ ID NO: 3-4 or a complementary sequence thereof, indicating that the test sample contains the DNA of the transgenic corn event LP111-2.

[0038] Furthermore, the present invention also provides a method for detecting the presence of DNA of the transgenic corn event LP111-2 in a sample, comprising:

[0039] (1) contacting the sample to be detected with the DNA probe and / or the marker nucleic acid molecule;

[0040] (2) hybridizing the sample to be detected with the probe and / or the marker nucleic acid molecule under stringent hybridization conditions;

[0041] (3) Detecting the hybridization between the sample to be detected and the probe and / or the marker nucleic acid molecule.

[0042] The stringent conditions may be hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0043] The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule.

[0044] The present invention also provides a DNA detection kit, comprising: a DNA primer pair that produces an amplicon for diagnosing transgenic corn event LP111-2, a probe specific to SEQ ID NO: 1-5, or a marker nucleic acid molecule specific to SEQ ID NO: 1-5. Specifically, the detection kit comprises the probe, primer pair, or marker nucleic acid molecule of the present invention.

[0045] Furthermore, the present invention provides a DNA detection kit, which includes the DNA primer pair.

[0046] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides in a homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in a homologous sequence of SEQ ID NO:4 or its complementary sequence, which can be used as a DNA primer or probe specific to transgenic corn event LP111-2 or its progeny.

[0047] Furthermore, the DNA molecule includes consecutive nucleotides at positions 1-11 or positions 12-22 in SEQ ID NO: 1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or positions 12-22 in SEQ ID NO: 2 or its complementary sequence.

[0048] Furthermore, the DNA molecule includes a homologous sequence of SEQ ID NO: 1 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 2 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 6 or a complementary sequence thereof, or a homologous sequence of SEQ ID NO: 7 or a complementary sequence thereof. To achieve the above object, the present invention also provides a plant cell, comprising a nucleic acid sequence encoding insect resistance Cry1Ab, Cry2Ab and Vip3Aa proteins, a nucleic acid sequence encoding glyphosate herbicide tolerance EPSPS protein and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region includes a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7.

[0049] The sequences provided by the present invention include the sequences listed in Table 2 below:

[0050] Table 2 Related sequences of the present invention

[0051]

[0052]

[0053]

[0054] The present invention also provides a method for protecting corn plants from insect attack, comprising providing transgenic corn plant cells containing transgenic corn event LP111-2 in the diet of target insects; target insects that feed on the transgenic corn plant cells are inhibited from further feeding on the corn plants, and corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO: P202430.

[0055] The present invention also provides a method for protecting corn plants from damage caused by glyphosate herbicides, comprising: planting transgenic corn plants containing transgenic corn event LP111-2, applying an effective dose of glyphosate herbicide, wherein the corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

[0056] The present invention also provides a method for controlling weeds in a field where corn plants are planted, comprising applying an effective dose of glyphosate herbicide to a field where transgenic corn plants are planted, wherein the transgenic corn plants comprise transgenic corn event LP111-2, and corn seeds comprising the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: P202430.

[0057] The present invention also provides a method for cultivating a corn plant that is resistant to insects and / or tolerant to glyphosate herbicides, comprising: planting corn seeds comprising transgenic corn event LP111-2;

[0058] allowing the corn seeds to grow and develop into corn plants;

[0059] The corn plants are attacked by target insects and / or sprayed with an effective dose of glyphosate herbicide, and plants with reduced plant damage are harvested compared to other plants that do not have the transgenic corn event LP111-2. Corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

[0060] In some embodiments, the present invention also provides a method for producing a corn plant resistant to insects, comprising introducing a transgenic corn event LP111-2 into the genome of the corn plant, and selecting a corn plant with reduced plant damage to insect feeding. In some embodiments, the method comprises: sexually crossing a first parent corn plant of a transgenic corn event LP111-2 resistant to insects with a second parent corn plant lacking insect resistance, thereby producing a plurality of progeny plants; infesting the progeny plants with a target insect; and selecting the progeny plants with reduced plant damage compared to other plants that do not have the transgenic corn event LP111-2.

[0061] In some embodiments, the present invention also provides a method for producing a corn plant tolerant to glyphosate herbicides, comprising introducing a transgenic corn event LP111-2 into the genome of the corn plant, and selecting a corn plant tolerant to glyphosate. In some embodiments, the method comprises: sexually hybridizing a first parent corn plant of a transgenic corn event LP111-2 tolerant to glyphosate herbicide with a second parent corn plant lacking glyphosate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with a glyphosate herbicide; and selecting the progeny plants tolerant to glyphosate.

[0062] In some embodiments, the present invention also provides a method for producing a corn plant that is resistant to insects and tolerates the application of glyphosate herbicides, comprising: introducing a transgenic corn event LP111-2 into the genome of the corn plant, and selecting corn plants that are tolerant to glyphosate and insect resistant. In some embodiments, the method comprises sexually crossing a first parent corn plant of a transgenic corn event LP111-2 that is glyphosate tolerant and insect resistant with a second parent corn plant that lacks glyphosate tolerance and / or insect resistance, thereby producing a plurality of progeny plants; treating the progeny plants with glyphosate; and selecting the progeny plants that are tolerant to glyphosate, wherein the progeny plants that are tolerant to glyphosate are also resistant to insect feeding damage.

[0063] The present invention also provides a composition produced from transgenic corn event LP111-2, the composition being corn flour, corn meal, corn oil, corn silk or corn starch. In some embodiments, the composition may be agricultural products or commodities such as corn flour, corn meal, corn oil, corn starch, corn gluten, corn tortillas, cosmetics or fillers. If sufficient expression levels are detected in the composition, the composition is expected to contain a nucleic acid sequence that can diagnose the presence of transgenic corn event LP111-2 material in the composition. Specifically, the composition includes but is not limited to corn oil, corn meal, corn meal, corn gluten, corn tortillas, corn starch, and any other food to be consumed as a food source for animals, or as an ingredient in a bulking agent or cosmetic composition for cosmetic purposes, etc.

[0064] The probe or primer pair-based detection method and / or kit of the present invention can be used to detect a transgenic corn event LP111-2 nucleic acid sequence such as shown in SEQ ID NO:1 or SEQ ID NO:2 in a biological sample, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 to diagnose the presence of transgenic corn event LP111-2.

[0065] In summary, the transgenic corn event LP111-2 of the present invention has the dual traits of insect resistance and herbicide resistance, and has the following advantages:

[0066] 1) To avoid economic losses caused by Lepidoptera pests (such as Asian corn borer, fall armyworm, oriental armyworm, fall armyworm, cotton bollworm, black cutworm and peach borer), which are the main pests in corn-growing areas.

[0067] 2) The ability to apply agricultural herbicides containing glyphosate to corn crops for broad spectrum weed control.

[0068] 3) Corn yield is not reduced. Specifically, the larvae used to detect the resistance level of target pests in the in vitro experiment of the present invention are second-instar larvae. The transgenic event LP111-2 of the present invention can make the mortality rate of second-instar pests as high as 100%, and the resistance to pests reaches a high level. Compared with the standard of using the first larvae to detect the insect resistance level in the same type of LP111 series applications, the vitality of the second-instar pests used in this application is greatly enhanced, and the second-instar stage is the larvae's overeating period, which greatly increases the degree of damage to plant leaves. Therefore, the insect resistance of this application is significantly improved, protecting plants from damage rates as low as 0%; high tolerance to glyphosate herbicides, can withstand 4 times the dose of glyphosate herbicides spraying, protecting plants from damage rates as low as 0%; and the agronomic traits of plants containing this event are excellent, and the yield percentage can be as high as 102%.

[0069] 4) The genes encoding insect resistance and glyphosate tolerance traits are linked on the same DNA segment and present at a single locus in the genome of transgenic maize event LP111-2, which provides enhanced breeding efficiency and enables the use of molecular markers to track transgenic insertion fragments in breeding populations and their progeny.

[0070] 5) The primer or probe sequence provided in the detection method of the present invention can produce an amplification product that is diagnosed as the transgenic corn event LP111-2 or its progeny, and can quickly, accurately and stably identify the presence of plant materials derived from the transgenic corn event LP111-2.

[0071] the term

[0072] The following definitions and methods can better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise specified, the terms are understood according to conventional usage by those skilled in the art.

[0073] The term "corn" refers to maize (Zea mays) and includes all plant varieties that can be crossed with maize, including wild maize species.

[0074] The term “comprising” means “including but not limited to.” The term “processed product” refers to a product obtained by processing raw materials such as plants and seeds, such as a composition.

[0075] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are therefore at least partially composed of transgenic cells.

[0076] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences before the coding sequence (5' non-coding sequences) and regulatory sequences after the coding sequence (3' non-coding sequences). "Native gene" refers to a gene found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a natural gene, which contains regulatory and coding sequences that are not found in nature. "Endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. "Foreign gene" is a foreign gene that is now present in the genome of an organism and did not exist originally, and also refers to a gene introduced into a recipient cell through a transgenic step. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. "Transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."

[0077] "Flanking DNA" can comprise the exogenous (heterologous) DNA naturally present in the genome of the organism of for example plant or introduced by the transformation process, for example the fragment relevant to the transformation event.Therefore, flanking DNA can comprise the combination of natural and exogenous DNA.In the present invention, "flanking region" or "flanking sequence" or "genome border region" or "genome border sequence" refers to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, which is located at the direct upstream or downstream of the initial exogenous insertion DNA molecule and adjacent to the initial exogenous insertion DNA molecule.When this flanking region is located at downstream, it can also be referred to as "left border flank" or "3' flank" or "3' genome border region" or "genome 3' border sequence" etc. When the flanking region is located upstream, it may also be referred to as the “right border flank” or the “5′ flank” or the “5′ genomic border region” or the “genomic 5′ border sequence” or the like.

[0078] Transformation procedures that cause random integration of foreign DNA can result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are usually not changed. Transformants will also contain a unique junction between a segment of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. "Joint" is the point where two specific DNA fragments connect. For example, the junction is present at the position where the insert DNA connects to the flanking DNA. Junction points are also present in transformed organisms, where two DNA fragments are connected together in a manner modified from natural organisms. "Joint DNA" refers to the DNA comprising a junction point.

[0079] The present invention provides a transgenic corn event called LP111-2 and its progeny, wherein the transgenic corn event LP111-2 is a corn plant LP111-2, which includes plants and seeds of the transgenic corn event LP111-2 and plant cells or their regenerable parts, and the plant parts of the transgenic corn event LP111-2 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the corn plant LP111-2, such as corn flour, corn meal, corn oil, corn steep liquor, corn silk, corn starch and biomass remaining in the corn crop field.

[0080] The transgenic corn event LP111-2 of the present invention comprises a DNA construct which, when expressed in plant cells, acquires resistance to insects and tolerance to glyphosate herbicide.

[0081] In some embodiments of the present invention, the DNA construct comprises four tandem expression cassettes, the first expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence of a Cry2Ab protein (Cry2Ab) of insect resistance of Bacillus thuringiensis, wherein the Cry2Ab protein has resistance to lepidopteran insects; the second expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence of a Vip3Aa protein (Vip3Aa) of insect resistance of Bacillus thuringiensis, wherein the Vip3Aa has resistance to lepidopteran insects; the third expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a nucleic acid sequence of a Vip3Aa protein (Vip3Aa) of insect resistance of Bacillus thuringiensis, wherein the Vip3Aa has resistance to lepidopteran insects; The invention relates to an expression cassette comprising a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably connected to the nucleic acid sequence of Cry1Fa protein, the nucleic acid sequence of which is mainly resistant to lepidopteran insects; the fourth expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably connected to the nucleic acid sequence of Cry1Ab protein, the nucleic acid sequence of which is mainly resistant to lepidopteran insects; the fifth expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably connected to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), the nucleic acid sequence of which is tolerant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from a plant, including a constitutive, inducible and / or tissue-specific promoter, and the suitable promoter includes, but is not limited to, a cauliflower mosaic virus (CaMV) 35S promoter, a figwort mosaic virus (FMV) 35S promoter, an ubiquitin promoter, an actin promoter, an Agrobacterium tumefaciens nopaline synthase (NOS) promoter, an octopine synthase (OCS) promoter, a Cestrum yellow leaf curl virus promoter, a potato tuber storage protein (Patatin) promoter, a ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, a glutathione S-transferase (GST) promoter, an E9 promoter, a GOS promoter, an alcA / alcR promoter, an Agrobacterium rhizogenes promoter, a rhizogenes) RolD promoter and Arabidopsis thaliana (Arabidopsis thaliana) Suc2 promoter.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, and the suitable polyadenylation signal sequence includes, but is not limited to, the polyadenylation signal sequence derived from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens, the polyadenylation signal sequence derived from the 35S terminator of cauliflower mosaic virus (CaMV), the polyadenylation signal sequence derived from the proteinase inhibitor II (PIN II) gene, and the polyadenylation signal sequence derived from the α-tubulin (α-tubulin) gene.

[0082] In addition, the expression cassette can also include other genetic elements, including but not limited to enhancers and signal peptide / transit peptide nucleic acid coding sequences. The enhancer can enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer and FMV35S enhancer. The signal peptide / transit peptide can guide the Cry1Ab protein and / or EPSPS protein to be transported to a specific organelle or compartment outside the cell or in the cell, for example, by targeting the chloroplast by encoding the chloroplast transit peptide sequence, or by targeting the endoplasmic reticulum by using the 'KDEL' retention sequence.

[0083] The Cry2Ab, Vip3Aa, Cry1Fa and Cry1Ab genes can be isolated from Bacillus thuringiensis (Bt for short), and the nucleic acid sequences of the Cry2Ab, Vip3Aa, Cry1Fa and Cry1Ab genes can be changed by optimizing codons or in other ways to achieve the purpose of increasing the stability and availability of transcripts in transformed cells.

[0084] In some embodiments of the present invention, a corn cell, seed or plant comprising the transgenic corn event LP111-2 comprises SEQ ID NO: 1, the nucleic acid sequence of positions 543-16657 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome, or comprises SEQ ID NO: 5.

[0085] The "Lepidoptera", scientifically known as Lepidoptera, includes two types of insects: moths and butterflies. It is the order with the most agricultural and forestry pests, such as the corn borer, cotton bollworm, oriental armyworm, fall armyworm, two-spotted armyworm, and peach borer.

[0086] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens sp. CP4 strain, and the polynucleotide encoding the EPSPS gene can be changed by optimizing codons or otherwise to increase the stability and availability of the transcript in the transformed cell. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selective marker gene.

[0087] The term "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with a "glyphosate herbicide" refers to treatment with any herbicide formulation containing glyphosate. The selection of a glyphosate formulation rate to achieve an effective biological dose is within the skill of an ordinary agronomist. Treatment of a field containing plant material derived from transgenic corn event LP111-2 with any herbicide formulation containing glyphosate will control weed growth in the field without affecting the growth or yield of the plant material derived from transgenic corn event LP111-2.

[0088] The DNA construct is introduced into the plant using a transformation method, including but not limited to Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.

[0089] The Agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissues, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

[0090] The gene gun transformation method is to bombard plant cells with vectors containing foreign DNA (particle-mediated biolistic transformation).

[0091] The pollen tube channel transformation method utilizes the natural pollen tube channel (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac through the nucellus channel.

[0092] Following transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny harboring the foreign DNA selected using appropriate markers.

[0093] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct is specifically can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and the restriction endonuclease sites contained are used for importing and provide functional gene element, i.e. promoter, intron, leader sequence, coding sequence, 3 ' terminator region and DNA molecule of other sequence.Expression cassette contained in the DNA construct comprises the necessary gene element of transcription that messenger RNA is provided, and described expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.Expression cassette of the present invention is designed to express in plant cell the most specifically.

[0094] Transgenic "events" are obtained by transforming plant cells with heterologous DNA constructs, i.e., comprising at least one nucleic acid expression cassette containing a target gene, inserted into the plant genome by transgenic methods to produce a plant population, regenerate the plant population, and select specific plants with the characteristics of insertion at a specific genomic site. The term "event" refers to the original transformant that includes the heterologous DNA and the offspring of the transformant. The term "event" also refers to the offspring obtained by sexually crossing between the transformant and individuals of other varieties containing heterologous DNA, even after repeated backcrossing with the recurrent parent, the inserted DNA and flanking genomic DNA from the transformant parent are present in the same chromosomal position in the hybrid offspring. The term "event" also refers to a DNA sequence from the original transformant, which contains the inserted DNA and the flanking genomic sequence closely adjacent to the inserted DNA, and the DNA sequence is expected to be transferred to the offspring, which is produced by sexually crossing the parental line containing the inserted DNA (e.g., the original transformant and the offspring produced by its self-pollination) with the parental line that does not contain the inserted DNA, and the offspring receives the inserted DNA containing the target gene.

[0095] As used herein, "recombinant" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced by human intervention. Such human intervention may produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two otherwise separate sequence segments, for example by chemical synthesis or by manipulation of separate nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

[0096] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is changed due to the presence of heterologous nucleic acid, including the transgenic body originally changed in this way and the progeny individuals generated by the initial transgenic body through sexual hybridization or asexual reproduction. In the present invention, the term "transgenic" does not include changes in the genome (chromosomal or extrachromosomal) by conventional plant breeding methods or naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

[0097] "Heterologous" in the present invention means that the first molecule is not normally found in nature in combination with the second molecule. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Such a molecule is thus heterologous to the host and is artificially introduced into the genome of the host cell.

[0098] The cultivation of a transgenic corn event LP111-2 that is resistant to lepidopteran insects and tolerant to glyphosate herbicides can be carried out through the following steps: first, a first parent corn plant is sexually hybridized with a second parent corn plant to produce a variety of first-generation offspring plants, wherein the first parent corn plant is composed of corn plants cultivated from the transgenic corn event LP111-2 and its offspring, and the transgenic corn event LP111-2 and its offspring are obtained by transforming with the expression box of the present invention that is resistant to lepidopteran insects and tolerant to glyphosate herbicides, and the second parent corn plant lacks resistance to lepidopteran insects and / or has tolerance to glyphosate herbicides; and then, the offspring plants that are resistant to lepidopteran insect invasion and / or tolerant to glyphosate herbicides are selected, and corn plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicides can be cultivated. These steps can further include backcrossing the lepidopteran insect resistant and / or glyphosate tolerant progeny plants to a second parent corn plant or a third parent corn plant, and then selecting the progeny by infestation with lepidopteran insects, application of glyphosate herbicide, or by identification of molecular markers associated with the trait (e.g., a DNA molecule comprising the junction sites identified at the 5' and 3' ends of the insertion sequence in the transgenic corn event LP111-2), thereby producing corn plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide.

[0099] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can result in offspring plants that are homozygous for both added exogenous genes. Backcrossing of parental plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual reproduction.

[0100] The term "probe" is an isolated nucleic acid molecule to which a conventional detectable label or reporter molecule may be bound, for example, a radioisotope, a ligand, a chemiluminescent agent or an enzyme. Such a probe is complementary to a strand of a target nucleic acid. In the present invention, the probe is complementary to a DNA strand from the genome of the transgenic corn event LP111-2, whether the genomic DNA is from the transgenic corn event LP111-2 or seed or from a plant or seed or extract of the transgenic corn event LP111-2. The probe of the present invention includes not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0101] The term "primer" is a separate nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forms a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pair of the present invention relates to its use in amplification of a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0102] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising the full length or fragments of SEQ ID NOs: 1-7 can be used as primers and probes for detecting corn event LP111-2 and can be easily designed by those skilled in the art using the sequences provided herein.

[0103] The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers of the present invention have complete DNA sequence identity with the continuous nucleic acids of the target sequence.

[0104] Primers and probes based on the flanking genomic DNA and insertion sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic corn event LP111-2 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises the transgenic insertion sequence and the flanking regions of the corn genome, and fragments of the DNA molecule can be used as primers or probes.

[0105] The nucleic acid probe and primer of the present invention hybridize with the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic corn event LP111-2 in a sample. Nucleic acid molecules or fragments thereof can be specifically hybridized with other nucleic acid molecules under certain circumstances. As used in the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules show complete complementarity, one of the nucleic acid molecules is said to be the "complement" of another nucleic acid molecule. As used in the present invention, when each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to show "complete complementarity". If two nucleic acid molecules can hybridize with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with sufficient stability so that they anneal and bind to each other under conventional "high stringency" conditions, the two nucleic acid molecules are said to have "complementarity". Deviations from complete complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0106] As used in the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with the complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions that promote DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC, 50°C for low stringency conditions to about 0.2×SSC, 50°C for high stringency conditions. In addition, the temperature conditions in the washing step can be increased from about 22°C at room temperature for low stringency conditions to about 65°C for high stringency conditions. Both the temperature conditions and the salt concentration can be changed, or one of them can be kept constant while the other variable is changed. Specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 or their complementary sequences, or any fragments of the above sequences under moderate stringency conditions, such as at about 2.0×SSC and about 65°C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 or their complementary sequences, or any fragments of the above sequences under highly stringent conditions. In the present invention, the preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragments of the above sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7 or its complementary sequence, or any fragment of the above sequence. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify the offspring of genetic crosses. The hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including but not limited to fluorescent labels, radioactive labels, antibody labels and chemiluminescent labels.

[0107] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, and primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0108] The term "specifically binds to (target sequence)" means that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

[0109] As used herein, "amplified DNA," "amplification product," or "amplicon" refers to a nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant is produced by sexual hybridization containing the transgenic corn event LP111-2 of the present invention, or whether a corn sample collected from a field contains the transgenic corn event LP111-2, or whether a corn extract, such as meal, flour, or oil, contains the transgenic corn event LP111-2, DNA extracted from a corn plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA of the transgenic corn event LP111-2. The primer pair includes a first primer derived from a flanking sequence adjacent to the inserted exogenous DNA insertion site in the plant genome, and a second primer derived from the inserted exogenous DNA. The amplicon has a certain length and sequence, and the sequence is also diagnostic for the transgenic corn event LP111-2. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.

[0110] Alternatively, the primer pairs can be derived from flanking genomic sequences on both sides of the inserted DNA to produce an amplicon comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from the plant genomic sequence can be located at a distance from the inserted DNA sequence, the range of which can be one nucleotide base pair to about 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in a DNA thermal amplification reaction.

[0111] Nucleic acid amplification reaction can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. The PCR amplification method has been developed to amplify 22kb of genomic DNA and 42kb of phage DNA. These methods and other DNA amplification methods in the art can be used for the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic corn event LP111-2 can be amplified by utilizing the provided primer sequence to amplify the genome of the transgenic corn event LP111-2, and after amplification, the PCR amplicon or cloned DNA is subjected to standard DNA sequencing.

[0112] A DNA detection kit based on a DNA amplification method may contain DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify diagnostic amplicons. The kit may provide a detection method based on agarose gel or many methods of detecting diagnostic amplicons known in the prior art. A kit containing DNA primers homologous or complementary to any portion of the corn genomic region of SEQ ID NO:3 or SEQ ID NO:4, and homologous or complementary to any portion of the transgenic insertion region of SEQ ID NO:5 is provided by the present invention. In particular, the primer pairs useful in the DNA amplification method are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicons homologous to a portion of the 5' transgenic / genomic region of the transgenic corn event LP111-2, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

[0113] The amplicons generated by these methods can be detected by a variety of techniques. One such method is GeneticBit Analysis, in which a DNA oligonucleotide strand is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide strand is immobilized in a microwell of a microplate, and after PCR amplification of the target region (using one primer each in the insert sequence and the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide strand and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained by fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, which indicates that the amplification, hybridization, and single-base extension reactions were successful.

[0114] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence), and then incubated with DNA polymerase, ATP, sulfhydryl enzyme, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the generated light signals are measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.

[0115] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) is also a method that can be used to detect the amplicon of the present invention. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTPs. Single-base extension will result in the insertion of ddNTPs. This insertion can be measured by a change in its polarization using a fluorimeter. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization and single-base extension reactions are successful.

[0116] Taqman is described as a method for detecting and quantifying the presence of a DNA sequence and is described in detail in the instructions provided by the manufacturer. As a brief example, a FRET oligonucleotide probe is designed that spans the insert DNA sequence and the adjacent genomic flanking binding site. The FRET probe and PCR primers (one primer each in the insert sequence and the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching portions of the FRET probe and the release of the fluorescent portion. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, which indicates that amplification and hybridization were successful.

[0117] Based on the principle of hybridization, suitable techniques for detecting plant materials derived from transgenic maize event LP111-2 can also include Southern blot hybridization, Northern blot hybridization and in situ hybridization. In particular, the suitable techniques include incubating probes and samples, washing to remove unbound probes and detecting whether the probes have hybridized. The detection method depends on the type of label attached to the probe, for example, radiolabeled probes can be detected by X-ray film exposure and development, or enzyme-labeled probes can be detected by color change through substrate conversion.

[0118] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) introduced the application of molecular markers in sequence detection. Briefly described below, a FRET oligonucleotide probe is designed that spans the insertion DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain the fluorescent part and the quenching part at a close distance. The FRET probe and PCR primers (one primer each is used in the insertion sequence and the adjacent flanking genomic sequence) are subjected to a cyclic reaction in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, the hybridization of the FRET probe and the target sequence results in the loss of the probe secondary structure, thereby separating the fluorescent part and the quenching part in space and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the insertion / flanking sequence, which indicates that the amplification and hybridization are successful.

[0119] Other described methods, such as microfluidics, provide methods and devices for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and can thus be detected are useful for detecting DNA molecules of the present invention.

[0120] DNA detection kits can be developed using the compositions of the present invention and methods described or known in the art of DNA detection. The kits are useful for identifying the presence of DNA of transgenic corn event LP111-2 in a sample, and can also be used to grow corn plants containing DNA of transgenic corn event LP111-2. The kits can contain DNA primers or probes that are homologous or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous or complementary to DNA contained in transgenic genetic elements of the DNA, and these DNA sequences can be used in DNA amplification reactions, or as probes in DNA hybridization methods.

[0121] Contained in the maize genome and inFigure 1 The DNA structure of the transgenic insertion sequence and the maize genome binding site illustrated in Table 1 comprises: the maize LP111-2 flanking genomic region located at the 5' end of the transgenic insertion sequence, a portion of the insertion sequence from the right border region (RB) of Agrobacterium tumefaciens, the first expression cassette consisting of the Scrophulariaceae mosaic virus 35s promoter (pFMV), operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP70), operably linked to the maize chloroplast transit peptide (ZmCTP), and operably linked to the insect resistance Cry2A of Bacillus thuringiensis. b protein (Cry2Ab), operably linked to the transcription terminator of nopaline synthase (Nos); the second expression cassette consists of tandem repeats of the maize ubiquitin gene promoter Ubi (pZmUbi) in the enhancer region, operably linked to the insect resistance gene Vip3Aa (Vip3Aa193) of Bacillus thuringiensis, operably linked to the ninth intron of the maize phosphoenolpyruvate carboxykinase gene (iPEEC), and operably linked to the cauliflower mosaic virus 35S terminator (35s); the third expression cassette consists of tandem repeats of the maize ubiquitin gene promoter Ubi (pZmUbi) in the enhancer region, operably linked to the insect resistance gene Vip3Aa (Vip3Aa193) of Bacillus thuringiensis, operably linked to the ninth intron of the maize phosphoenolpyruvate carboxykinase gene (iPEEC), and operably linked to the cauliflower mosaic virus 35S terminator (35s). The rice ubiquitin gene promoter Ubi (pZmUbi) is operably linked to the insect resistance Cry1Fa protein (Cry1Fa) of Bacillus thuringiensis and is operably linked to the terminator ORF25PolyA from Agrobacterium tumefaciens pTi15955; the fourth expression cassette is composed of the cauliflower mosaic virus 35S promoter (p35S), which is operably linked to the 5'-end non-translated leading chain sequence (WtCab) of wheat chloroplast a / b binding protein, which is operably linked to the rice actin gene 1 intron (iOsAct1), which is operably linked to The fifth expression cassette is composed of a rice actin 1 promoter (pOsAct1), operably linked to the Arabidopsis EPSPS chloroplast transit peptide (AtCTP2), operably linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of the Agrobacterium CP4 strain, and operably linked to the transcription terminator (Nos) of nopaline synthase. A portion of the insertion sequence from the left border region (LB) of Agrobacterium, and the maize plant LP111-2 flanking genomic region (SEQ ID NO: 5) located at the 3' end of the transgenic insertion sequence. In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence derived from the transgenic corn event LP111-2, or any part of the DNA region flanking the corn genome in the transgenic corn event LP111-2.

[0122] The transgenic corn event LP111-2 can be combined with other transgenic corn varieties, such as corn with tolerance to herbicides (such as glufosinate, dicamba, etc.), or transgenic corn varieties carrying other insect-resistant genes (such as beetles, grubs, two-spotted firefly leaf beetles, etc.). All of these various combinations of different transgenic events, bred together with the transgenic corn event LP111-2 of the present invention, can provide improved hybrid transgenic corn varieties that are resistant to multiple insect pests and multiple herbicides. These varieties can show more excellent characteristics such as yield improvement compared to non-transgenic varieties and single-trait transgenic varieties.

[0123] The present invention provides a transgenic corn event LP111-2, a nucleic acid sequence for detecting corn plants containing the event and a detection method thereof, wherein the transgenic corn event LP111-2 is resistant to feeding damage by lepidopteran pests and tolerates the phytotoxic effects of agricultural herbicides containing glyphosate. The dual-trait corn plant expresses Cry2Ab, Cry1Ab, Cry1Fa and Vip3Aa and proteins of Bacillus thuringiensis, which provide resistance to feeding damage by lepidopteran pests (such as Asian corn borer and fall armyworm); and expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium strain CP4, which confers tolerance to glyphosate on the plant. Dual-trait corn has the following advantages: 1) protection from economic losses caused by lepidopteran pests (such as Asian corn borer, fall armyworm, oriental armyworm, fall armyworm, cotton bollworm, cutworm and peach borer, etc.), which are major pests in corn-growing areas; 2) the ability to apply agricultural herbicides containing glyphosate to corn crops for broad-spectrum weed control; 3) no reduction in corn yield. Specifically, the event LP111-2 of the present invention has a high level of resistance to insects, which can cause pest mortality as high as 100%, protect plants from damage as low as 0%; has high tolerance to glyphosate herbicides, can protect plants from damage as low as 0%; and plants containing the event have excellent agronomic traits, and the yield percentage can be as high as 100%. In addition, the genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and exist on a single locus in the genome of the transgenic corn event LP111-2, which provides enhanced breeding efficiency and enables the use of molecular markers to track transgenic insertion fragments in breeding populations and their progeny. At the same time, the primer or probe sequence provided in the detection method of the present invention can produce an amplification product that is diagnosed as the transgenic corn event LP111-2 or its progeny, and can quickly, accurately and stably identify the presence of plant materials derived from the transgenic corn event LP111-2. BRIEF DESCRIPTION OF THE DRAWINGS

[0124] Figure 1 The present invention is a schematic diagram of the structure of the transgenic insertion sequence and the corn genome binding site for detecting the nucleic acid sequence of the corn plant LP111-2 and the detection method thereof.

[0125] Figure 2 It is a schematic diagram of the structure of the recombinant expression vector pLP111 used for detecting the nucleic acid sequence of corn plant LP111-2 and the detection method thereof of the present invention.

[0126] Figure 3 The present invention shows the in vitro resistance effect of the transgenic corn containing the transgenic corn event LP111-2 to second-instar lepidopteran pests.

[0127] Figure 4 This is a diagram showing the effect of artificial inoculation of the transgenic corn containing the transgenic corn event LP111-2 of the present invention with second-instar corn borers in the field.

[0128] Figure 5 This is a diagram showing the effect of artificial inoculation of the transgenic corn containing the transgenic corn event LP111-2 of the present invention with second-instar cotton bollworms in the field.

[0129] Figure 6 This is a diagram showing the effect of artificial inoculation of the transgenic corn containing the transgenic corn event LP111-2 of the present invention with second-instar peach borer in the field.

[0130] Figure 7 This is a field effect diagram of the transgenic corn containing the transgenic corn event LP111-2 of the present invention when sprayed with 8 times the recommended spraying concentration of glyphosate herbicide in the field. DETAILED DESCRIPTION

[0131] The present invention is further described in detail by way of examples below. Through these exemplary descriptions, the features and advantages of the present invention will become more clear and distinct.

[0132] The professional word “exemplary” used herein means “serving as an example, example, or illustration.” Any embodiment described herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments.

[0133] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0134] The technical scheme of the present invention for detecting the nucleic acid sequence of corn plant LP111-2 and the detection method thereof is further illustrated by specific examples below.

[0135] Example 1: Cloning and transformation

[0136] 1.1. Vector cloning

[0137] The recombinant expression vector pLP111 (such as Figure 2 The vector pLP111 comprises five tandem transgenic expression cassettes, a flanking genomic region of maize LP111-2 located at the 5' end of the transgenic insertion sequence, a portion of the insertion sequence from the right border region (RB) of Agrobacterium tumefaciens, the first expression cassette is composed of the 35s promoter of the figwort mosaic virus (pFMV), operably linked to the intron of the maize heat shock protein gene HSP70 protein (iZmHSP70), operably linked to the maize chloroplast transit peptide (ZmCTP), operably linked to the insect resistance Cry2Ab protein (Cry2Ab) of Bacillus thuringiensis 2Ab), operably linked to the transcription terminator of nopaline synthase (Nos); the second expression cassette consists of tandem repeats of the maize ubiquitin gene promoter Ubi (pZmUbi) in the enhancer region, operably linked to the insect resistance gene Vip3Aa (Vip3Aa193) of Bacillus thuringiensis, operably linked to the 9th intron of the maize phosphoenolpyruvate carboxykinase gene (iPEEC), and operably linked to the cauliflower mosaic virus 35S terminator (35s); the third expression cassette consists of tandem repeats of the maize ubiquitin gene in the enhancer region The fourth expression cassette consists of the cauliflower mosaic virus 35S promoter (p35S), operably linked to the 5' non-translated leader sequence of the wheat chloroplast a / b binding protein (WtCab), operably linked to the rice actin gene 1 intron (iOsAct1), and operably linked to the su The fifth expression cassette is composed of the rice actin 1 promoter (pOsAct1), operably linked to the Arabidopsis EPSPS chloroplast transit peptide (AtCTP2), operably linked to the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of the Agrobacterium CP4 strain, and operably linked to the transcription terminator (Nos) of nopaline synthase. The vector pLP111 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformed cells are screened with 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.

[0138] 1.2 Plant transformation

[0139] Conventional Agrobacterium infection method was used for transformation. The sterile cultured maize embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pLP111 into the maize chromosome to produce transgenic maize event LP111-2.

[0140] For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequences of cry2Ab, cry1Ab, vip3Aa, cry1Fa genes and the nucleic acid sequence of the epsps gene to at least one cell of one of the embryos (step 1: infection step), in which the embryos are specifically immersed in the Agrobacterium suspension (OD660=0.4-0.6, infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation. . The immature embryos are co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Specifically, the immature embryos are cultured on a solid culture medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) after the infection step. After this co-cultivation stage, there can be an optional "recovery" step. In the "recovery" step, the culture medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium, and no selective agent for plant transformants is added (step 3: recovery step). Specifically, the immature embryos are cultured on a solid medium with an antibiotic but without a selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selective agent (N-(phosphonomethyl)glycine) and growing transformed callus is selected (step 4: selection step). Specifically, the immature embryos are cultured on a screening solid medium with a selective agent (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) to selectively grow the transformed cells. Then, the callus tissue is regenerated into plants (step 5: regeneration step), specifically, the callus tissue grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0141] The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salt 4.3g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, 6-benzyladenine 2mg / L, N-(phosphonomethyl)glycine 0.125mol / L, phytagel 3g / L, pH=5.8), and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, indole-3-acetic acid 1mg / L, agar 8g / L, pH=5.8), cultured at 25°C to a height of about 10cm, and moved to a greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 28°C for 16 hours and at 20°C for 8 hours every day.

[0142] 1.3 Identification and screening of transgenic events

[0143] A total of 1500 independent transgenic T0 plants were generated.

[0144] Example 2: Detection of transgenic maize event LP111-2 using TaqMan

[0145] About 100 mg of leaves of transgenic corn event LP111-2 were taken as samples, and the genomic DNA was extracted using Qiagen's DNeasyPlantMaxi Kit. The copy numbers of cry2Ab, vip3Aa, cry1Ab, cry1Fa and epsps were detected by Taqman probe fluorescence quantitative PCR. At the same time, wild-type corn plants were used as controls and the detection and analysis were performed according to the above method. The experiment was repeated 3 times and the average value was taken.

[0146] The specific method is as follows:

[0147] Step 11, taking 100 mg of leaves of the transgenic corn event LP111-2, grinding them into a homogenate in a mortar with liquid nitrogen, and taking 3 replicates for each sample;

[0148] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to its product manual;

[0149] Step 13, using NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above sample;

[0150] Step 14, adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0151] Step 15: Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the sample with known copy number as the standard, use the sample of wild-type corn plant as the control, and repeat 3 times for each sample to take the average value; the sequences of fluorescence quantitative PCR primers and probes are:

[0152] The following primers and probes were used to detect the cry2Ab gene sequence:

[0153] Primer 1: GGACAGAGGCACCGCATT as shown in SEQ ID NO: 16 in the sequence listing;

[0154] Primer 2: CGGGTCTGCAAGCAAACG as shown in SEQ ID NO: 17 in the sequence listing;

[0155] Probe 1: TCCACTTGGCGGTTGAACTCCTCC as shown in SEQ ID NO: 18 in the sequence listing;

[0156] The following primers and probes were used to detect the vip3Aa gene sequence:

[0157] Primer 3: CACCTTCTTCTTGTTCAG as shown in SEQ ID NO: 19 in the sequence listing;

[0158] Primer 4: CACCAAGAAGATGAAGAC as shown in SEQ ID NO: 20 in the sequence listing;

[0159] Probe 2: TGACCGCCAACTTCTACGACA as shown in SEQ ID NO: 21 in the sequence listing;

[0160] The following primers and probes were used to detect the cry1Fa gene sequence:

[0161] Primer 5: GCTATGTCCAGTCCCCAACCT as shown in SEQ ID NO: 22 in the sequence listing;

[0162] Primer 6: CAAGCTGCTAACCTGCACTTGT as shown in SEQ ID NO: 23 in the sequence listing;

[0163] Probe 3: CCCAAACGACACAGCGTCGCG as shown in SEQ ID NO: 24 in the sequence listing;

[0164] The following primers and probes were used to detect the Cry1Ab gene sequence:

[0165] Primer 7: TGGGAGGACGGAATGATATTG as shown in SEQ ID NO: 25 in the sequence listing;

[0166] Primer 8: AACTCGTCCGTGAGCATCATC as shown in SEQ ID NO: 26 in the sequence listing;

[0167] Probe 4: AACTCCGCGCTGCGATGAATCC as shown in SEQ ID NO: 27 in the sequence listing;

[0168] The following primers and probes were used to detect the epsps gene sequence:

[0169] Primer 9: GCAAATCCTCTGGCCTTTCC as shown in SEQ ID NO: 28 in the sequence listing;

[0170] Primer 10: TGAAGGACCGGTGGGAGAT as shown in SEQ ID NO: 29 in the sequence listing;

[0171] Probe 5: CGTCCGCATTCCCGGCGA as shown in SEQ ID NO: 30 in the sequence list; PCR reaction system is

[0172]

[0173] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in an amber tube at 4°C.

[0174] The PCR reaction conditions were

[0175]

[0176] The data were analyzed using SDS2.3 software (Applied Biosystems) to obtain a single-copy transgenic maize event LP111-2.

[0177] Example 3: Detection of transgenic corn event LP111-2

[0178] 3.1 Genomic DNA Extraction

[0179] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic maize event LP111-2 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid)], adjust pH to 8.0 with NaOH, mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 1 volume of isopropanol, gently shake the centrifuge tube, and let it stand at -20°C for 30 minutes; centrifuge at 12000rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 0.5mL of 70% ethanol by volume; centrifuge at 12000rpm for 5 minutes; vacuum dry or blow dry on a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.

[0180] 3.2 Analysis of flanking DNA sequences

[0181] The concentration of the DNA sample extracted above was measured so that the concentration of the sample to be tested was between 80-100 ng / μL. The genomic DNA was digested with the selected restriction endonucleases SpeI, PstI, BssHII (5' end analysis) and SacI, KpnI, XmaI, NheI (3' end analysis). 26.5 μL genomic DNA, 0.5 μL of the restriction endonuclease selected above and 3 μL of digestion buffer were added to each digestion system, and digested for 1 hour at an appropriate temperature. After the digestion was completed, 70 μL of anhydrous ethanol was added to the digestion system, ice bathed for 30 minutes, centrifuged at 12000 rpm for 7 minutes, the supernatant was discarded, dried, and then 8.5 μL of double distilled water (ddH2O), 1 μL of 10X T4 Buffer and 0.5 μL of T4 ligase were added to connect overnight at a temperature of 4°C. PCR amplification was performed to separate 5' and 3' transgenic / genomic DNA using a series of nested primers. Specifically, the primer combination for separating 5' transgenic / genomic DNA includes SEQ ID NO: 13 and SEQ ID NO: 38 as the first primer, SEQ ID NO: 39 and SEQ ID NO: 40 as the second primer, and SEQ ID NO: 13 as the sequencing primer. The primer combination for separating 3' transgenic / genomic DNA includes SEQ ID NO: 15 and SEQ ID NO: 41 as the first primer, SEQ ID NO: 42 and SEQ ID NO: 43 as the second primer, and SEQ ID NO: 15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0182] The obtained amplicons were electrophoresed on 2.0% agarose gel to separate the PCR reactants, and then the target fragments were isolated from the agarose matrix using the QIAquickGel extraction kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0183] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 8 or SEQ ID NO: 12, in combination with SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 38. The 3' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 11 or SEQ ID NO: 14, in combination with SEQ ID NO: 10, SEQ ID NO: 15, or SEQ ID NO: 41. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. Those skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking sequence and junction sequence.

[0184] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of corn plants or seeds derived from transgenic corn event LP111-2.

[0185] The maize genomic sequence is found to flank the right border of the insertion sequence of the transgenic maize event LP111-2 at nucleotides 1-439 of SEQ ID NO: 5 (5' flanking sequence), and the maize genomic sequence is found to flank the left border of the insertion sequence of the transgenic maize event LP111-2 at nucleotides 21162-21864 of SEQ ID NO: 5 (3' flanking sequence). The 5' junction sequence is listed in SEQ ID NO: 1, and the 3' junction sequence is listed in SEQ ID NO: 2.

[0186] 3.3. PCR zygosity assay

[0187] The junction sequence is a relatively short polynucleotide molecule that is a new DNA sequence that is diagnostic for the DNA of the transgenic corn event LP111-2 when detected in a polynucleic acid detection assay. The binding sequence of SEQ ID NO:1 consists of 11 bp on each side of the T-DNARB region insertion site and the corn genomic DNA insertion site of the transgenic corn event LP111-2, and the binding sequence of SEQ ID NO:2 consists of 11 bp on each side of the T-DNALB region insertion site and the corn genomic DNA insertion site of the transgenic corn event LP111-2. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The junction sequence (5' junction region SEQ ID NO:1, and 3' junction region SEQ ID NO:2) is useful as a DNA probe or as a DNA primer molecule in a DNA detection method. The junction sequences SEQ ID NO:6 and SEQ ID NO:7 are also new DNA sequences in the transgenic corn event LP111-2, which can also be used as a DNA probe or as a DNA primer molecule to detect the presence of the transgenic corn event LP111-2 DNA. The SEQ ID NO:6 (nucleotides 440-938 of SEQ ID NO:3) spans the LP111 construct DNA sequence and the tNos transcription termination sequence, and the SEQ ID NO:7 (nucleotides 1-249 of SEQ ID NO:4) spans the tNos transcription termination sequence and the LP111 construct DNA sequence.

[0188] Additionally, an amplicon was generated by using primers from at least one of SEQ ID NO:3 or SEQ ID NO:4 that, when used in a PCR method, produced an amplicon diagnostic for transgenic maize event LP111-2.

[0189] Specifically, a PCR product was generated from the 5' end of the transgenic insertion sequence, which was a portion of the genomic DNA flanking the 5' end of the T-DNA insertion sequence in the genome of the plant material derived from the transgenic corn event LP111-2. This PCR product contained SEQ ID NO: 3. For PCR amplification, primer 13 (SEQ ID NO: 8) was designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 14 (SEQ ID NO: 9) was paired with it and located at the transgenic tNos transcription termination sequence.

[0190] A PCR product was generated from the 3' end of the transgenic insertion sequence, which PCR product contained a portion of the genomic DNA flanking the 3' end of the T-DNA insertion sequence in the genome of the plant material from the transgenic corn event LP111-2. This PCR product contained SEQ ID NO: 4. For PCR amplification, primer 16 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insertion sequence, and primer 15 (SEQ ID NO: 10) was paired with the tNos transcription termination sequence located at the 3' end of the insert.

[0191] The DNA amplification conditions described in Tables 3 and 4 can be used in the above-mentioned PCR zygosity test to generate diagnostic amplicons for transgenic corn event LP111-2. Detection of the amplicons can be performed by using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradient thermal cycler, etc., as shown in Table 3, or by methods and equipment known to those skilled in the art.

[0192] Table 3 PCR steps and reaction mixture conditions used for identification of the 5' transgenic insert / genomic junction region of transgenic maize event LP111-2

[0193]

[0194]

[0195] Table 4 Perkin-Elmer 9700 thermal cycler conditions

[0196]

[0197] Mix gently and add 1-2 drops of mineral oil over each reaction if the thermal cycler does not have a thermal cap. Use the following cycling parameters (Table 3)

[0198] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0199] The experimental results show that: primers 13 and 14 (SEQ ID NOs: 8 and 9), when used in the PCR reaction of the genomic DNA of the transgenic corn event LP111-2, produce an amplification product of a 938bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-LP111-2 corn genomic DNA, no fragment is amplified; primers 15 and 16 (SEQ ID NOs: 10 and 11), when used in the PCR reaction of the genomic DNA of the transgenic corn event LP111-2, produce an amplification product of a 952bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-LP111-2 corn genomic DNA, no fragment is amplified.

[0200] PCR zygosity assays can also be used to identify whether material from transgenic corn event LP111-2 is homozygous or heterozygous. Primer 17 (SEQ ID NO: 12), primer 18 (SEQ ID NO: 13) and primer 19 (SEQ ID NO: 14), or primer 18 (SEQ ID NO: 13), primer 19 (SEQ ID NO: 14) and primer 20 (SEQ ID NO: 15) are used in an amplification reaction to generate a diagnostic amplicon for transgenic corn event LP111-2. The DNA amplification conditions described in Tables 5 and 6 can be used in the above zygosity assay to generate a diagnostic amplicon for transgenic corn event LP111-2.

[0201] Table 5: Zygosity assay reaction solution

[0202]

[0203]

[0204] Table 6 Zygosity determination Perkin-Elmer 9700 thermal cycler conditions

[0205]

[0206] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the following cycling parameters (Table 5). The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0207] In the amplification reaction, the biological sample containing the template DNA contains DNA that is diagnostic for the presence of transgenic corn event LP111-2 in the sample. Alternatively, the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from a corn genome, and the DNA derived from the corn genome is heterozygous for the allele corresponding to the inserted DNA present in the transgenic corn event LP111-2. The two different amplicons will correspond to a first amplicon derived from a wild-type corn genomic locus and a second amplicon that is diagnostic for the presence of transgenic corn event LP111-2 DNA. A corn DNA sample that only produces a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnosed to determine the presence of transgenic corn event LP111-2 in the sample, and the sample is produced by corn seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic corn plant LP111-2.

[0208] It should be noted that the primer pairs of the transgenic corn event LP111-2 are used to generate amplicons that are diagnostic for the genomic DNA of the transgenic corn event LP111-2. These primer pairs include, but are not limited to, primers 13 and 14 (SEQ ID NOs: 8 and 9), and primers 15 and 16 (SEQ ID NOs: 10 and 11), which are used in the DNA amplification method. In addition, a control primer 11 and 12 (SEQ ID NOs: 31 and SEQ ID NOs: 32) for amplifying endogenous genes in corn are included as an internal standard for reaction conditions. Analysis of the DNA extract samples of the transgenic corn event LP111-2 should include a positive tissue DNA extract control of the transgenic corn event LP111-2, a negative DNA extract control from a non-transgenic corn event LP111-2, and a negative control of a corn DNA extract that does not contain a template. In addition to these primer pairs, any primer pairs from SEQ ID NO: 3 or SEQ ID NO: 4, or their complementary sequences, can also be used, which, when used in a DNA amplification reaction, respectively generate amplicons for the transgenic event corn plant.

[0209] Tissues of LP111-2 are diagnostic for an amplicon comprising SEQ ID NO: 1 or SEQ ID NO: 2. The DNA amplification conditions described in Tables 2-5 can be used to generate diagnostic amplicons for transgenic corn event LP111-2 using appropriate primer pairs. Extracts of corn plants or seeds presumed to contain DNA comprising transgenic corn event LP111-2, or products derived from transgenic corn event LP111-2, that produce an amplicon diagnostic for transgenic corn event LP111-2 when tested in a DNA amplification method can be used as templates for amplification to determine the presence or absence of transgenic corn event LP111-2.

[0210] Example 4: Detection of transgenic maize event LP111-2 by Southern blot hybridization 4.1. DNA extraction for Southern blot hybridization

[0211] Southern blot analysis was performed using homozygous transformation events of the T4 and T5 generations. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone) and centrifuged at 4000 rpm for 10 minutes (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH = 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37° C. for 30 minutes. During the incubation period, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently by inversion, and centrifuge at 4000rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000rpm for 5 minutes to precipitate DNA after adding 0.54 volume of isopropanol. Discard the supernatant and resuspend the DNA precipitate in 500μL TE. In order to degrade any RNA present, at 37°C, DNA and 1μL 30mg / mL RNAaseA were incubated for 30 minutes, centrifuged at 4000rpm for 5 minutes, and precipitated DNA by centrifugation at 14000rpm for 10 minutes in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume of isopropanol. After discarding the supernatant, wash the precipitate with 500μL of ethanol with a mass fraction of 70%, and resuspend it in 100μL TE after drying.

[0212] 4.2 Restriction enzyme digestion

[0213] Utilize spectrophotometer or fluorometer to quantitatively detect DNA concentration (utilizing 1×TAE and GelRED dye).In 100 μ L reaction system, digest 5 μ g DNA each time.Use restriction enzyme MfeI and HindIII to digest genomic DNA respectively, with partial sequence of Vip3Aa, Cry1Ab and EPSPS on T-DNA as probe, use restriction enzyme AvrII and HindIII to digest genomic DNA respectively, with partial sequence of Cry2Ab on T-DNA as probe, use restriction enzyme SnaBI and HindIII to digest genomic DNA respectively, with partial sequence of Cry1Fa on T-DNA as probe.For each enzyme, incubate digestion overnight at appropriate temperature.Use vacuum centrifugal evaporation concentrator (speed vacuum) to rotate sample to reduce volume to 30 μ L.

[0214] 4.3 Gel electrophoresis

[0215] Bromophenol blue loading dye was added to each sample from Example 4.2 and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.

[0216] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. In 0.4MNaOH, pre-wet 1 thin blotting paper and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4MNaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on the top of the gel, and the buffer tray is filled with 0.4MNaOH. Connect the gel stack and the buffer tray with a wick pre-soaked in 0.4M NaOH, and transfer the DNA to the membrane. Perform DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.

[0217] 4.4 Hybridization

[0218] A suitable DNA sequence was amplified by PCR for probe preparation. The DNA probe was SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37, or partially homologous or complementary to the above sequences. 25 ng of probe DNA was boiled in 45 μL TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After adding 5 μl 32P-labeled dCTP to the Rediprime tube, the probe was incubated at 37°C for 15 minutes. According to the manufacturer's instructions, the probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) to remove unincorporated dNTPs. The probe activity was measured using a scintillation counter. Prehybridize the Hybond membrane by wetting it with 20 mL of pre-warmed Church prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 minutes. Boil the labeled probe for 5 minutes and place on ice for 10 minutes. Add an appropriate amount of probe to the prehybridization buffer (1 million counts per 1 mL of prehybridization buffer) and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 mL of Church wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 mL of Church wash solution 1 at 65°C for 20 minutes. Repeat this process twice with Church wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect the location of probe binding.

[0219] Two control samples were included on each Southern run: (1) DNA from a negative (untransformed) segregant to identify any endogenous maize sequences that hybridized to the element-specific probe; and (2) DNA from a positive segregant into which HindIII-digested pLP111 was introduced in an amount equivalent to one copy number based on the probe length to illustrate the sensitivity of the assay in detecting a single gene copy within the maize genome.

[0220] Hybridization data provide conclusive evidence supporting TaqMan TMPCR analysis showed that the maize plant LP111-2 contained a single copy of the Cry2Ab, Cry1Ab, Vip3Aa, Cry1Fa and EPSPS genes. Using the Cry1Ab probe, MfeI and HindIII digestions produced single bands of approximately 8.502 kb and 20.837 kb, respectively; using the Cry2Ab probe, AvrII and HindIII digestions produced single bands of approximately 14.782 kb and 5.723 kb, respectively; using the Vip3Aa probe, MfeI and HindIII digestions produced single bands of approximately 13.775 kb and 20.837 kb, respectively; using the Cry1Fa probe, SnaBI and HindIII digestions produced single bands of approximately 15.079 kb and 20.837 kb, respectively; using the EPSPS probe, MfeI and HindIII digestions produced single bands of approximately 8.502 kb and 20.837 kb, respectively. This indicated that one copy each of Cry1Ab, Cry2Ab, Vip3Aa, Cry1Fa and EPSPS was present in the maize transformation event LP111-2.

[0221] Example 5: Insect resistance detection

[0222] 5.1. Bioassay of maize plant LP111-2

[0223] Ten plants of transgenic corn events LP111-2, LP007-1 to LP007-8 (see the applicant's prior series of applications "Transgenic corn event LP007-1 and its detection method", "Transgenic corn event LP007-2 and its detection method", "Transgenic corn event LP007-3 and its detection method", "Transgenic corn event LP007-4 and its detection method", "Transgenic corn event LP007-5 and its detection method", "Transgenic corn event LP007-6 and its detection method", "Transgenic corn event LP007-7 and its detection method", "Transgenic corn event LP007-8 and its detection method", in which the insect resistance detection was all targeted at first-stage pests. As is known to all, the harm of first-stage pests is far less than that of second-stage pests, and the difficulty of killing first-stage pests is also far less than that of second-stage pests) and wild-type corn plants (non-transgenic, transformed receptor control (CK)) were respectively tested against second-stage Asian corn borer (Ostriniafurnacalis), peach borer (Connatrix persicae) and groundnut borer (Bornetus oleraceus).

[0224] Bioassays were conducted for Conogethes punctiferalis, Helicoverpaarmigera, Spodoptera frugiperda, Athetis lepigone, Mythimnaseperata, Agrotis ipsilon, and Spodoptera exigua according to the following method:

[0225] Fresh leaves (V3-V4 period) of the above 10 plants were taken respectively, rinsed with sterile water and dried with gauze, then the veins of corn leaves were removed and cut into strips of about 1 cm × 3 cm, 1-3 pieces (the number of leaves was determined according to the insect's food intake) were taken and placed on the filter paper at the bottom of the round plastic culture dish, the filter paper was moistened with distilled water, 10 artificially reared second-instar larvae in the gluttonous stage were placed in each culture dish, the insect test culture dish was covered, and placed under the conditions of temperature 26-28°C, relative humidity 70%-80%, and photoperiod (light / dark) 16:8 for 5 days, and the results were counted. The mortality rate was counted, and the resistance level was identified by correcting the mortality rate, corrected mortality rate (%) = (1-survival number / infection number-wild type control mortality rate) / (1-wild type control mortality rate) × 100%, the resistance results of the second-instar pests are shown in Table 7, and the in vitro resistance effect is shown in Figure 3 .

[0226] Table 7 Bioassay results of transgenic corn events against second instar insects - mortality (%)

[0227]

[0228] 5.2 Field effects of transgenic maize event LP111-2

[0229] (1) Corn borer

[0230] The insect-resistant and herbicide-tolerant corn LP111-2 was verified for its resistance to the main target pest, the Asian corn borer, in the field. Second-instar larvae were inoculated during the 4-6 leaf stage and the silking stage (the female ear was 3-5 cm silking), and the inoculation was conducted twice, 50 heads each time, with an interval of one week between the two times. 14 days after inoculation at the heart leaf stage, the feeding of the middle and upper leaves of the corn plants by the Asian corn borer was investigated plant by plant, and the level of leaf feeding by the Asian corn borer was recorded. After inoculation at the silking stage, the degree of damage to the female ears and the damage to the plants were measured before harvest, including the damaged length of the corn female ears, the number of boreholes, the length of the borer tunnels, the age of the surviving larvae, and the number of survivors. The evaluation was conducted using the "Heart Leaf Damage Level Grading Standard" as an indicator, and the results are shown in the results. Figure 4 , Table 12. The ears were dissected during the silking period, and the statistical results are shown in Figure 13.

[0231] Table 8 Grading standards for the degree of damage caused by Asian corn borer to corn heart leaves

[0232] Leaf-eating level Symptom description 1 The leaves are not damaged, or only have needle-like (≤1mm) insect holes on the leaves 2 Only a few bullet-sized (≤5mm) insect holes are found on individual leaves. 3 A few leaves have bullet-sized (≤5mm) insect holes 4 Notches on individual leaves (≤10mm) 5 A few leaves have notches (≤10mm) 6 Some leaves have notches (≤10mm) 7 Some leaves are partially eaten, and a few have large notches (≤10 mm) 8 A few leaves were eaten, and some leaves had large notches (≤10 mm) 9 Most of the leaves are eaten

[0233] Table 9 Evaluation criteria for corn resistance to Asian corn borer

[0234] Average leaf edible level at heart leaf stage Resistance level 1.0-2.9 High resistance (HR) 3.1-4.9 Anti (R) 5.0-6.9 Medium resistance (MR) 7.0-8.9 feel 9.0 High Sensitivity

[0235] Table 10 Classification standard of damage degree of corn ear by Asian corn borer

[0236]

[0237]

[0238] Table 11 Evaluation criteria for corn ear resistance to Asian corn borer

[0239] Average ear damage level Resistance Type 1-2.0 High resistance to HR 2.1-3.0 Anti-R 3.1-5.0 Middle resistance MR 5.1-7.0 Sense ≥7.1 High sensitivity HS

[0240] Table 12 Resistance results of transgenic corn events to the second-instar Asian corn borer at the heart leaf stage

[0241] Project / Plant Average leaf edible level Resistance level CK 8.7 feel LP111-2 1.9 High resistance LP007-1 7.2 feel LP007-2 5.9 Zhongkang LP007-3 7.6 feel LP007-4 6.0 Zhongkang LP007-5 7.5 feel LP007-6 6.8 Zhongkang LP007-7 6.5 Zhongkang LP007-8 6.1 Zhongkang

[0242] Table 13 Resistance results of transgenic corn events to Ostrinia furnacalis at silking stage

[0243]

[0244]

[0245] The results showed that the transgenic maize event LP111-2 had a good resistance level to the second-instar Asian corn borer in both the heart leaf stage and the silking stage. In the heart leaf stage, the average leaf feeding level of the transgenic maize event LP111-2 was significantly lower than that of the transformed receptor control (CK-) and other transgenic maize events. In the silking stage, the female ear damage rate, larval survival number, tunnel length and female ear damage level of the transgenic maize event LP111-2 were significantly lower than those of the transformed receptor control and other transgenic maize events.

[0246] (2)Bollworm

[0247] The experimental design and experimental methods are basically the same as those for evaluating the resistance of Asian corn borer as described above. The difference is that artificial inoculation is only carried out during the silking stage of corn, and the inoculation is carried out twice. About 20 artificially reared second-instar larvae are inoculated in the silk of each corn plant. Three days after inoculation, the second inoculation is carried out, and the number of inoculations is the same as the first. 14-21 days after inoculation, the damage rate of female ears, the number of surviving larvae per female ear, and the length of female ears damaged are investigated plant by plant. Usually, the investigation begins 14 days after inoculation. If the damage level of the negative control material (CK) reaches sensitive or highly sensitive, it is considered effective. If it does not reach the level, the investigation can be appropriately postponed. However, if it still does not reach the corresponding level 21 days after inoculation, the inoculation is considered invalid. According to the damage rate of female ears, the number of surviving larvae, and the length of female ears damaged (cm), the average damage level of cotton bollworm to female ears in the corn ear stage of each plot is calculated. The judgment criteria are shown in Table 14, and then the resistance level of corn ear stage to cotton bollworm is judged according to the standards in Table 15. The results of the resistance of transgenic maize event LP111-2 to cotton bollworm during the silking stage are as follows Figure 5 , as shown in Table 16.

[0248] Table 14 Classification standard of the degree of damage caused by cotton bollworm on corn ears

[0249]

[0250]

[0251] Table 15 Evaluation criteria for resistance of corn ears to cotton bollworm

[0252] Average ear damage level Resistance Type 0-1.0 High resistance to HR 1.1-3.0 Anti-R 3.1-5.0 Middle resistance MR 5.1-7.0 Sense ≥7.1 High sensitivity HS

[0253] Table 16 Resistance results of transgenic corn events to cotton bollworm during silking period

[0254]

[0255] The results showed that the transgenic corn event LP111-2 had a good level of resistance to cotton bollworm, and the ear damage rate, number of larval survival, ear damage length and ear damage level of the transgenic corn event LP111-2 were significantly lower than those of the transformed receptor control (CK-) and other transgenic corn events.

[0256] (3)Peach borer

[0257] The experimental design and experimental method are basically consistent with the evaluation of cotton bollworm resistance as described above. Artificial inoculation is only carried out during the silking stage of corn. The inoculation is carried out twice. About 20 artificially reared second-instar larvae are inoculated in the silk of each corn plant. Three days after inoculation, the second inoculation is carried out, and the number of inoculations is the same as the first time. 14-21 days after inoculation, the damage rate of female ears, the number of surviving larvae per female ear, and the length of female ears damaged are investigated plant by plant. Usually, the investigation begins 14 days after inoculation. If the damage level of the negative control material (CK) reaches sensitive or highly sensitive, it is considered effective. If it does not reach the level, the investigation can be appropriately postponed. However, if it still does not reach the corresponding level 21 days after inoculation, the inoculation is considered invalid. According to the damage rate of female ears, the number of surviving larvae, and the length of female ears damaged (cm), the average damage level of peach borer to female ears in the corn ear stage of each plot is calculated. The judgment criteria are shown in Table 17, and then the resistance level of corn ear stage to peach borer is judged according to the standards in Table 18. The results of resistance of transgenic maize event LP111-2 to peach borer at silking stage are as follows Figure 6 , as shown in Table 19.

[0258] Table 17 Classification standard of the degree of damage of corn ears by C.

[0259] Damage level of female ears Symptom description 0 The female ears were not damaged 1 Only the filaments were damaged 2 The top of the ear was killed 1cm 3+ For every 1cm increase in damage below the ear top, the corresponding damage level increases by 1 level …N

[0260] Table 18 Evaluation criteria for resistance of corn ears to C. persicae

[0261] Average ear damage level Resistance Type 0-1.0 High resistance to HR 1.1-3.0 Anti-R 3.1-5.0 Middle resistance MR 5.1-7.0 Sense ≥7.1 High sensitivity HS

[0262] Table 19 Resistance results of transgenic corn events to peach borer at silking stage

[0263]

[0264] The results showed that the transgenic corn event LP111-2 had a good resistance level to the peach borer, and the ear damage rate, number of larval survival, ear damage length and ear damage level of the transgenic corn event LP111-2 were significantly lower than those of the transformed receptor control (CK-) and other transgenic corn events.

[0265] Example 6: Herbicide tolerance testing of events

[0266] This experiment selected Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) for spraying. A randomized block design was used with 3 replicates. The plot area was 15m 2(5m×3m), row spacing 60cm, plant spacing 25cm, conventional cultivation management, 1m wide isolation belt between plots. Each transgenic corn event was subjected to the following two treatments: 1) no spraying; 2) spraying Roundup herbicide at a dose of 3360g ae / ha (4 times the dose) at the V3 leaf stage, and then spraying Roundup herbicide again at the V8 stage at the same dose. It should be noted that the conversion of glyphosate herbicides of different contents and dosage forms into the form of equivalent glyphosate acid is applicable to the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after the application, and the yield of the plot was measured at harvest. The phytotoxicity symptom classification is shown in Table 20. The herbicide damage rate is used as an evaluation index to assess the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of damaged plants at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the glyphosate damage rate, which is determined based on the results of the phytotoxicity survey 2 weeks after glyphosate treatment. The corn yield of each plot is the total corn kernel yield (weight) of the 3 middle rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, and the yield percentage (%) = spraying yield / non-spraying yield. The results of herbicide tolerance and corn yield of the transgenic corn event LP111-2 are shown in Figure 2. Figure 7 , as shown in Table 21.

[0267] Table 20 Grading standards for the degree of damage caused by glyphosate herbicides to corn

[0268]

[0269] Table 21 Results of glyphosate herbicide tolerance and corn yield of transgenic corn events

[0270]

[0271] The results show that in terms of herbicide (glyphosate) damage rate: 1) The damage rate of the transgenic corn event LP111-2 under the treatment of glyphosate herbicide (3360g ae / ha) is basically 0. Therefore, the transgenic corn event LP111-2 has excellent tolerance to high-dose glyphosate herbicide.

[0272] In terms of yield: the yield of the transgenic corn event LP111-2 did not decrease under the two treatments of no spraying (spraying water) and spraying 3360 g.e. / ha of glyphosate. After spraying glyphosate herbicide, the yield of the transgenic corn event LP111-2 was slightly higher than that of CK (non-transgenic), which further demonstrated that the transgenic corn event LP111-2 has good tolerance to glyphosate herbicide.

[0273] In summary, TaqMan TMThe regenerated transgenic corn plants were analyzed (see Example 2) for the presence of cry1Ab, cry2Ab, vip3Aa, cry1Fa and epsps genes, and the copy number of the insect resistance and glyphosate herbicide tolerance lines was characterized. Based on the copy number of the target gene, good insect resistance, glyphosate herbicide tolerance and agronomic performance (see Examples 5 and 6), event LP111-2 was selected as excellent through screening, having a single copy transgene, good insect resistance, glyphosate herbicide tolerance and agronomic performance (Examples 5 and 6).

[0274] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A nucleic acid molecule for detecting transgenic corn event LP111-2, characterized in that: The sequence of the nucleic acid molecule is shown in one or more groups of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5 or their complementary sequences. The nucleic acid molecule is derived from the transgenic corn event LP111-2. The corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:P202430.

2. A DNA primer pair, comprising a first primer and a second primer, characterized in that: When the first primer and the second primer are used together with DNA containing transgenic corn event LP111-2 for an amplification reaction, an amplicon of transgenic corn event LP111-2 in a detection sample is generated; The first primer is selected from SEQ ID NO: 8 or SEQ ID NO: 12, and the second primer is selected from SEQ ID NO: 9 or SEQ ID NO: 13; or the first primer is selected from SEQ ID NO: 10 or SEQ ID NO: 15, and the second primer is selected from SEQ ID NO: 11 or SEQ ID NO: 14; The corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

3. A method for detecting the presence of DNA of transgenic maize event LP111-2 in a sample, characterized in that: include: (1) contacting a sample to be tested with the DNA primer pair described in claim 2 in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of amplification products; The amplification product includes a nucleic acid sequence of SEQ ID NO:3-4 or a complementary sequence thereof, indicating that the test sample contains the DNA of the transgenic corn event LP111-2, and the corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO:P202430.

4. A DNA detection kit, characterized in that: Comprising the DNA primer pair described in claim 2.

5. A method for protecting corn plants from insect attack, characterized in that: The invention comprises providing transgenic corn plant cells containing transgenic corn event LP111-2 in the diet of target insects; target insects that ingest the transgenic corn plant cells are inhibited from further ingesting the corn plants, and corn seeds containing the transgenic corn event LP111-2 have been deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

6. A method for protecting corn plants from damage caused by glyphosate herbicides, characterized in that Transgenic corn plants comprising the transgenic corn event LP111-2 were planted, and an effective dose of glyphosate herbicide was applied. Corn seeds comprising the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCCNO: P202430.

7. A method for controlling weeds in a field where corn plants are grown, characterized in that: The method comprises applying an effective dose of glyphosate herbicide to a field planted with transgenic corn plants, wherein the transgenic corn plants comprise transgenic corn event LP111-2, and corn seeds comprising the transgenic corn event LP111-2 have been deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

8. A method for growing corn plants that are resistant to insects and / or tolerant to glyphosate herbicides, characterized in that: include: Planting corn seeds containing transgenic corn event LP111-2; allowing the corn seeds to grow and develop into corn plants; The corn plants are attacked by target insects and / or sprayed with an effective dose of glyphosate herbicide, and plants with reduced plant damage are harvested compared to other plants that do not have the transgenic corn event LP111-2. Corn seeds containing the transgenic corn event LP111-2 have been deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: P202430.

Images