Molecular marker closely linked with wheat scab resistance QTL-qFHB4A.1 and application

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with wheat scab resistance QTL-qFHB4A.1 and application of the molecular marker. Whole genome association analysis finds that the gibberellic disease resistant site qFHB4A.1 is located on a wheat 4A chromosome, peak SNP closely linked with the gibberellic disease resistant site qFHB4A.1 is further located at 584th, 934th and 370th basic groups of a wheat Chinese spring reference genome 4A chromosome, and the phenotypic variation rate of 4.8% can be explained. When 96 parts of materials are subjected to genotype detection by utilizing the PARMS marker designed by the SNP, the PARMS marker is simple and convenient to operate and clear in typing, and has a good selection effect on wheat scab.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker tightly linked to wheat fusarium head blight resistance QTL-qF HB4A.1 and application thereof. Background Art

[0002] Wheat fusarium head blight is a fungal disease of wheat caused by Fusarium graminearum, which often occurs in areas with warm and humid climatic conditions. In epidemic years, fusarium head blight can cause serious reduction in wheat production; at the same time, the infected wheat grains contain deoxynivalenol (DON toxin), which not only endangers the health of humans and animals, but also seriously affects the edible and feeding value. Therefore, the occurrence of fusarium head blight can cause serious economic losses to wheat production. Although drug prevention and control can play a certain role in years when the disease is not serious, it is easy to cause environmental pollution. Therefore, analyzing the genetic mechanism of disease resistance of fusarium head blight and cultivating new wheat varieties resistant to fusarium head blight are the most economical and effective means of preventing and controlling fusarium head blight.

[0003] Studies have shown that wheat fusarium head blight resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and the susceptibility of its phenotypic identification to environmental conditions, the mining of wheat fusarium head blight resistance genes and the study of molecular mechanisms have progressed slowly. At present, wheat germplasms with good resistance to fusarium head blight have been discovered in the United States, Japan, Brazil, and Switzerland. The fusarium head blight resistance loci located based on these germplasms are distributed on almost every chromosome of wheat, but the effect values ​​of most gene loci are small. The local wheat varieties Sumai No. 3 and Wangshuibai, which originated from Jiangsu Province, my country, are recognized as materials with high resistance to fusarium head blight in the world so far; in both materials, the major effect gene locus Fhb1 located on 3BS was located. In 2019, the team of Professor Ma Zhengqiang of Nanjing Agricultural University and the team of Professor Bai Guihua of Kansas State University in the United States cloned the Fhb1 gene, which encodes the histidine-rich calcium-binding protein TaHR C.

[0004] Although local varieties such as Sumai No. 3 have strong resistance to fusarium head blight, due to the existence of unfavorable linkage, other agronomic traits of this material are poor and it is difficult to use it in breeding. Therefore, the exploration of new fusarium head blight resistant materials and resistance-related gene loci is an important aspect of wheat fusarium head blight resistance breeding.

[0005] The present invention uses 240 natural wheat populations to conduct multi-environment QTL detection on fusarium fusarium, aiming to find new QTL loci with an improvement effect on wheat fusarium fusarium, and to develop practical high-throughput and low-cost molecular markers based on them for selecting wheat fusarium fusarium resistance. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a reagent for detecting bases at positions 584, 934, and 370 on wheat chromosome 4A in wheat fusarium head blight resistance screening and breeding.

[0007] Another object of the present invention is to provide the use of primers for detecting bases 584, 934, and 370 on wheat chromosome 4A in wheat fusarium scaber resistance screening and breeding.

[0008] The last object of the present invention is to provide a method for screening and breeding wheat fusarium resistance.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] Obtaining a molecular marker tightly linked to wheat fusarium head blight resistance QTL-qFHB4A.1:

[0011] (1) A population of 240 domestic and foreign wheat varieties (lines) was used to inoculate and identify Fusarium head blight in the Nanhu Experimental Field of Hubei Academy of Agricultural Sciences for three consecutive years from 2014 to 2016. The pathogenic bacteria strain was Huanggang No. 1.

[0012] (2) A total of 240 wheat populations were genotyped using a 90K SNP chip. Markers with a missing rate of more than 20% and a minimum allele frequency of less than 5% were removed, resulting in a total of 19,803 SNPs remaining for GWAS.

[0013] (3) The genotype and phenotype data of the above 240 populations were used to perform association analysis using a mixed linear model using GEMMA v0.98 software. When P ≤ 0.001, the marker was considered to be significantly associated with the trait.

[0014] (4) Association analysis found that the Fusarium head blight resistance locus on wheat chromosome 4A was significant in 2016 and BLUE environment, explaining 4.8% of the phenotypic variation. The representative association marker was BS00035122_51. The physical position on the reference genome sequence of the wheat variety Chinese Spring was 584.9 Mb. Under the three environments, the average FHB index of materials containing disease-resistant alleles was 15.5%-35.7% lower than that of materials containing susceptible alleles.

[0015] (5) According to the primer design principles, the PARMS marker detection primer sequences were obtained for the nucleotide sequences before and after the peak SNP marker BS00035122_51, which is closely linked to qFHB4A.1: PFHB4A-Fc: GAAGGTGACC AAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AATAAGAAGTCCTATAAG TTCGCAAAG.

[0016] The protection scope of the present invention includes:

[0017] Application of reagents for detecting bases 584, 934, and 370 on wheat chromosome 4A in wheat fusarium scaber resistance screening and breeding.

[0018] Application of a reagent for detecting bases 584, 934, and 370 on wheat chromosome 4A in preparing a wheat fusarium head blight resistance screening kit.

[0019] In the application described above, if the 584,934,370th base on the wheat chromosome 4A is detected to be T, the wheat is determined to be resistant to ergot.

[0020] In the application described above, if the 584th, 934th, 370th base on the wheat chromosome 4A is detected to be C, the wheat is determined to be susceptible to ergot disease.

[0021] In the above application, the reagent is preferably a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: PFHB4A-Fc: GAAGGTGACCAAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AAT AAGAAGTCCTATAAGTTCGCAAAG.

[0023] A method for screening and breeding wheat fusarium resistance comprises using conventional schemes in the art to detect bases at positions 584, 934, and 370 on wheat chromosome 4A. The conventional schemes include but are not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0024] The version number of the wheat Chinese Spring genome used in the present invention is IWGSC RefSeq v1.0, and the website is https: / / www.wheatgenome.org / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention obtains the wheat fusarium rust QTL locus qFHB4A.1, which can be repeatedly detected and can explain 4.8% of the phenotypic variation rate.

[0027] (2) The present invention obtains a PARMS marker tightly linked to qFHB4A.1, and the detection method thereof is simple and low-cost, which can improve the selection efficiency and accuracy of wheat fusarium head blight resistance screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Frequency distribution of Fusarium head blight phenotypes in 240 natural wheat populations in three environments.

[0029] Figure 2 The phenotypic differences of Fusarium fusarium disease in different genotypes of the qFHB4A.1 locus under three environments and BLUE.

[0030] Figure 3 Genotyping results of PARMS markers in 96 materials DETAILED DESCRIPTION

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels. The version number of the wheat Chinese Spring genome used in the present invention is IWGSCRef Seq v1.0, https: / / www.wheatgenome.org / .

[0032] Embodiment 1:

[0033] SNP molecular markers closely linked to wheat fusarium head blight resistance QTL-qFHB4A.1:

[0034] Test materials: WAPS (Wheat Association Panel for Scab research) population composed of 240 wheat varieties (lines) from home and abroad. The materials used are recorded in the literature: Zhu Zhanwang, Xu Dengan, Cheng Shunhe, et al. Identification and traceability of the stripe rust resistance gene Fhb1 in Chinese wheat varieties [J]. Acta Agronomica Sinica, 2018, 44(4): 473–482.

[0035] (1) Identification of resistance to Fusarium fusarium: Fusarium fusarium inoculation and identification were carried out in the Nanhu experimental field of Hubei Academy of Agricultural Sciences for three consecutive years from 2014 to 2016. The pathogen strain was Huanggang No. 1. The experiment adopted a completely randomized block design, with 2 rows, 1 m row length, 0.25 m row spacing, 2 replicates, and spray inoculation. 20 days after inoculation, the number of diseased ears, the number of spikelets per ear, and the number of diseased spikelets were investigated. The Fusarium fusarium fusarium index (FHB index) = incidence × severity was used to calculate the FHB index, where the incidence is the ratio of the number of diseased ears to the total number of ears, and the severity is the average ratio of the number of diseased spikelets per ear to the number of spikelets, both expressed as percentages. Then the 3-year FHB index BLUE values ​​(Best linear unbiased estimate) were calculated ( Figure 1 ).

[0036] (2) Genotyping analysis: 240 wheat populations were genotyped using a 90K SNP chip, and 22,922 SNPs with good typing results were selected for subsequent analysis. Markers with a missing rate of more than 20% and a minimum allele frequency of less than 5% were removed, leaving a total of 19,803 SNPs for GWAS.

[0037] (3) GWAS analysis: Association analysis was performed using a mixed linear model using GEMMA v0.98 software. When P ≤ 0.001, the marker was considered to be significantly associated with the trait.

[0038] (4) Obtaining qFHB4A.1 and its associated SNP markers: Association analysis found that the Fusarium head blight resistance locus was located on chromosome 4A, which was significant in the 2016 and BLUE environments, explaining 4.8% of the phenotypic variation. The representative associated marker was BS00035122_51, and its flanking sequence was: 5'-GTCCTATAAGTTCGCAAAGCAAACTGCTGCAGATTGAAAGT AAGAGACGG[A / G]CACTCCAGCTAATCTCTGGTTGAAATCGAGTATGGTACAAAACAG GGCGT-3'. The physical position on the reference genome sequence of the wheat variety Chinese Spring (IWGSC, http: / / www.wheatgenome.org) was 584.9 Mb (Table 1). Under the three environments, the average FHB index of materials containing disease-resistant alleles was 15.5%-35.7% lower than that of materials containing susceptible alleles ( Figure 2 ).

[0039] Table 1qFHB4A.1 and its associated SNP markers

[0040]

[0041] Embodiment 2:

[0042] Development of a PARMS marker tightly linked to wheat fusarium head blight:

[0043] According to the primer design principle, the PARMS marker detection primer sequence was obtained for the nucleotide sequence before and after the peak SNP marker BS00035122_51 which is closely linked to qFHB4A.1:

[0044] PFHB4A-Fc: GAAGGTGACCAAGTTCATGCT CAACCAGAGATTAGCTGGAGTGC;

[0045] PFHB4A-Ft: GAAGGTCGGAGTCAACGGATT TCAACCAGAGATTAGCTGGAGTGT;

[0046] PFHB4A-R:AATAAGAAGTCCTATAAGTTCGCAAAG.

[0047] The method for detecting the genotype of the wheat qFHB4A.1 locus to be tested using the above PARMS primer set is as follows:

[0048] (1) Extract the genomic DNA of the wheat to be tested.

[0049] (2) Prepare the reaction system. The reaction system is 5 μL, including 2.5 μL 2×PARMS PCR reaction mix (product of Wuhan Jingpeptide Biotechnology Co., Ltd.), primers PFHB4A-Fc, PFHB4A-Ft, PFHB4A-R aqueous solution, DNA and water. In the reaction system, the concentrations of primers PFHB4A-Fc and PFHB4A-Ft are both 150 nM, and the concentration of primer PFHB4A-R is 400 nM.

[0050] (3) Add 5 μL of mineral oil to the reaction system (to prevent sample evaporation) and then perform PCR amplification.

[0051] The reaction program was: 95°C for 15 min; 95°C for 20 s, 65°C for 1 min, decreasing by 0.8°C per cycle until 57°C, for 10 cycles; 95°C for 20 s, 57°C for 1 min, for 32 cycles.

[0052] (4) After completing step (3), the signal is read on the TECAN Infinite M1000, and then the following judgment is made: if it is displayed in blue, the corresponding wheat is or is suspected to be susceptible to ergot; if it is displayed in green, the corresponding wheat is or is suspected to be resistant to ergot.

[0053] The above primers were used to detect the genotypes of Yangmai 158 and Zhengmai 366. In the fusarium resistant wheat Yangmai 158, the sequence amplified by the primers was:

[0054] CAACCAGAGATTAGCTGGAGTGTCCGTCTCTTACTTTCAATCTGCAGCAGTTTGTCTTTGCGAACTTATAGGACTTCTTATT.

[0055] In the wheat Zhengmai 366 that is sensitive to ergot disease, the sequence amplified by this primer is: CAACCAGAGATTAGCTGGAGTGCCCGTCTCTTACTTTCAATCTGCAGCAGTTTGTCTTTGCGAACTTATAGGACTTCTTAT T.

[0056] Embodiment 3:

[0057] Universality of PARMS markers in wheat fusarium head blight resistance selection:

[0058] The PARMS primer set and experimental method designed in Example 2 were used to perform genotyping on 96 wheat varieties (collected by the applicant). The results showed that among the 96 wheat varieties (lines), 77 materials with red color were detected to have a genotype of CC; 16 materials with green color were detected to have a genotype of TT; and 3 materials with gray color were detected to have a genotype that could not be detected (Table 2, Figure 3 ).

[0059] According to the method described in Example 1, Fusarium head blight inoculation and identification were carried out in the Nanhu experimental field of Hubei Academy of Agricultural Sciences for three consecutive years from 2014 to 2016, and the Fusarium head blight disease index (FHB index) was counted, and then the 3-year FHB index BLUE values ​​were calculated.

[0060] The resistance of wheat genotype TT to Fusarium head blight was higher than that of genotype CC, and the difference in FHB index was 14.9%, reaching a significant level (Table 2).

[0061] Table 2 Phenotypes of Fusarium head blight of two genotypes of PARMS marker qFHB4A.1 in 96 wheat varieties

[0062]

Claims

1. Application of reagents for detecting the genotype of bases 584, 934, and 370 of chromosome 4A of the wheat genome in selective breeding for resistance to fusarium wilt.

2. Application of reagents for detecting bases 584, 934, and 370 on wheat chromosome 4A in the preparation of a wheat fusarium wilt resistance screening kit.

3. The use according to claim 1 or 2, characterized in that: If the 584,934,370th base on wheat chromosome 4A is detected to be T, the wheat is determined to be resistant to ergot.

4. The use according to claim 1 or 2, characterized in that: If the 584th, 934th, 370th base on wheat chromosome 4A is detected to be C, the wheat is judged to be sensitive to ergot disease.

5. The use according to claim 1 or 2, characterized in that: The reagent is a primer.

6. The use according to claim 5, wherein the primers are: PFHB4A-Fc: GAAGGTGACCAAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AATAAGAAGTCCTATAAGTTCGCAAAG.

7. A method for screening and breeding wheat scab resistance, the method comprising detecting bases 584, 934, and 370 on wheat chromosome 4A, the detection method comprising: Sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method.

Images