KASP molecular marker, primer set and application of wheat adult stage stripe rust resistance gene YrAK58.3

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a KASP molecular marker of a wheat adult stage stripe rust resistance gene YrAK58.3, a primer group and application thereof. The KASP molecular marker is Ta4631, the nucleotide sequence of which is shown as SEQ ID NO. 1, wherein there is a mutation from A to C at the 119th position from the 5' end; the nucleotide sequence of the wheat adult stage stripe rust resistance gene YrAK58.3 is shown as SEQ ID NO. 2. The KASP molecular marker provided in the application has the characteristic of co-expression, and specific primers of the KASP molecular marker can accurately and efficiently identify whether the stripe rust resistance gene YrAK58.3 is contained in a stripe rust resistance wheat variety 。 The KASP molecular marker provided in the application can be used in molecular marker assisted breeding, and greatly improves the breeding selection efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a wheat adult-stage stripe rust resistance gene. YrAK58.3 KASP molecular markers, primer sets and their applications. Background Technology

[0002] Due to the continuous mutation of stripe rust fungi and the emergence of new, prevalent, and highly virulent races, my country currently faces an extreme shortage of effective stripe rust resistance resources, particularly broad-spectrum and durable resistance gene resources. Therefore, identifying and utilizing resistance gene resources remains the most fundamental solution.

[0003] With the advancement of modern biotechnology and the application of molecular marker technology, we have discovered and named a large number of stripe rust resistance genes. To date, 87 stripe rust resistance genes have been officially named. Yr1-Yr87 In addition, there are numerous temporarily named stripe rust resistance genes or QTL loci. Because different breeding units in different regions used the same type of resistance source or a single stripe rust resistance gene extensively during the same period, the widespread promotion of new varieties exerted strong selective pressure on stripe rust fungus. This favored the emergence and spread of new virulent races of stripe rust, which became dominant races, overcoming the resistance of stripe rust resistance genes and ultimately leading to the loss of resistance in varieties. Therefore, it is urgent to discover and utilize new disease-resistant gene resources from common wheat materials to further broaden the genetic basis of disease-resistant breeding materials.

[0004] The common wheat variety Aikang 58 is a well-suited comprehensive resistance variety currently used in production practice. Previous research has found that it carries a stripe rust resistance gene. Yr5b , YrAK58.1 ( Yr6 ), YrAK58.2 ( Yr52 ), YrAK58.3 ( YrZH84 ), of which is located on chromosome 2BL Yr5b It exhibits good resistance to the physiological race CYR32, located on chromosome 7BL. Yr6 and YrAK58.2 It exhibits good resistance to physiological race CYR34. To further develop and utilize the above-mentioned stripe rust resistance genes, it is necessary to develop molecular markers targeting these genes to assist in the research of disease-resistant breeding materials.

[0005] At present, many molecular markers for the development of resistance to stripe rust genes are mainly developed and applied for the resistance to stripe rust at the seedling stage. However, the resistance at the adult stage is different from the resistance at the seedling stage. The resistance at the seedling stage is often pathogen race-specific resistance, which is easily overcome by the complex flora in the field, and then the resistance is "lost"; and the resistance at the adult stage is often non-race-specific resistance, thereby having the characteristics of broad-spectrum and durability. However, the resistance at the adult stage is mostly quantitative resistance, and due to the resistance effect is not as good as a single major gene, it is difficult to select early through conventional techniques, and most breeding units do not have precise disease identification capabilities. Therefore, it is necessary to use molecular markers for resistance to stripe rust genes to solve the problems that cannot be solved by conventional techniques. However, the specific molecular markers for the resistance to stripe rust genes at the adult stage are relatively few, which makes it difficult to specially screen wheat varieties with stable resistance to stripe rust at the adult stage in the breeding process. Therefore, it is urgent to develop corresponding molecular markers that are tightly linked or cosegregated. SUMMARY

[0006] In order to solve the problem that the specific markers for the resistance to stripe rust genes at the adult stage are relatively few in the prior art, which makes it difficult to specially screen wheat varieties with stable resistance to stripe rust at the adult stage in the breeding process, the present application provides a KASP molecular marker for the resistance to stripe rust genes at the adult stage of wheat, a primer set and application thereof. In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows.

[0007] The first object of the present application is to provide a KASP molecular marker for the resistance to stripe rust genes at the adult stage of wheat, which is Ta4631, and the nucleotide sequence thereof is shown as SEQ ID NO. 1, wherein the 119th base from the 5' end is a SNP site, and the base at the site is SNP mutated from A to C. YrAK58.3

[0008] 5'-GGGAGAGAACGATGGCTCTCATGTACGGTAACCTACAAAACATCAGTGGCTACAATAGTAATGAAGAAGAAAATAGGCTGACTCATCCAGAACTGGAGGAGGATGCTAGGTACTCTAG[A / C]ATTATTAGTTTTTCCTTGGATTCAACTCCGATAGTTCGACACTTATTTGCTGGATTTACACTCTTCCAGATACCAGAAGGCTTCCATGCAACAACTTGGACAAGCTATGCTCGATCACATCAAGTCCAACAGGC-3', wherein A in [A / C] is the mutation site, and C is the site after mutation.

[0009] ​The KASP molecular marker provided by the present application can accurately predict the wheat adult plant resistance stripe rust gene YrAK58.3 , which is of great significance for the subsequent cloning of the wheat adult plant resistance stripe rust gene YrAK58.3 . The KASP molecular marker of the wheat adult plant resistance stripe rust gene YrAK58.3 provided by the present application is a specific marker of the wheat adult plant resistance stripe rust gene, which solves the problem that it is difficult to specially screen wheat varieties with stable adult plant resistance stripe rust resistance in the current wheat breeding process.

[0010] Preferably, the KASP molecular marker is used for detecting the wheat adult plant resistance stripe rust gene YrAK58.3.

[0011] The candidate gene of the wheat adult plant resistance stripe rust gene YrAK58.3 TraesCS7B03G1245900 The nucleotide sequence of the KASP molecular marker is shown as SEQ ID NO. 2.

[0012] A second object of the present application is to provide a primer set for amplifying the KASP molecular marker, comprising forward primer 1, forward primer 2 and reverse primer 3.

[0013] The nucleotide sequence of the forward primer 1 is shown as SEQ ID NO. 3.

[0014] The nucleotide sequence of the forward primer 2 is shown as SEQ ID NO. 4.

[0015] The nucleotide sequence of the reverse primer 3 is shown as SEQ ID NO. 5.

[0016] Preferably, a fluorescent label sequence is added to the 5' end of the forward primer 1 and the forward primer 2, respectively.

[0017] Preferably, the nucleotide sequence of the forward primer 1 after adding the fluorescent label sequence is shown as SEQ ID NO. 6; and the nucleotide sequence of the forward primer 2 after adding the fluorescent label sequence is shown as SEQ ID NO. 7.

[0018] A third object of the present application is to provide a PCR reagent for detecting the wheat adult plant resistance stripe rust gene YrAK58.3 or a kit containing the PCR reagent, wherein the PCR reagent comprises a primer set for amplifying the KASP molecular marker.

[0019] Preferably, the PCR reagent is a complete reagent consisting of PCR reagent 1 and PCR reagent 2, or the PCR reagent is PCR reagent 3.

[0020] ​The PCR reagent 1 comprises the forward primer 1 or the forward primer 1 after adding a sequence of fluorescent label.

[0021] The PCR reagent 2 comprises the forward primer 2 or the forward primer 2 after adding a sequence of fluorescent label.

[0022] The PCR reagent 3 comprises the reverse primer 3.

[0023] The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3, and the nucleotide sequence of the forward primer 1 after adding a sequence of fluorescent label is shown in SEQ ID NO. 6.

[0024] The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4, and the nucleotide sequence of the forward primer 2 after adding a sequence of fluorescent label is shown in SEQ ID NO. 7.

[0025] The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO. 5.

[0026] A fourth object of the present application is to provide an application of the KASP molecular marker, the primer set, the PCR reagent or the kit, which comprises at least one of the following applications:

[0027] Detecting a wheat adult plant resistance stripe rust gene YrAK58.3.

[0028] Wheat assisted breeding.

[0029] Preparation of a product for detecting a wheat adult plant resistance stripe rust gene YrAK58.3 .

[0030] Preparation of a product for assisting wheat breeding.

[0031] Preferably, the step of detecting a wheat adult plant resistance stripe rust gene YrAK58.3 is as follows:

[0032] Extracting genomic DNA of the wheat to be detected.

[0033] Using the primer set to perform PCR amplification with the genomic DNA of the wheat as a template.

[0034] Performing typing detection on the PCR amplification product.

[0035] Using the primer set to determine the genotype of the SNP site of the KASP molecular marker.

[0036] If the genotype is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "AA" homozygous, the wheat to be tested is a candidate wheat with stripe rust resistance.

[0037] YrAK58.3 It has good resistance in the adult stage, and is resistant to YrAK58.3 locus, through fine mapping and further gene annotation analysis, it is found that the interval contains 9 high-confidence disease resistance genes, wherein TraesCS7B03G1245900 The gene encodes transmembrane protein, putative (DUF594), and is highly expressed in the process of stripe rust infection, which is speculated to be an important candidate gene. Based on the difference sequence of the gene between the parents Avocet S and dwarf resistance 58, a corresponding KASP gene functional marker Ta4631 is developed, and molecular detection is carried out in natural population materials, and it is found that the presence of the gene can improve the resistance of wheat to stripe rust, thereby reducing the damage of stripe rust in the adult stage of wheat. At the same time, it has great potential application value for improving the resistance of wheat to stripe rust in the future. Therefore, the development of the molecular marker of the stripe rust resistance gene is of great significance for molecular assisted breeding of multiple disease resistance genes.

[0038] Compared with the prior art, the present application has the following beneficial effects:

[0039] 1. The present application provides a KASP molecular marker of a wheat adult stage stripe rust resistance gene YrAK58.3 , which can accurately predict the wheat adult stage stripe rust resistance gene YrAK58.3 , and is of great significance for the cloning of the wheat adult stage stripe rust resistance gene YrAK58.3 . The KASP molecular marker of the wheat adult stage stripe rust resistance gene YrAK58.3 provided by the present application belongs to the specific marker of the wheat adult stage stripe rust resistance gene, and solves the problem that it is difficult to specially screen wheat varieties with stable stripe rust resistance in the adult stage in the current wheat breeding process.

[0040] 2. The present application provides a primer set for amplifying the KASP molecular marker of the wheat adult stage stripe rust resistance gene YrAK58.3 , and the KASP molecular marker and the primer set thereof can be quickly and high-throughput applied to molecular assisted breeding of wheat variety improvement, thereby accelerating the breeding process of wheat at the whole genome level. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 is the amplification typing scatter plot of the primer set of the molecular marker Ta4631 in Example 2 in the present application, the resistance parent, the susceptible parent and 388 wheat varieties; wherein,Figure 1 Figure a in the drawing is a scatter plot of the amplification genotyping of the molecular marker Ta4631 of the resistant parent, the susceptible parent and 388 wheat varieties; Figure 1 Figure b in the drawing is a box plot of the disease severity; wherein FAM is located on the X axis, HEX is located on the Y axis, ÷÷ represents the same type as the resistant parent, -- represents the same type as the susceptible parent, and ÷- represents the heterozygous type.

[0042] Figure 2 Figure in the drawing is a genetic linkage map constructed by the 660K chip and the SNP marker in the candidate gene in Example 1 of the present application and the position map of the SNP marker in the genetic linkage map; wherein, Figure 2 Figure a in the drawing is a YrAK58.3 rough mapping map; Figure 2 Figure b in the drawing is a YrAK58.3 fine mapping map; Figure 2 Figure c in the drawing is a genetic integration map of the 7BL chromosome where YrAK58.3 is located, wherein I, II and III are three different disease resistance hot spot enrichment regions. DETAILED DESCRIPTION

[0043] The present application will be described in detail below in conjunction with the drawings and specific examples, but should not be understood as limiting the present application. If not specially stated, the technical means used in the following examples are the conventional means well known to those skilled in the art, and the materials, reagents and the like used in the following examples, if not specially stated, can be obtained from commercial channels.

[0044] The test materials used in the examples of the present application and their preparation are as follows:

[0045] The wheat material used in the examples of the present application is common wheat, specifically the dwarf resistant 58 material and its derivative varieties bred by the Wheat Breeding Center of Henan University of Science and Technology.

[0046] The stripe rust in the present application can be specifically the stripe rust caused by the current stripe rust pathogen races CYR32, CYR33 and CYR34.

[0047] Example 1: Wheat adult stage stripe rust resistance gene YrAK58.3 Obtaining of the molecular marker

[0048] 1. Construction of genetic population and genetic analysis

[0049] (1) Test wheat materials:

[0050] The parents used for constructing the genetic population are dwarf resistant 58 and Avocet S.

[0051] Among them, the disease-resistant parent dwarf resistance 58 is a variety with seedling resistance to the current prevailing race CYR34 of stripe rust fungus bred by the Wheat Breeding Center of Henan University of Science and Technology. The susceptible parent is the Australian susceptible variety Avocet S (AvS), and the disease-resistant variety dwarf resistance 58 is the father hybrid to obtain F1, F1 self-crossing to obtain F2, and F2 single plant continuous self-crossing to obtain a recombinant inbred line (RIL) population by using the “single particle transmission” method for genetic analysis and gene location.

[0052] Common wheat Xiaoyan 22 is a cultivar, which is used as a susceptible control and can be obtained from the National Crop Germplasm Repository.

[0053] (2) Phenotypic evaluation and phenotypic data analysis of the test population:

[0054] The steps and methods of field adult plant resistance identification are as follows: 124 F7 RILs are sown in Yangling (34°17'N, 108°04'E, altitude 519m) and Jiangyou (31°53'N, 104°47'E, altitude 571m) two test points. A completely randomized block design is used, and three replicates are set up in each replicate, with about 40 seeds of a single family in each replicate. Each family is sown in a single row, with a row length of 1.2m and a row spacing of 30cm. Every 20 rows are planted with one row of parents and two rows of Xiaoyan 22 as susceptible indicator varieties, and every 50 rows are planted with 5 rows of Mingxian 169, and in the spacing between plots, 30 seeds of Mingxian 169 are sown every 1.5m as the inducing row. Jiangyou belongs to the winter breeding area of stripe rust fungus, and the climate conditions are very suitable for the natural occurrence and spread of stripe rust fungus, so artificial inoculation is not needed. Yangling belongs to the occasional area of stripe rust fungus, so artificial inoculation is carried out in the middle of March every year when the wheat grows to the jointing stage. One week before inoculation, irrigation is carried out once, and if it rains, it can be omitted. The current prevailing races CYR32, CYR33 and CYR34 of stripe rust fungus are used for field artificial inoculation, and generally after 6pm, when the air is humid and water droplets often condense on the leaves, it is very conducive to the infection of stripe rust fungus. The specific artificial inoculation method is as follows:

[0055] First, mix the uredospores of stripe rust fungus with paraffin oil at a volume ratio of 1:300, then use a throat sprayer to directly spray the inducing row of Mingxian 169, and then use a plastic bag to cover and keep moist, and open the bag before noon the next day. According to the actual situation, investigate the occurrence of stripe rust disease every year, generally 3 times, i.e. initial occurrence, peak occurrence and terminal occurrence. In individual years, only the terminal occurrence is investigated, at which time the occurrence of stripe rust disease is the most serious, i.e. the susceptible control is often covered with stripe rust spores on the entire flag leaf.

[0056] Based on past survey experience, stripe rust outbreaks typically occur from April 1st to April 15th in Jiangyou and from May 1st to May 20th in Yangling. Therefore, this period was chosen for the disease survey. Disease survey records were kept consistent with those used in greenhouse mature plant trials. For homozygous families, only one value was recorded; for segregating families, two or more values ​​were generally recorded: the maximum, minimum, and median values. In this experiment, maximum disease severities (MDS) were used as the analytical index. MDS was then used for analysis of variance (ANOVA) and correlation analysis. The ANOVA function in IciMapping V4.1 software was used for calculation, and the generalized heritability was calculated based on the variance results. The formula is as follows:

[0057] h2 b = σ2 g / ( σ2 g + σ2 ge / e + σ2 ε / re ),in σ2 g =( MS f – MS fe ) / re, σ2 ge =( MS fe – MS e ) / r, σ2 ε = MS e (Allard 1960);

[0058] In the above formula, h2 b Represents heredity, σ2 g Represents genotype variance. σ2 ge This represents the interaction between genotype and environment. σ2 ε The value represents the error; e is the number of environments, and r is the number of repetitions within each environment.

[0059] Analysis of variance showed that there were highly significant differences in stripe rust resistance among different genotypes, and the correlation coefficients of the four environments ranged from 0.71 to 0.92, indicating good correlation, thus clarifying the validity of the phenotypic data.

[0060] 2. Genetic mapping and stripe rust resistance genes YrAK58.3 Location and candidate gene cloning

[0061] (1) Bulk segregant analysis (BSA) combined with wheat microarray analysis:

[0062] When the wheat grows to 3-leaf stage, the 3rd leaf of each parent and single plant / line is collected, and DNA is extracted by CTAB method. According to the separation characteristics of the F2 progeny population of AvS x AK58 and the RIL line of AvS x AK58, 10 extremely resistant single plants / lines and 10 extremely susceptible single plants / lines are selected by cluster separation analysis, and equal amounts of DNA are extracted to construct two groups of resistant and susceptible pools. After quality inspection, the constructed resistant and susceptible pools and the parents are sent to Beijing Boao Biotechnology Co., Ltd. for genotyping by using a wheat 660K SNP chip. According to the chromosome where the number of different SNPs is located and the concentration of the chromosome, the position of the QTL site is preliminarily determined, then the polymorphic KASP markers are developed, the RIL population is genotyped, and the genetic map is drawn by using IciMapping software. A new stripe rust resistance gene is located in the population, which is named YrAK58.3 . YrAK58.3 , which is referred to as YrAK58.3 in the following, and the KASP molecular marker thereof is Ta4631. The nucleotide sequence of Ta4631 is shown in SEQ ID NO. 1: YrAK58.3

[0063] 5'-GGGAGAGAACGATGGCTCTCATGTACGGTAACCTACAAAACATCAGTGGCTACAATAGTAATGAAGAAGAAAATAGGCTGACTCATCCAGAACTGGAGGAGGATGCTAGGTACTCTAG[A / C]ATTATTAGTTTTTCCTTGGATTCAACTCCGATAGTTCGACACTTATTTGCTGGATTTACACTCTTCCAGATACCAGAAGGCTTCCATGCAACAACTTGGACAAGCTATGCTCGATCACATCAAGTCCAACAGGC-3'.

[0064] The primer set designed for Ta4631 is as follows:

[0065] The nucleotide sequence of the forward primer 1 of Ta4631A is shown in SEQ ID NO. 3:

[0066] 5'-AGGAGGATGCTAGGTACTCTAGA-3'.

[0067] The nucleotide sequence of the forward primer 2 of Ta4631B is shown in SEQ ID NO. 4:

[0068] 5'-AGGAGGATGCTAGGTACTCTAGC-3'.​

[0069] The nucleotide sequence of the reverse primer 3 is shown as SEQ ID NO. 5:

[0070] 5'-CCAGCAAATAAGTGTCGAACTATC-3'.

[0071] The 5' end of the forward primer 1 is added with a fluorescent tag sequence: FAM probe sequence, respectively.

[0072] The nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent tag is shown as SEQ ID NO. 6:

[0073] 5'-gaaggtgaccaagttcatgctAGGAGGATGCTAGGTACTCTAGA-3'.

[0074] The 5' end of the forward primer 2 is added with a fluorescent tag sequence: HEX probe sequence, respectively.

[0075] The nucleotide sequence of the forward primer 2 after adding the sequence of the fluorescent tag is shown as SEQ ID NO. 7:

[0076] 5'-gaaggtcggagtcaacggattAGGAGGATGCTAGGTACTCTAGC-3'.

[0077] (2) YrAK58.3 Fine mapping and candidate gene cloning:

[0078] Further fine mapping work of the site was carried out by using the remaining heterozygous line population. The remaining heterozygous lines AAKHIF4, AAKHIF38, AAKHIF52 and AAKHIF81 containing only YrAK58.3 were selected from the Avocet S / Dwarf-Resistant 58 advanced genetic analysis population and selfed to create F2 secondary segregation populations. About 200 F2 single plants were selected from each heterozygous line as the basic segregation population. According to the phenotype and segregation of the F2 single plants, the population in which the target trait was controlled by a single gene (resistance: susceptible segregation ratio of 3:1) was screened to carry out preliminary positioning and fine mapping work.

[0079] More than 5000 F2 segregation populations were needed in the process of fine mapping, which were composed of F2 or F 2:3 derived populations. The F 2:3 basic segregation populations constructed above were used to select extreme phenotype lines to construct resistance / susceptible mixed pools according to the identification results in multiple environments: 30 susceptible lines (genotype yrAK58.3 yrAK58.3 ​, i.e. recessive homozygous), a diseased homozygous pool was constructed; 30 dominant homozygous disease-resistant families (genotype of YrAK58.3 / YrAK58.3 ) were selected to construct a disease-resistant mixed pool. Genotype typing of the two mixed pools and the two parents was performed using a wheat 660K SNP chip and RNA-Seq sequencing, and in addition, 10x genome resequencing of each parent of the segregating population was performed. The specific steps are as follows:

[0080] 1) For SNP chip typing data: after mining the differential SNPs between the resistant and susceptible pools, the chromosomal distribution and genetic and physical location information of the differential SNP sites were obtained according to the reference integrated genetic and physical maps. The number of differential SNPs per megabase (Mb) or per genetic distance centiMorgan (cM) was calculated using a Perl language program to understand the enrichment degree of SNP distribution on the chromosome, thereby determining the possible range of the target gene.

[0081] 2) For RNA-Seq data, the sequencing data was aligned to the Chinese Spring reference genome sequence and SNPCalling was performed, and the Index value (the proportion of a certain genotype in the total genotype) of the SNP site was calculated. In most regions of the genome, due to free combination between genes, the above-mentioned Index value is about 0.5; while in the gene region controlling the target trait, the Index values of the two extreme mixed pools will be significantly different, thereby quickly completing preliminary positioning and roughly locking the target gene to a certain interval on the chromosome, and the above-mentioned 690-750 Mb interval on the 7BL chromosome.

[0082] 3) Since the genome of one of the parents, Dwarf 58, is basically assembled and spliced, the resequencing data of the other parent can be aligned thereto, and the Chinese Spring genome will also be referred to during the alignment in order to mine more DNA variation information. Finally, the data results of the three methods are integrated to provide a reference for the design of molecular marker development in the future.

[0083] Based on the positioning interval of the above-mentioned method, a SNP-based KASP molecular marker was developed, and the F 2:3 segregating population was genotyped. After obtaining the F 2:3After separating phenotypic and genotypic data from populations under different environments, two methods were used to analyze the data: qualitative and quantitative traits. For qualitative traits, the recombination rate was calculated using the Kosambi function in conjunction with phenotypic and genotypic data using Joinmap software, and linkage maps were drawn. For quantitative traits, QTL mapping was performed using inclusive composite interval mapping (ICIM) software (QTL IciMapping V4.1). Finally, the results of the two methods were combined to cross-validate the mapped regions. After determining the target gene region within the 700Mb~710Mb range of the Chinese Spring reference genome, appropriate flanking markers were selected at both ends, such as... AX-109545885 and 7B_ 725766535 Key recombinants were screened in the F2 population. Genotype and phenotype analysis and confirmation of these key recombinants were conducted, and new molecular markers developed during fine mapping were used to establish marker-phenotype (corresponding) relationships. YrAK58.3 The linkage between genotypes (dominant homozygous and heterozygous materials were identified based on whether the genotypes segregated in the progeny) and closer flanking markers were determined. Ultimately, the target region was narrowed down to... AX-108746141 and AX-111168714 This corresponds to the 729.732Mb~730.681Mb interval on chromosome 7B in the Chinese Spring reference genome v.2.1. According to the Chinese Spring gene annotation results, there are 9 high-confidence genes, namely... TraesCS7B03G1245500.1, TraesCS7B03G1245600.1, TraesCS7B03G1245900.1, TraesCS7B03G1246000.1, TraesCS7B03G1246100.1, TraesCS7B03G1246300.1, TraesCS7B03G1246800.1, TraesCS7B03G1247900.1 and TraesCS7B03G1248100.1 Annotated the following: Receptor-like protein kinase, receptor kinase 1, transmembrane protein, putative (DUF594), Receptor-like protein kinase, wall-associated receptor kinase-like protein, Non-lysosomal glucosylceramidase, Wall-associated receptor kinase 3, Disease resistance protein RPM1, and Receptor-like kinase. Based on transcriptome data, only... TraesCS7B03G1245900 Genes were induced to express by stripe rust fungi, while other genes were largely not expressed; therefore, it was preliminarily determined that... TraesCS7B03G1245900 As an important candidate gene, molecular markers for this gene were developed and designed using Primer 5.0 software based on its sequence differences in resistant and susceptible materials. Ta4631and its robustness was verified in the recombinant single clones of the offspring.

[0084] wherein the above TraesCS7B03G1245900 is a candidate gene of the stripe rust resistance gene YrAK58.3 in the adult stage of wheat TraesCS7B03G1245900 , and the nucleotide sequence thereof is shown as SEQ ID NO. 2:

[0085]

[0086] YrAK58.3 The results of coarse positioning are as follows Figure 2 Figure a in the diagram.

[0087] YrAK58.3 The results of fine positioning are as follows Figure 2 Figure b in the diagram.

[0088] Depend on Figure 2 As can be seen from Figure b, Ta4631 Mark and YrAK58.3 Phenotypic co-separation.

[0089] Example 2: Straw rust resistance gene in mature wheat plants YrAK58.3 Feasibility verification of molecular markers

[0090] This invention aims to develop a gene for resistance to stripe rust in mature wheat plants. YrAK58.3 candidate genes TraesCS7B03G1245900 Functional molecular markers Ta4631 The feasibility of Ta4631 (hereinafter referred to as Ta4631) and its dedicated primer set was verified, and the following studies were conducted:

[0091] I. Molecular detection of stripe rust resistance genes in 388 wheat cultivars

[0092] Methods: The stripe rust resistance gene in 388 wheat cultivars was detected using the primer set of Ta4631.

[0093] 1. Using the primer set of Ta4631, 388 test varieties were detected according to the method described in the example. The template solution had a DNA concentration of 100 ng / μL.

[0094] The primer set for Ta4631 is as follows:

[0095] The nucleotide sequence of forward primer 1, Ta4631A, is shown in SEQ ID NO. 3.

[0096] 5'-AGGAGGATGCTAGGTACTCTAGA-3'.

[0097] Forward primer 2: The nucleotide sequence of Ta4631B is shown in SEQ ID NO. 4:

[0098] 5'-AGGAGGATGCTAGGTACTCTAGC-3'.

[0099] The nucleotide sequence of reverse primer 3: Ta4631C is shown in SEQ ID NO. 5:

[0100] 5'-CCAGCAAATAAGTGTCGAACTATC-3'.

[0101] The 5' end of the forward primer 1 is added with a fluorescent label sequence: FAM probe sequence, respectively.

[0102] The nucleotide sequence of the forward primer 1 after adding the sequence of the fluorescent label is shown in SEQ ID NO. 6:

[0103] 5'- AGGAGGATGCTAGGTACTCTAGA-3'. gaaggtgaccaagttcatgct The 5' end of the forward primer 2 is added with a fluorescent label sequence: HEX probe sequence, respectively.

[0104] The nucleotide sequence of the forward primer 2 after adding the sequence of the fluorescent label is shown in SEQ ID NO. 7:

[0105] 5'- AGGAGGATGCTAGGTACTCTAGC-3'.

[0106] gaaggtcggagtcaacggatt 2、If the genotype of the labeled target SNP is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with potential resistance to stripe rust; if the genotype of the labeled target SNP is "AA" homozygous, the wheat to be tested is a candidate wheat with susceptibility to stripe rust, and the results are as shown in FIG. a of

[0107] As shown in FIG. a of Figure 1 , Ta4631 can amplify "CC" homozygous type in the resistant parent, and all "CC" homozygous or "AC" heterozygous are possible materials carrying the target gene. At the same time, as shown in FIG. b of , the "CC" homozygous type, i.e., the material containing the target gene, has better resistance than the "AA" homozygous type at the adult stage. It is proved that the molecular marker Ta4631 can be used for detecting the resistance of wheat to stripe rust. The genotype and stripe rust phenotype of 388 wheat cultivars detected by the Ta4631 primer group are shown in Table 1.

[0108] Figure 1 Table 1 Genotype and stripe rust phenotype of 388 wheat cultivars detected by Ta4631 primer group Figure 1

[0109]

[0110] ​​​ From Table 1, Ta4631 can expand "CC" homozygous and "AA" homozygous in disease-resistant / disease-susceptible parents, respectively. All "CC" homozygous or "AC" heterozygous are possible target gene materials, and the numerical value of their stripe rust resistance phenotype, i.e. severity, is generally smaller than that of "AA" homozygous materials (not containing target genes), indicating that their field resistance is good. It is shown that molecular marker Ta4631 can be used for detecting the resistance of wheat to stripe rust.

[0111] From the above experimental results, it is shown that Ta4631 as a functional molecular marker of the candidate gene is co-segregated with the stripe rust resistance phenotype in a large population (more than 5000 F2 generations), indicating that the marker is closely linked to the target gene. Compared with the previous markers such as Xgwm577 and Xbarc32 (see Figure C in Figure 2 ), the genetic distance of the marker is closer to the target gene, that is, it is less likely to recombine, further ensuring the accuracy of the marker for detection; in addition, Ta4631 as a high-throughput KASP molecular marker has another advantage that it can quickly and efficiently detect large samples, and the operation is simple and easy to implement, ensuring the timeliness of field selection, while the traditional SSR marker cannot achieve this purpose.

[0112] It should be noted that when the numerical range is involved in the present application, it should be understood that any number between the two endpoints of each numerical range can be selected, and in order to prevent repetition, the present application describes the preferred embodiments.

[0113] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic inventive concept, and these changes and modifications all fall within the scope of all changes and modifications of the present application.

Claims

1. A wheat stripe rust resistance gene at the adult stage YrAK58.3 The KASP molecular marker, characterized by, The KASP molecular marker is Ta4631, and its nucleotide sequence is shown in SEQ ID NO. 1, wherein there is a mutation from A to C at position 119 starting from the 5' end.

2. A primer set for amplifying the KASP molecular marker of claim 1, characterized in that, It includes forward primer 1, forward primer 2, and reverse primer 3; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 3; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 4; The nucleotide sequence of the reverse primer 3 is shown in SEQ ID NO.

5.

3. The primer set according to claim 2, characterized in that, Fluorescent tag sequences are added to the 5' ends of both forward primer 1 and forward primer 2.

4. The primer set according to claim 3, characterized in that, The nucleotide sequence of forward primer 1 with added fluorescent tag sequence is shown in SEQ ID NO. 6; the nucleotide sequence of forward primer 2 with added fluorescent tag sequence is shown in SEQ ID NO.

7.

5. The application of the primer set according to claim 2, characterized in that, The application includes at least one of the following: Detection of stripe rust resistance genes in mature wheat plants YrAK58.3 Among them, the wheat stripe rust resistance gene at the adult stage... YrAK58.3 candidate genes TraesCS7B03G1245900 The nucleotide sequence is shown in SEQ ID NO. 2; Assisted breeding for resistance to stripe rust in mature wheat plants; Preparation and detection of wheat stripe rust resistance genes at adult stage YrAK58.3 The product; wherein, the wheat adult stage stripe rust resistance gene YrAK58.3 candidate genes TraesCS7B03G1245900 The nucleotide sequence is shown in SEQ ID NO. 2; To prepare products for wheat adult plants resistant to stripe rust through auxiliary breeding.

6. The application according to claim 5, characterized in that, Detection of stripe rust resistance genes in mature wheat plants YrAK58.3 The steps are as follows: Genomic DNA was extracted from the wheat to be tested; Using the genomic DNA of the wheat as a template, PCR amplification was performed using the primer set; The PCR amplification products were then subjected to typing detection. The primer set was used to determine the genotype of the SNP site of the KASP molecular marker; Judgment results: If the genotype is "CC" homozygous or "AC" heterozygous, the wheat to be tested is a candidate wheat with stripe rust resistance; if the genotype is "AA" homozygous, the wheat to be tested is a candidate wheat with stripe rust susceptibility.

Images