A molecular marker related to the number of branches of alfalfa and its application
A KASP marker on chromosome 2 (chr2:57649197) for purple clover allows accurate branch number selection, improving breeding efficiency and speed through fluorescent detection, addressing the inefficiencies of traditional branch number-based selection methods.
Patent Information
- Application Number
- CN202510341234.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2045-03-21
AI Technical Summary
The selection and breeding of new traditional alfalfa varieties depends on the selection of single plants with the number of branches of breeding offspring, which is time-consuming and labor-intensive and has low accuracy.
KASP molecular markers related to alfalfa branch count were developed, and specific primer combinations were designed using SNP site 57649197 on chromosome chr2, and early selection of branch count was achieved through competitive allele-specific PCR and high sensitivity fluorescence detection.
It improves the selection efficiency of alfalfa breeding, reduces workload, accelerates the high-yield breeding process, and improves the accuracy of selection.
Smart Images

Figure CN119842975B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the number of branches of alfalfa and its application. Background Art
[0002] Alfalfa is an important leguminous forage grass, known as the "king of forage grasses". The yield of alfalfa is determined by multiple factors, and the number of branches is one of the key factors. The number of branches directly determines the plant size and biomass of alfalfa. Research shows that an increase in the number of branches can significantly increase the dry matter yield of alfalfa.
[0003] At present, alfalfa breeding in China is still in the stage of conventional breeding, and the excavation and identification of important traits such as the number of branches are not deep enough. By studying the genes related to the number of branches and their regulatory mechanisms, molecular markers tightly linked to branch traits can be developed for molecular marker-assisted breeding to improve breeding efficiency and accuracy.
[0004] The traditional breeding of new alfalfa varieties with more branches is based on single-plant selection according to the number of branches in breeding offspring. This method is time-consuming and laborious, and the accuracy is not high. Using the base differences existing in target genes to develop specific molecular markers for assisted selection is the best method to improve selection efficiency. Kompetitive Allele-Specific PCR (KASP) molecular marker is a new type of SNP genotyping method based on allele-specific amplification (Amplification Refractory Mutation System, ARMS) and highly sensitive fluorescence detection. Its principle is to design two forward primers and a common reverse primer for the allele SNP locus. Each forward primer has a specific sequence and can be combined with different fluorescent labels. The forward primers with sequences combined with different fluorescences and the common reverse primer are used for PCR amplification of the DNA of the sample to be tested, and its allelic variation can be reflected by different fluorescent signals (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75-86).
[0005] Therefore, developing KASP markers tightly linked to the number of branches of alfalfa for early breeding selection is crucial for reducing breeding workload and accelerating high-yield breeding of alfalfa, and at the same time, the economic benefits are obvious. Summary of the Invention
[0006] The technical problem solved by the present invention is that the traditional breeding of new alfalfa varieties with more branches is based on single-plant selection according to the number of branches in breeding offspring. This method is time-consuming and laborious, and the accuracy is not high.
[0007] The technical solution of the present invention is a molecular marker related to the number of branches of alfalfa, and the specific information is as follows: Specific information: Chromosome: chr2; Location: 57649197; SNP typing: C / A.
[0008] Furthermore, the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1 or SEQ ID No.2.
[0009] The present invention also provides a primer combination for amplifying the molecular marker, and its nucleotide sequence is as shown in SEQ ID No.3-5.
[0010] The present invention also provides a molecular marker detection kit, including the primers shown in SEQ ID No.3-5.
[0011] The present invention also provides a molecular marker chip, including the primers shown in SEQ ID No.3-5.
[0012] The present invention also provides the application of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following:
[0013] a. Predicting the alfalfa branching index;
[0014] b. Identifying and screening alfalfa with different numbers of branches;
[0015] c. Molecular marker-assisted breeding of alfalfa;
[0016] d. Alfalfa breeding;
[0017] e. Preparing products for alfalfa breeding.
[0018] The present invention also provides a method for screening alfalfa materials with different numbers of branches, including the following steps: Extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker using the primers described in SEQ ID No.3-5, sequencing the amplification product, and screening by typing.
[0019] Specifically, the amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, and the annealing and extension temperature decreases by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.
[0020] Particularly, the criteria for screening by typing are as follows: If the typing result is AA, it is a material with a large number of branches; if the typing result is AC or CC, it is a material with a small number of branches.
[0021] Beneficial effects of the present invention: The present invention found a site (Chr2_57649197) significantly associated with the number of alfalfa branches near 57.64Mb of chromosome 2, with an LOD value of 7.23 and an explainable phenotypic contribution rate of 11.25%. A primer combination was designed for the site. The KASP primer combination developed by the present invention can directly distinguish and detect the A or C base of the SNP mutation site specifically, has good application value, can realize the pre-selection and molecular-assisted breeding of the number of alfalfa branches, and has important theoretical and practical significance for improving the selection efficiency. The molecular marker of the present invention has good application value, can realize the pre-selection and molecular-assisted breeding of the number of alfalfa branches trait, and has important theoretical and practical significance for accelerating the genetic improvement process of breeding materials with suitable number of branches and improving the selection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 GWAS found that the Chr2_57649197 site was significantly associated with the number of branches.
[0023] Figure 2 , KASP marker typing results, red represents AA genotype, purple represents AC genotype, and blue represents CC genotype.
[0024] Figure 3 , comparison of branches between different genotype materials. DETAILED DESCRIPTION
[0025] In order to further explain the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the specific implementation mode, structure, characteristics and effects of the present invention are described in detail below in combination with the accompanying drawings and preferred embodiments.
[0026] Example 1 Acquisition of molecular markers
[0027] This experimental population consists of 150 alfalfa germplasm materials, including core germplasm, germplasm from different regions and with different phenotypes. Taking into account the differences between different plants of the same variety of alfalfa, this study cut branches from the germplasm resource nursery in 2021 and carried out cuttings in the greenhouse. After the cuttings successfully took root, these germplasm materials were transplanted to experimental fields in Langfang, Hebei and Changping, Beijing. In these experimental sites, the establishment of the experimental population adopted a randomized block design, with three replications set up, each replication containing 10 cuttings. In order to ensure sufficient growth space, the interval between replications was 150 cm, and the distances between rows and plants were set to 150 cm and 60 cm, respectively. During the growth period, no fertilization and irrigation measures were carried out, only manual weeding was carried out. In order to help the plants overwinter, winter watering was carried out.
[0028] At the early flowering stage, the branch number of each alfalfa germplasm was counted using the manual counting method. After obtaining the branch numbers of different replicates and different environments for each material, the average value was calculated. This was used for subsequent GWAS analysis.
[0029] 100 mg of young alfalfa leaves were selected, quickly frozen in liquid nitrogen and then stored. Subsequently, the total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro-spectrophotometer (Nano Photometer NP80, Germany), and then sequencing was performed on the BGI DNBSEQ second-generation sequencing platform (BGI, Shenzhen, China).
[0030] Approximately 36 GB of raw data was obtained for each material. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) to remove adapters and filter out low-quality base sequences. Subsequently, the cleaned sequencing data was aligned to the haplotype reference genome of Medicago sativa 'Zhongmu No. 1' using BWA-MEM. SAMtools (version 1.13) was used to filter out multi-mapped and low-quality sequences, resulting in a filtered BAM file that was then sorted. The Mark Duplicates function in the Picard toolkit (version 2.23.0) was used to mark PCR duplicates. Finally, the processed BAM file was used with GATK Haplotype Caller (version 4.2.3.062) for variant calling. In the SNP filtering strategy, the following parameters were set as screening criteria: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, Strand Odds Ratio (SOR) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the screening conditions for a subset of Medicago sativa SNP markers were defined, including: (1) removing SNP markers with a missing rate greater than 20% and a Minor Allele Frequency (MAF) less than 0.05% using VCFtools (version 0.1.16) to create a basic SNP set containing only biallelic SNP markers; (2) performing Linkage Disequilibrium (LD)-based filtering on this basic SNP set using Plink (version 1.90b6.21), setting the window size for LD filtering to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2 to obtain a core SNP marker set. Missing genotypes in the SNP marker set after LD filtering were imputed using Beagle software with default parameters. Similarly, Indel markers were filtered using VCFtools, retaining only biallelic markers with a missing rate less than 20% and a MAF greater than 0.05%.
[0031] GWAS analysis was performed using 1,303,375 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, multiple software and statistical models were employed: TASSEL 5.0 (GLM and MLM) (Bradbury P J et al., 2007), BLINK (v1.01) (Huang et al., 2019). The Q-Q plot (quantile-quantile plot) was used to measure the reliability of the model. By comparing the Q-Q plots generated by different models, we found that the GLM model in TASSEL 5.0 performed better. Therefore, the GLM model of TASSEL 5.0 was selected to present our final results. Principal component analysis was conducted on the SNP data, and the first three principal component variables were used as covariates to correct the population structure. The Manhattan plot was visualized using the R package CMplot (Yin et al., 2021). Association SNP linkage disequilibrium (LD) analysis was calculated using LDBlockShow (Dong et al., 2021) and the data was visualized. A locus significantly associated with the number of branches in alfalfa (Chr2_57649197) was found near 57.64 Mb on chromosome 2, with an LOD value of 7.23 and a phenotypic contribution rate of 11.25% that could be explained ( Figure 1 ).
[0032] Example 2 Development of KASP markers for the Chr2_57649197 locus
[0033] The Chr2_57649197 locus is near 57.64 Mb on chromosome 2. Specific information: chromosome: chr2; position: 57649197; SNP typing: C / A.
[0034] Approximately 200 bp sequences upstream and downstream of the Chr2_57649197 locus were obtained from the reference genome "Zhongmu No. 1":
[0035] SEQ ID No.1, where lowercase letters represent the SNP locus;
[0036] TCCTTGCGTGACTAGCTTTAGTTGTCCAAGAAGTACGTGCTTCCCTCCTTCAACACCAAATTGCATTCGTCGTATTTGTGAATGCATCTAAGTATAACAATTAAGTTAAAAAATAATGTTATGTTGCTTGTAATCCAACAATTTTATATAATGTTGCTACTCCTATAATTTTCCTCACTTTTATTTGTATTTTTGTCCTTTaAACTCATTTGCTTGATTTAGAACTCTCATTAGGGGGATTAGTGGACGATCTTAGTACTTGTTAGGCAGGCCTTACTAATTGCTAGTGGCCTTTACTTTTAGTGCTTATGTTCTATAAATTAGACACATTGGGTTGTAAATGATACACCTTAAAGAATACAATACGATCTTGTTCACTTTTTGTTCTTCCACCTTCATCTATATTCTTCTAATAT。
[0037] SEQ ID No.2, where lowercase letters represent SNP sites;
[0038] TCCTTGCGTGACTAGCTTTAGTTGTCCAAGAAGTACGTGCTTCCCTCCTTCAACACCAAATTGCATTCGTCGTATTTGTGAATGCATCTAAGTATAACAATTAAGTTAAAAAATAATGTTATGTTGCTTGTAATCCAACAATTTTATATAATGTTGCTACTCCTATAATTTTCCTCACTTTTATTTGTATTTTTGTCCTTTcAACTCATTTGCTTGATTTAGAACTCTCATTAGGGGGATTAGTGGACGATCTTAGTACTTGTTAGGCAGGCCTTACTAATTGCTAGTGGCCTTTACTTTTAGTGCTTATGTTCTATAAATTAGACACATTGGGTTGTAAATGATACACCTTAAAGAATACAATACGATCTTGTTCACTTTTTGTTCTTCCACCTTCATCTATATTCTTCTAATAT。
[0039] Using Bacthprimer 3 software, KASP primers were designed for the Chr2_57649197 locus and its flanking sequences (SEQ ID No.1 and SEQ ID No.2). Each set of KASP markers consists of 2 specific primers and 1 common primer. Fluorescent linker sequences were attached to the 5' ends of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent linker sequence).
[0040] The KASP marker primers are as follows:
[0041] Specific primer 1 (SEQ ID No.3): GAAGGTGACCAAGTTCATGCTTGAGAGTTCTAAATCAAGCAAATGAGTTT;
[0042] Specific primer 2 (SEQ ID No.4): GAAGGTCGGAGTCAACGGATTGAGAGTTCTAAATCAAGCAAATGAGTTG;
[0043] Common primer (SEQ ID No.5): TGTTGCTACTCCTATAATTTTCCTCACTT.
[0044] Example 3 Use of Molecular Markers
[0045] Another 99 alfalfa materials were taken, planted, sampled, and DNA was extracted using the method in Example 1, and then analyzed on the Array Tape system of Douglas Scientific Company. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.
[0046] NEXAR was used for PCR system assembly, and the PCR reaction system is shown in Table 1.
[0047] Table 1 KASP Reaction System
[0048] PCR amplification was performed using SOELLEX. The Touch down PCR amplification conditions were as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.
[0049] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then data analysis and genotype typing were performed using INTELLICS. The marker typing is as Figure 2 shown, where the red ones are AA allele genotypes, the purple ones are A / C allele genotypes, and the blue ones are CC allele genotypes. The allele types of 99 materials at this locus are shown in Table 2. At the same time, the number of branches of each material was counted. The germplasm with AA allele genotype had a higher number of branches (average value was 72.06), the average number of branches of germplasm with A / C allele genotype was 49.06, and the germplasm with CC allele genotype had the lowest number of branches, which was 45.16 ( Figure 3 ).
[0050] Table 2 Allele types of 99 germplasm materials at this locus
[0051]
[0052] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to the above-disclosed technical content to obtain equivalent embodiments with equivalent changes, but as long as it does not depart from the technical content of the present invention, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A molecular marker related to the branching number of alfalfa, characterized in that: The nucleotide sequence of the molecular marker is shown as SEQ ID No.1 or SEQ ID No.
2.
2. The primer combination for amplifying the molecular marker according to claim 1, characterized in that: Its nucleotide sequence is shown as SEQ ID No.3 - 5.
3. A molecular marker detection kit, characterized in that: It includes the primers shown as SEQ ID No.3 - 5.
4. A molecular marker chip, characterized in that: It includes the primers shown as SEQ ID No.3 - 5.
5. Use of the primer combination according to claim 2, the kit according to claim 3 and / or the molecular marker chip according to claim 4 in any one of the following: a. Predicting the number of branches of alfalfa; b. Identifying and screening alfalfa with different numbers of branches; c. Molecular marker-assisted breeding of alfalfa materials with different numbers of branches; d. Breeding of alfalfa materials with different numbers of branches; e. Preparing products for breeding alfalfa with different numbers of branches; Moreover, if the genotyping result is AA, it is an alfalfa material with a large number of branches; if the genotyping result is AC or CC, it is an alfalfa material with a small number of branches.
6. A method for screening alfalfa materials with different branch numbers or predicting the branch number of alfalfa, characterized in that: It includes the following steps: extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker using the primers shown as SEQ ID No.3 - 5, sequencing the amplification product, and genotyping and screening; the criteria for the genotyping and screening are as follows: if the genotyping result is AA, it is a material with a large number of branches; if the genotyping result is AC or CC, it is a material with a small number of branches.
7. The method according to claim 6, characterized in that: The amplification procedure is as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker closely linked with alfalfa branching character and application of SNP molecular marker
CN118813859A