Molecular markers related to the crude protein content of alfalfa and their applications

Abstract

The present invention belongs to the technical field of molecular biology, and particularly relates to molecular markers related to the crude protein content of alfalfa and their applications. The technical problem solved by the present invention is that the breeding of new alfalfa varieties with traditional high protein and high quality is based on single-plant selection according to the crude protein content of breeding offspring, which is time-consuming, laborious and inaccurate. The technical solution of the present invention is a molecular marker related to the crude protein content of alfalfa, and the specific information is as follows: chromosome: chr3; position: 25995949; SNP typing: C / A. The present invention also designs a primer combination for this molecular marker, which can directly and specifically distinguish and detect the A or C base at the SNP mutation site.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to crude protein content of alfalfa and an application thereof. Background Art

[0002] Alfalfa (Medicago sativa), the "king of forage grasses", has high protein content and excellent feeding value. Its crude protein content can reach about 20%, making it an important high-quality forage for herbivores such as dairy cows. Molecular markers can accurately locate genes related to crude protein content, providing a theoretical basis for the selection and breeding of high-protein alfalfa varieties. Molecular marker-assisted breeding can quickly screen out high-protein varieties and improve breeding efficiency.

[0003] Traditionally, the breeding of new high-protein and high-quality alfalfa varieties is based on single-plant selection based on the crude protein content of the breeding offspring. This method is time-consuming, labor-intensive, and inaccurate. The best way to improve selection efficiency is to develop specific molecular markers for auxiliary selection using the base differences in the target gene. Competitive allele-specific PCR (Kompetitive Allele-Specific PCR, KASP) molecular markers are a new SNP typing method based on allele-specific amplification (Amplification Refractory Mutation System, ARMS) and highly sensitive fluorescence detection. The principle is to design two forward primers and a universal reverse primer for the allele SNP site. Each forward primer has a specific sequence that can be combined with different fluorescent markers. The DNA of the sample to be tested is amplified by PCR using forward primers with different fluorescent binding sequences and universal reverse primers, and its allelic variation can be reflected by different fluorescent signals (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75-86).

[0004] Therefore, developing KASP markers that are closely linked to the crude protein content of alfalfa for use in early selection in breeding is crucial to reducing the workload of breeding and accelerating the breeding of high-quality alfalfa, while also having obvious economic benefits. Summary of the invention

[0005] The technical problem solved by the invention is that the traditional breeding of high-protein and high-quality alfalfa new varieties is to select individual plants according to the crude protein content of breeding offspring, which is time-consuming, labor-intensive and has low accuracy.

[0006] The technical solution of the present invention is a molecular marker related to the crude protein content of alfalfa, and the specific information is as follows: chromosome: chr3; position: 25995949; SNP typing: C / A.

[0007] Furthermore, the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1 or SEQ ID No.2.

[0008] The present invention also provides a primer combination for amplifying the molecular marker, and its nucleotide sequence is as shown in SEQ ID No.3-5.

[0009] The present invention also provides a molecular marker detection kit, including the primers shown in SEQ ID No.3-5.

[0010] The present invention also provides a molecular marker chip, including the primers shown in SEQ ID No.3-5.

[0011] The present invention also provides the application of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following:

[0012] a. Predicting the crude protein content of alfalfa;

[0013] b. Identifying and screening alfalfa with different crude protein contents;

[0014] c. Breeding alfalfa with high crude protein content;

[0015] d. Molecular marker-assisted breeding of alfalfa;

[0016] e. Breeding of alfalfa;

[0017] f. Preparing products for alfalfa breeding.

[0018] The present invention also provides a method for screening alfalfa materials with different crude protein contents or predicting the crude protein content of alfalfa, including the following steps: extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker using the primers described in SEQ ID No.3-5, sequencing the amplification product, and performing typing and screening.

[0019] Specifically, the amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, and the annealing and extension temperature decreases by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 10 cycles.

[0020] Especially, the criteria for typing and screening are as follows: if the typing result is AA or AC, it is a low crude protein material; if the typing result is CC, it is a high crude protein material.

[0021] Advantages of the present invention: Through a large amount of material and data analysis, the present invention obtained a locus (Chr3_25995949) significantly associated with the crude protein content of alfalfa, with an LOD value of 8.39 and a phenotypic contribution rate of 12.13% that can be explained. And a primer combination was designed for this locus. The KASP primer combination developed by the present invention can directly and specifically distinguish and detect the A or C base at the SNP mutation site, has good application value, can realize the pre-selection of the crude protein content of alfalfa and molecular-assisted breeding, and has important theoretical and practical significance for improving the selection efficiency. The molecular marker of the present invention has good application value, can realize the pre-selection of the crude protein content trait of alfalfa and molecular-assisted breeding, and has important theoretical and practical significance for accelerating the genetic improvement process of breeding for crude protein content and improving the selection efficiency. Brief Description of the Drawings

[0022] Figure 1 GWAS found that the locus Chr3_25995949 was significantly associated with the crude protein content.

[0023] Figure 2 KASP marker genotyping results, red represents the AA genotype, purple represents the AC genotype, and blue represents the CC genotype.

[0024] Figure 3 Comparison of crude protein content among materials with different genotypes. Detailed Embodiments

[0025] To further elaborate on the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the following combines the drawings and preferred embodiments to detail the specific embodiments, structures, features and their effects of the present invention as follows.

[0026] Example 1 Obtaining of Molecular Marker

[0027] This experimental population consisted of 150 alfalfa germplasm materials, including core germplasm, germplasm from different regions with different phenotypes. Considering the differences among different individual plants within the same alfalfa variety, branches were cut from the germplasm resource nursery in 2021 and cuttings were carried out in the greenhouse. After successful rooting of the cuttings, these germplasm materials were transplanted to experimental fields in Langfang, Hebei and Changping, Beijing. In these experimental fields, the experimental population was established using a randomized block design, with three replicates, and each replicate contained 10 cutting single plants. To ensure sufficient growth space, the interval between replicates was 150 cm, and the row spacing and plant spacing were set at 150 cm and 60 cm respectively. During the growth period, no fertilization and irrigation measures were taken, and only manual weeding was carried out. To help the plants survive the winter, winter water was irrigated.

[0028] Alfalfa was harvested at the early flowering stage in two experimental plots. After harvesting, the whole alfalfa plants were placed in a nylon net belt and air-dried in a ventilated and shady greenhouse, avoiding direct sunlight, until their branches became brittle and easy to break. Then, these samples were placed in a constant temperature oven and dried thoroughly at 60 °C for 6 hours. After drying, they were crushed using a cyclone mill to a particle size that could pass through a 40-mesh sieve, sealed in a self-sealing bag (kept dry and avoiding direct sunlight) for subsequent determination, and then the crude protein content was determined using a FOSS near-infrared analyzer NIRS D2500F (FOSS, Denmark) (three technical replicates, taking the average).

[0029] 100 mg of young alfalfa leaves were selected, quickly frozen in liquid nitrogen and stored. Subsequently, the total plant DNA was extracted using a CWBIO plant genomic DNA extraction kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro-spectrophotometer (Nano Photometer NP80, Germany), and then sequencing was performed on the BGI DNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0030] Approximately 36 GB of raw data was obtained for each material. The raw sequencing data was processed by Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove adapters and filter out low-quality base sequences. Subsequently, the cleaned sequencing data was aligned to the haplotype reference genome of Medicago sativa 'Zhongmu No. 1' using BWA-MEM. SAMtools (version 1.13) was used to filter out multi-mapped and low-quality sequences, resulting in a filtered BAM file that was sorted. The Mark Duplicates function in the Picard toolkit (version 2.23.0) was used to mark PCR duplicates. Finally, the processed BAM file was used with GATK Haplotype Caller (version 4.2.3.062) for variant detection. In the filtering strategy for SNPs, the following parameters were set as screening criteria: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, Strand Odds Ratio (SOR) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the screening conditions for a subset of Medicago sativa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a missing rate greater than 20% and a Minor Allele Frequency (MAF) less than 0.05% to create a basic SNP set containing only bi-allelic SNP markers; (2) performing LD-based filtering on this basic SNP set using Plink (version 1.90b6.21), setting the window size for LD filtering to 100 SNPs, the window step to 50 SNPs, and the r2 threshold to 0.2 to obtain a core SNP marker set. Missing genotypes in the SNP marker set after LD filtering were imputed using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only bi-allelic markers with a missing rate less than 20% and a MAF greater than 0.05%.

[0031] GWAS analysis was performed using 1,303,375 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, multiple software and statistical models were employed: TASSEL 5.0 (GLM and MLM) (Bradbury P J et al., 2007), BLINK (v1.01) (Huang et al., 2019). The Q-Q plot (quantile-quantile plot) was used to measure the reliability of the model. By comparing the Q-Q plots generated by different models, it was found that the GLM model in TASSEL 5.0 performed better. Therefore, the GLM model of TASSEL 5.0 was selected to display the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct the population structure. The Manhattan plot was visualized using the R package CMplot (Yin et al., 2021). Association SNP linkage disequilibrium (LD) analysis was calculated using LDBlockShow (Dong et al., 2021) and the data was visualized. A locus significantly associated with the crude protein content of alfalfa (Chr3_25995949) was found near 25.99 Mb on chromosome 3, with an LOD value of 8.39 and a phenotypic contribution rate of 12.13% that could be explained (see Figure 1 ).

[0032] Example 2 Development of KASP markers for the Chr3_25995949 locus

[0033] The Chr3_25995949 locus is near 25.99 Mb on chromosome 3. Specific information: chromosome: chr3; position: 25995949; SNP typing: C / A.

[0034] Approximately 200 bp sequences upstream and downstream of the Chr3_25995949 locus were obtained from the reference genome "Zhongmu No. 1":

[0035] SEQ ID No.1, where lowercase letters represent the SNP locus;

[0036] CAAGATTTCTTCAAGTGTTCTTTAGAACATGATATTAGAAATGCACATATAACCAAAGAAACATGAATCTCAACAACACCATGTGTCAAAGATTTCACTATGGTAAGAAGTACTTCAAAATAATATCAAAAGCATCTCATCTCAGAAGTTAAGATTCAGATTTTTGAAGAAAAGAATGAAAACCAAATGTACTTTAGGTTTCAGaTCAAGTAGATCATAATTCCAAATTAAGGGATAGAAAGGATTGAAGTTCTATAAATCATAAGCAGATCATCATGACATCGGAAGTAGAAATTTATAAAAACATCAAATGAATTGATGGAATAAACATGCCTAAGTGTACACCATATGATCAAAATAAAAGATCATAAGCTAGAAGTCAAATAACAAGGAATAACAACTAGTTTCTAGAGTTACTTGGTGATCAAGGCAAGC。

[0037] SEQ ID No.2, where lowercase letters represent SNP sites;

[0038] CAAGATTTCTTCAAGTGTTCTTTAGAACATGATATTAGAAATGCACATATAACCAAAGAAACATGAATCTCAACAACACCATGTGTCAAAGATTTCACTATGGTAAGAAGTACTTCAAAATAATATCAAAAGCATCTCATCTCAGAAGTTAAGATTCAGATTTTTGAAGAAAAGAATGAAAACCAAATGTACTTTAGGTTTCAGcTCAAGTAGATCATAATTCCAAATTAAGGGATAGAAAGGATTGAAGTTCTATAAATCATAAGCAGATCATCATGACATCGGAAGTAGAAATTTATAAAAACATCAAATGAATTGATGGAATAAACATGCCTAAGTGTACACCATATGATCAAAATAAAAGATCATAAGCTAGAAGTCAAATAACAAGGAATAACAACTAGTTTCTAGAGTTACTTGGTGATCAAGGCAAGC。

[0039] Using Bacthprimer 3 software, KASP primers were designed for the Chr3_25995949 locus and its flanking sequences (SEQ ID No.1 and SEQ ID No.2). Each set of KASP markers consists of 2 specific primers and 1 common primer. Fluorescent linker sequences were attached to the 5' ends of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent linker sequence).

[0040] The KASP marker primers are as follows:

[0041] Specific primer 1 (SEQ ID No.3): GAAGGTGACCAAGTTCATGCTCCCTTAATTTGGAATTATGATCTACTTGAT;

[0042] Specific primer 2 (SEQ ID No.4): GAAGGTCGGAGTCAACGGATTCCCTTAATTTGGAATTATGATCTACTTGAG;

[0043] Common primer (SEQ ID No.5): GCATCTCATCTCAGAAGTTAAGATTCAGA.

[0044] Example 3 Use of Molecular Markers

[0045] Another 87 alfalfa materials were taken, planted, sampled, and DNA was extracted using the method in Example 1, and then analyzed on the Array Tape system of Douglas Scientific Company. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0046] Use NEXAR to assemble the PCR system, and the PCR reaction system is shown in Table 1.

[0047] Table 1 KASP reaction system

[0048] PCR amplification was performed using SOELLEX, and the Touch down PCR amplification conditions were as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

[0049] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then data analysis and genotype typing were performed using INTELLICS. The schematic diagram of marker typing is as shown in Figure 2 which, where the red ones are AA allele genotypes, the purple ones are A / C allele genotypes, and the blue ones are CC allele genotypes. The allele types of 87 materials at this locus are shown in Table 2. At the same time, the crude protein content of each material was measured using the FOSS near-infrared analyzer NIRS D2500F (FOSS, Denmark) (technical replicates were performed three times, and the average value was taken). The germplasm with the CC allele genotype had a relatively high crude protein content (average value of 21.72%), the average crude protein content of the germplasm with the A / C allele genotype was 17.22%, and the germplasm with the AA allele genotype had the lowest crude protein content, which was 17.11% ( Figure 3 ).

[0050] Table 2 Allele types of 87 germplasm materials at this locus

[0051]

[0052] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to the above-disclosed technical content to obtain equivalent embodiments with equivalent changes, but as long as they do not depart from the technical content of the present invention, any brief modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A molecular marker related to the crude protein content of alfalfa, characterized in that: The nucleotide sequences of the molecular markers are shown in SEQ ID No.1 and SEQ ID No.

2.

2. A primer combination for KASP genotyping of the molecular marker according to claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID No.3-5.

3. A molecular marker detection kit, characterized in that: It includes the primers shown in SEQ ID No.3-5.

4. Use of the molecular marker according to claim 1, the primer combination according to claim 2, or the kit according to claim 3 in any one of the following: a. Predicting the crude protein content of alfalfa; b. Identifying and screening alfalfa with different crude protein contents; c. Breeding alfalfa with high crude protein content; d. Molecular marker-assisted breeding of alfalfa; e. Alfalfa breeding.

5. A method for screening alfalfa materials with different crude protein contents or predicting the crude protein content of alfalfa, characterized in that: It includes the following steps: extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker using the primers shown in SEQ ID No.3-5, sequencing the amplification product, and performing genotyping screening.

6. The method according to claim 5, characterized in that: The amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, and the annealing and extension temperature decreases by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

7. The method according to claim 5, wherein: The criteria for the genotyping screening are as follows: If the genotyping result is AA or AC, it is a low crude protein material; if the genotyping result is CC, it is a high crude protein material.

Images