Intermediate silk protein as biomarker for predicting stage, prognosis and drug resistance of renal clear cell carcinoma and application of intermediate silk protein

Abstract

The invention discloses an intermediate silk protein as a biomarker for predicting the staging, prognosis and drug resistance of renal clear cell carcinoma and application of the intermediate silk protein. By detecting the IFFO1 expression level of a ccRCC patient tissue specimen and analyzing a database, a new insight is provided for taking the expression quantity of the IFFO1 as a ccRCC biomarker. By changing the expression level of IFFO1 in the cell, the increase in proliferation, transfer and clone generation of the ccRCC cell as well as the improvement in genome stability are detected. In addition, after the IFFO1 is expressed in the ccRCC cells, the tolerance degree to sunitinib is increased, and the expression quantity of the IFFO protein family in the constructed ccRCC drug-resistant cells is increased. Researches show that the IFFO protein in ccRCC stabilizes a genome and promotes the tolerance of cells to a DNA damage inducer and a tyrosine kinase inhibitor sunitinib, molecular mechanism research and drug development taking IFFO as a target spot are beneficial to improvement of a treatment effect, and the IFFO protein has clear and beneficial practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedical detection, and in particular is an intermediate filament protein as a biomarker for predicting the staging, prognosis and drug resistance of renal clear cell carcinoma and its application. Background Art

[0002] Renal cell carcinoma (RCC) is a heterogeneous tumor originating from the renal tubular epithelium and is one of the top ten most common cancers in the world. In 2020, more than 400,000 new cases of RCC were reported worldwide, of which about 75% were clear cell renal cell carcinoma (ccRCC). Partial or radical nephrectomy, ablation, and radiological monitoring are the main treatments for ccRCC, but the 5-year recurrence rate of patients after surgery is close to 60%, and 30% of ccRCC patients will eventually develop metastases. Previous studies have shown that ccRCC has innate resistance to conventional chemotherapy and molecular targeted therapy, and mutations in the Von Hippel-Lindau (VHL) gene have been detected in more than 50% of patients diagnosed with ccRCC, which causes hypoxia-inducible factor (HIF) to accumulate in cells and promote tumor resistance by promoting the formation of platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and multidrug resistance pumps. Therefore, it is very important to clarify the biomarkers associated with ccRCC resistance for the application of therapeutic drugs for ccRCC.

[0003] Protein tyrosine kinases are involved in multiple signaling pathways of cell growth, differentiation, and metabolism. Growth factors VEGF and PDGF in the blood bind to receptor tyrosine kinases on ccRCC cells, thereby transmitting proliferation and survival signals to tumor cells. In 2006, Europe approved the tyrosine kinase inhibitor (TKI) sunitinib as a treatment for advanced RCC. This drug is also one of the first TKIs approved for the treatment of metastatic RCC. In clinical applications, the prognosis of patients with advanced or metastatic ccRCC has been significantly improved after treatment with sunitinib, but approximately 20% of patients will develop innate resistance when they first receive sunitinib treatment, and most patients will develop secondary resistance after 6-11 months of treatment. Some studies have revealed factors associated with sunitinib resistance in ccRCC, including (1) activated HIF in ccRCC helps cells adapt to the hypoxic tumor microenvironment, inducing cell quiescence and increasing treatment tolerance; (2) anti-angiogenic therapy used in ccRCC treatment causes secondary hypoxia and bypass activation, leading to the production of several VEGF- and PDGF-independent pro-angiogenic factors and acquisition of drug resistance; (3) high immune infiltration is associated with poor drug response to sunitinib. However, these predictive factors are not sufficient to accurately distinguish patients with sensitivity, and the exact molecular mechanism of sunitinib resistance in ccRCC has not yet been elucidated. Therefore, it is necessary to find more reliable biomarkers to predict sunitinib sensitivity and patient prognosis.

[0004] Intermediate filaments are one of the components of the cytoskeleton and are important for maintaining cell structure and morphology, as well as achieving functional maintenance. Intermediate filaments are polymers encoded by more than 70 different genes, with remarkable versatility and cell type specificity. The absence or mutation of different intermediate filament proteins is closely related to a variety of human diseases. The intermediate filament protein IFFO family consists of two proteins, IFFO1 and IFFO2, whose expression levels and functions in ccRCC have not yet been studied. Summary of the invention

[0005] Based on existing research, the inventors have provided the application of IFFO1 in maintaining the genomic stability of ccRCC and promoting the sensitivity of ccRCC cells to sunitinib after long-term technical exploration and experimental verification. Specifically, the present invention provides new insights into the expression of IFFO1 as a ccRCC biomarker by detecting the expression level of IFFO1 in tissue specimens of ccRCC patients and analyzing the database. By changing the expression level of IFFO1 in cells, an increase in ccRCC cell proliferation, metastasis and clonal generation, as well as an improvement in genomic stability were detected. In addition, after expressing IFFO1 in ccRCC cells, the tolerance to sunitinib increased, and the expression of the IFFO protein family in the constructed ccRCC resistant cells increased. Based on the above research results, the present invention is completed.

[0006] To this end, the technical solution adopted by the present invention includes:

[0007] In a first aspect, the present invention provides the use of intermediate filament protein as a biomarker for predicting the staging and prognosis of renal clear cell carcinoma.

[0008] Furthermore, the intermediate filament protein is IFFO1.

[0009] More specifically, it also includes a product for detecting the expression level of IFFO1, and the product includes an IFFO1 antibody.

[0010] Specifically, the present invention found that compared with adjacent normal tissues, the expression of IFFO1 in tumor tissues was significantly increased, and the overall survival (OS), disease-specific survival (DSS) and disease-free interval (PFI) of ccRCC patients with high IFFO1 expression were shorter. Therefore, the product (detection kit or detection device) for detecting the expression level of IFFO1 can evaluate the staging and prognosis of ccRCC patients.

[0011] In a second aspect, the present invention provides the use of IFFO1 as a biomarker in the preparation of a product for predicting the staging and prognosis of renal clear cell carcinoma.

[0012] In a third aspect, the present invention provides the use of IFFO1 in the preparation of a product for predicting drug resistance of renal clear cell carcinoma.

[0013] Specifically, the drug used to treat renal clear cell carcinoma is sunitinib.

[0014] In a third aspect, the present invention provides the use of IFFO1 in the preparation or screening of a therapeutic drug for renal clear cell carcinoma, wherein the therapeutic drug comprises an intervening antibody or protein inhibitor targeting IFFO1. IFFO1 inhibitors can improve the drug resistance of ccRCC to sunitinib.

[0015] Furthermore, the IFFO1 inhibitor described in the present invention can also be combined with DNA damage inducers such as cisplatin to prepare ccRCC drugs.

[0016] Compared with the prior art solutions, the technical solution of the present invention can bring the following beneficial effects:

[0017] The above technical scheme is the first study to show that the intermediate filament protein IFFO1 is overexpressed in ccRCC tumor tissue and serves as a key molecule for stabilizing the genome. Overexpression of IFFO1 in cells will promote the malignant progression of ccRCC and enhance the tolerance of ccRCC to sunitinib. Therefore, IFFO1 can be used as a potential intervention target for the treatment of ccRCC. The present invention's research shows that IFFO1 promotes cell tolerance to DNA damage inducers and tyrosine kinase inhibitors, sunitinib, in ccRCC by stabilizing the genome. Molecular mechanism research and drug development targeting IFFO1 help improve the therapeutic effect and have clear and beneficial practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The high expression of IFFO1 in ccRCC tumor tissues;

[0019] Figure 2 is the relationship between IFFO1 expression and different tumor stages;

[0020] Figure 3 This is the proliferation and migration detection of IFFO1 knockdown and overexpression cells. In the figure, shCon represents the control lentivirus group, and shRNA-1 and shRNA-2 represent the two lentivirus groups for knockdown of IFFO1.

[0021] Figure 4 The effect of IFFO1 on genome stability;

[0022] Figure 5 The effect of IFFO1 on the drug response of sunitinib;

[0023] Figure 6 The interacting protein network of IFFO1 in ccRCC cells;

[0024] Figure 7 This is a diagram showing the changes in signaling pathways in ccRCC cells resistant to sunitinib. DETAILED DESCRIPTION

[0025] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0026] Embodiment 1, materials and methods of the present invention

[0027] 1.1 Tissue microarray

[0028] This invention has been approved by the Ethics Committee of Chongqing Medical University (approval number 2024036). Tissue microarrays containing cancer and adjacent tissue samples were obtained from Shanghai Aotu Biotechnology Co., Ltd. (catalog number HKidE180Su02). The expression of IFFO1 was determined by immunohistochemical staining (antibodies from Proteintech).

[0029] 1.2 Data Source

[0030] RNA-seq data were obtained from TCGA (https: / / portal.gdc.cancer.gov / ) and GEO (https: / / www.ncbi.nlm.nih.gov / geo / ) databases, and the obtained data were standardized and log2 transformed. The affy package in R was used for data set normalization and background noise removal. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were performed for functional enrichment analysis of hub genes.

[0031] 1.3 Cell lines and plasmid transfection

[0032] 786-O and ACHN cell lines were purchased from Pricela Biotechnology. 786-O cells were cultured in RPMI-1640 medium (Pricela, Catalog No. PM150110). HEK-293 and ACHN cells were cultured in high-glucose DMEM medium (Pricela, Catalog No. PM150210). All cell culture media were supplemented with 10% fetal bovine serum (FBS) (Excell, Catalog No. FSP500) and 1% penicillin / streptomycin (10000 μg / mL, Gibco, Catalog No. 15140-122) and incubated at 37°C, 5% CO 2 HEK-293 cells were transfected with polyethyleneimine (PEI, Yeasen Biotechnology) and 786-O and ACHN cells were transfected with transfection reagent (Polyplus, catalog number 101000015).

[0033] 1.4 Western Blot

[0034] Digest the cells with trypsin (Gibco, catalog number 25200-072), collect the cells with culture medium, centrifuge the cells at 3000 rpm for 5 minutes, and retain the precipitate. Rinse the cell precipitate with pre-cooled PBS, centrifuge the mixture at 3000 rpm for 5 minutes, and retain the precipitate. Use RIPA lysis buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) to extract total protein from the washed cell precipitate. Mix the lysate with the cell precipitate thoroughly and lyse on ice for 15 minutes. Centrifuge the lysed mixture at 12000 rpm for 5 minutes, collect the supernatant, add one-quarter volume of 5X loading buffer (Yeasen, catalog number 20315ES05), mix well, and heat and boil at 95°C for 10 minutes. The extracted proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (Yazyme, catalog number PG111 and PG112) and then transferred to a polyvinylidene fluoride membrane (Millipore, catalog number IPVH00010). The transferred membrane was selected according to the protein size and blocked in a PBST solution containing 5% skimmed milk powder (PBS containing 0.1% Tween-20) for 1 hour. Subsequently, the membrane was incubated with the primary antibody overnight at 4°C, and the membrane was washed three times with PBST, each time on a horizontal shaker for 5 minutes. After that, it was incubated with the HRP-labeled secondary antibody at room temperature for 2 hours, and the membrane was washed three times with PBST, each time on a horizontal shaker for 5 minutes. A chemiluminescent ECL working solution was placed on the membrane, and the obtained signal was quantified using a fully automatic chemiluminescent gel imaging system (BIO-RAD, CANICES-3 (A) / NMB-3 (A)).

[0035] 1.5 Cell proliferation detection

[0036] The cultured 786-O and ACHN cells were trypsinized, centrifuged and counted. 2000 cells / well were plated in a 96-well plate and incubated at 37°C and 5% CO 2 The cells were cultured in a 4% PBS environment for 5 days. Metabolic activity of cells was determined daily using CCK-8 (MedChemExpress). 10% CCK-8 reagent was added to each well and incubated in an incubator for 3 hours. The absorbance was measured at 450 nm using an ELISA reader and the results were processed and analyzed using Graphpad Prism.

[0037] 1.6 Cell migration assay

[0038] Scratch assay and Transwell assay were used to detect cell migration. In the scratch assay, the treated cells were evenly plated in a 12-well plate at a density of 40%. When the cells grew to a density of 90%-100%, a blank area was scratched in the well with a pipette tip. The cells were then rinsed 3 times with PBS, the fallen cells were aspirated, and serum-free medium was added to continue culturing. Photos were taken at different time points, and the scratch area between cells was calculated. In the Transwell assay, the trypsin-digested cells were centrifuged and counted, and 20,000 cells were resuspended in serum-free medium. The Transwell chamber was placed in the culture plate, culture medium was added to the lower chamber, and the above-resuspended cells were added to the upper chamber. The cells were then incubated at 37°C and 5% CO 2 Culture in the environment for 24 hours. Carefully remove the chamber with tweezers, remove all the culture medium in the upper and lower chambers, wash the cells in the upper and lower chambers with PBS, and fix them with 4% paraformaldehyde for 15 minutes. Remove the paraformaldehyde and stain with 0.1% crystal violet stain for 15 minutes. Then wash the upper and lower chambers three times with PBS, and gently wipe all the cells in the upper chamber with a cotton swab. Take pictures and count the remaining cells attached to the lower layer of the Transwell chamber.

[0039] 1.7 Cell clone formation assay

[0040] The treated cells were trypsinized, centrifuged and counted. The cells were placed in a 6-well plate at a density of 200 cells / well. The 6-well plate was then placed at 37°C, 5% CO 2 Culture in the environment for 7-10 days until the cells grow into visible clones. After removing the culture medium, wash the cells once with PBS, fix them with 4% paraformaldehyde for 15 minutes, and then stain them with 0.1% crystal violet stain for 15 minutes. After the liquid in the 6-well plate is dried, take pictures and count.

[0041] 1.8 Immunofluorescence detection

[0042] The transfected cells were seeded on sterile glass slides (Servicebio, catalog number WG655) and incubated at 37°C and 5% CO 2 The cells were cultured in a PBS environment for 24 hours. After washing the cell slides three times with PBS, they were fixed with 4% paraformaldehyde for 15 minutes at room temperature. The cells were then incubated with PBS containing 0.5% Triton X-100 for 15 minutes, and then washed three times with PBS. The cells were incubated in PBS containing 5% bovine serum albumin (BSA), blocked for 1 hour at room temperature, and then incubated with the primary antibody overnight at 4°C. After washing the cells three times with PBST, the cells were incubated in a fluorescent secondary antibody, incubated in the dark at room temperature for 1 hour, and rinsed 3 times with PBST. Finally, the slides were mounted on a glass slide with a mounting medium (Beyotime, Cat. No. P0131) for microscopic imaging.

[0043] 1.9 Drug sensitivity testing

[0044] The transfected cells were trypsinized, centrifuged and counted. They were plated in a 96-well plate at a density of 4000 cells / well, and sunitinib was added at concentrations of 0 μM, 0.25 μM, 0.5 μM, 1 μM, 2.5 μM, 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM. After 48 hours of drug treatment, cell viability was detected by CCK-8.

[0045] 1.10 Co-immunoprecipitation and mass spectrometry identification

[0046] IFFO1 protein with Flag tag was expressed in HEK-293 cells. After collecting the cells, they were washed twice with pre-cooled PBS. The cells were then lysed with NTEN buffer (20mM Tris-HCl (pH 7.5), 10% glycerol, 150mM NaCl, 0.5% NP40 and 1mM PMSF). The cells were centrifuged at 14000rpm for 30 minutes at 4°C, and 50μL of supernatant was collected to prepare the input sample. The remaining supernatant was incubated overnight with 30μL anti-DYKDDDDK (Flag) affinity gel (Yeasen Biotechnology, Cat. No. 20584). The cells were washed four times with washing buffer (20mM Tis-HCl, pH7.5, 150mM NaCl, 10% glycerol, 1% Nonidet P40 and 2mM EDTA, pH 8.0). 1X loading buffer was added, mixed and heated to boil at 95°C for 10 minutes.

[0047] 1.11 Lentivirus transfection and knockdown cell construction

[0048] HEK-392 cells were transfected with lentiviral packaging vectors and short hairpin RNA (shRNA) targeting IFFO1 mRNA using PEI. The sequences of the two shRNAs were CGAGTACAAGCGGAGATGCTT and GCCTGGCTTGTCGTGGGTGCA, respectively. After 72 hours of transfection, the lentiviral particles in the cell culture supernatant were collected and used to infect ccRCC cells. The cells were selected with puromycin, and finally a cell line with stable knockdown of IFFO1 was obtained. Protein expression was verified by immunoblotting.

[0049] 1.12 Statistical analysis

[0050] The data of the present invention were analyzed using GraphPad Prism 9 software. The experiments were repeated at least three times independently under the same conditions. All immunoblots were performed at least three times. The data were analyzed using Student's t test and expressed as mean ± standard deviation. Statistical significance was determined as follows: ***p<0.001**p<0.01*p<0.05; not significant (ns) p>0.05.

[0051] The following examples respectively introduce the verification results of the present invention.

[0052] Example 2: IFFO1 is highly expressed in ccRCC tumor tissues

[0053] Using the TCGA database, the inventors analyzed the expression level of IFFO1 in ccRCC tumor tissues. RNA sequencing (RNA-seq) data from 613 tumor tissues and 72 adjacent normal tissues showed that the expression level of IFFO1 in ccRCC tumors was higher than that in normal tissues ( Figure 1 A). Kaplan-Meier survival curves were used to evaluate the potential impact of IFFO1 expression on the prognosis of cancer patients. In all ccRCC patients, IFFO1 expression was observed to be negatively correlated with overall survival (OS), disease-specific survival (DSS), and disease-free interval (PFI) ( Figure 1 B). In order to verify the expression of IFFO1 in ccRCC, the inventors obtained tissue microarrays containing cancer and adjacent tissue samples from Shanghai Aotu Biotechnology Co., Ltd. and performed immunohistochemical staining of IFFO1 on the ccRCC tissue microarray. The results of evaluation by pathologists showed that the expression of IFFO1 in the nucleus of ccRCC tumor tissue was higher than that in adjacent normal tissue ( Figure 1 C).

[0054] Example 3: High expression of IFFO1 is associated with poor prognosis of ccRCC

[0055] The ccRCC patients were grouped according to different stages, and the expression of IFFO1 in different groups was compared. The present study showed that with the increase of the involvement range of the primary tumor (T stage), distant metastasis (M stage) and tumor grade (Pathologic stage), the expression of IFFO1 increased ( Figure 2 ).

[0056] Example 4: IFFO1 can promote cell proliferation and migration

[0057] In ccRCC cells, adenovirus carrying IFFO1 interfering RNA was transfected using a lentiviral packaging system, and the knockdown effect of IFFO1 was confirmed by testing ( Figure 3A). The IFFO1 plasmid was transfected into the cells, and immunoblotting showed strong expression in different ccRCC cells ( Figure 3 B). The proliferation ability of the two cell lines with IFFO1 knockdown was significantly lower than that of the non-knockdown group ( Figure 3 C), and the healing ability of knockdown cells after scratch test was significantly lower than that of non-knockdown group ( Figure 3 D). In addition, Transwell experiments confirmed that the number of migrating cells decreased after IFFO1 knockdown, while the number of migrating cells increased after IFFO1 overexpression ( Figure 3 E). This suggests that IFFO1 can promote the proliferation and migration of ccRCC cells.

[0058] Example 5: IFFO1 can improve genome stability

[0059] Genomic instability is one of the prominent characteristics of tumors and is considered to be a driving factor in tumorigenesis, closely related to the malignant progression and prognosis of tumors. The inventors evaluated the ability of IFFO1 as a ccRCC biomarker by detecting genomic instability. Due to genomic instability, chromosomes break or mitotic errors, causing some chromosome fragments to form micronuclei in the cytoplasm, which is a marker of chromosomal instability in tumors. By immunofluorescence staining and counting of micronuclei, the inventors confirmed that the number of micronuclei in cells increased after IFFO1 knockdown, while the number of micronuclei decreased after overexpression of IFFO1 ( Figure 4 A). After DNA double-strand breaks occur, histone H2AX is rapidly phosphorylated at Ser139 (γ-H2AX), which is an indicator of the degree of DNA damage. Through immunofluorescence experiments and data statistics, the inventors confirmed that under untreated conditions, the number of γ-H2AX aggregation points in cells increased after IFFO1 knockdown ( Figure 4 B). After the cells were irradiated with 4 Gy of X-rays, the damage intensity was calculated again after 2 hours of recovery. The number of γ-H2AX aggregation points in the cells after IFFO1 knockdown was significantly more than that in the control group ( Figure 4 C).

[0060] Example 6: IFFO1 promotes the increased tolerance of ccRCC cells to sunitinib

[0061] Sunitinib, a classic first-line drug for RCC treatment, is a receptor tyrosine kinase inhibitor that can also inhibit the VEGF signaling pathway of angiogenesis. However, about 20% of advanced patients are ineffective against sunitinib, and most patients develop tolerance. In order to expand the application of IFFO1 as a biomarker and therapeutic target for ccRCC, the inventors evaluated the sensitivity of cells to sunitinib after overexpressing IFFO1. The results showed that after the expression of IFFO1 increased, the cells were more tolerant to sunitinib ( Figure 5A), the half-maximal effect concentration (EC50) of the cells increased from 9.86μM to 13.52μM. However, the expression of IFFO1 had no effect on the sensitivity of conventional chemotherapy drugs cisplatin and camptothecin (CPT) ( Figure 5 BC). Under the same treatment conditions, IFFO1 could not affect the sensitivity of lung cancer cells NCI-H1299 to sunitinib ( Figure 5 D). Therefore, IFFO1 specifically promotes the resistance of ccRCC cells to sunitinib treatment, which also suggests the application of IFFO inhibitors in improving the sunitinib resistance of ccRCC.

[0062] Example 7: Establishment of IFFO1 interacting protein network in ccRCC cells

[0063] By expressing an empty vector plasmid with a Flag tag and an IFFO1 protein with a Flag tag in ccRCC cell lines, and after immunoprecipitation and mass spectrometry detection using the Orbitrap FUSION LUMOS, the inventors established an interacting protein map of IFFO1. 45,582 spectra were obtained in the control group, and 257 proteins and 1,156 peptides were identified after searching for matches ( Figure 6 A). 43,162 spectra were obtained from the IFFO1 immunoprecipitation group, and 512 proteins and 2,807 peptides were identified after searching for matches ( Figure 6 B). There were 227 proteins in both groups, 30 proteins unique to the blank group, and 285 proteins unique to the IFFO1 immunoprecipitation group ( Figure 6 C), showing an effective immunoprecipitation effect. The proteins with the number of enriched specific peptides greater than or equal to 3 in the immunoprecipitation group were subjected to GO (Gene Ontology) enrichment and KEGG (Kyoto Encclopedia of Genes and Genomes) enrichment analysis. The results showed that in the KEGG analysis, the interacting proteins were concentrated in the pathways of platelet activation and complement and coagulation cascade reactions. In the biological process analysis, the interacting proteins were concentrated in the regulatory pathways of cell morphogenesis in actin filament organization and differentiation. In the cellular component analysis, the interacting proteins were concentrated in the pathways of cytoplasmic vesicle cavity and secretory granule cavity. In the molecular function analysis, the interacting proteins were concentrated in the pathways of actin binding and cadherin binding.

[0064] Example 8: The expression of IFFO protein family in sunitinib-resistant cells is significantly increased

[0065] To further confirm the potential of IFFO1 as a biomarker of ccRCC tolerance, the inventors performed whole transcriptome detection in constructed ccRCC cells resistant to sunitinib. Tolerant cells were established by gradient drug stimulation, and the EC50 of cells was increased from 8.9μM to 20.3μM ( Figure 7 A). By comparing sunitinib-resistant cells with wild-type cells, the inventors identified 3095 specific proteins in the resistant cells ( Figure 7 B). Pathways associated with sunitinib resistance mainly focus on PI3K-Akt signaling, MAPK signaling, cytokine and cytokine receptor interactions, and cell adhesion molecule signaling ( Figure 7 C). In drug-resistant cells, IFFO2, a protein of the IFFO family, showed significant upregulation ( Figure 7 D).

[0066] Finally, it should be noted that the above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of intermediate filament proteins as biomarkers for predicting the stage and prognosis of renal clear cell carcinoma.

2. The application according to claim 1, characterized in that: The intermediate filament protein is IFFO1.

3. The use according to claim 1 or 2, characterized in that: Products for detecting IFFO1 expression levels.

4. The application according to claim 3, characterized in that: The product for detecting the expression level of IFFO1 includes IFFO1 antibody.

5. Application of IFFO1 as a biomarker in the preparation of products for predicting the staging and prognosis of renal clear cell carcinoma.

6. Application of IFFO1 in the preparation of products for predicting drug resistance in renal clear cell carcinoma.

7. The use according to claim 6, characterized in that: Sunitinib is a drug used to treat clear cell renal cell carcinoma.

8. Use of IFFO1 in the preparation or screening of a drug for treating renal clear cell carcinoma, characterized in that: The therapeutic drugs include intervention antibodies or protein inhibitors targeting IFFO1.

Images