Method for producing recombinant adeno-associated virus with high yield and high quality

Abstract

The present specification provides a method for producing a recombinant adeno-associated virus (rAAV) of a desired composition in high yield and high quality. The method for producing the recombinant adeno-associated virus disclosed in the present application is characterized by comprising a pre-culture process and an osmotic shock process. The pre-culture process and the osmotic shock process cooperate with each other in the production process to produce recombinant adeno-associated viruses in high yield and high quality.

Description

Technical Field

[0001] This specification discloses the technical details of a method for preparing a recombinant adeno-associated virus. Background Art

[0002] The method for producing recombinant adeno-associated virus can be divided into the following processes: a) upstream process of producing recombinant adeno-associated virus by host cells; and b) downstream process of harvesting, filtering, separating and purifying recombinant adeno-associated virus produced in host cells. The upstream process is directly related to the process of expressing each component of the recombinant adeno-associated virus by host cells. The downstream process is directly related to the method of separating and purifying only the target recombinant adeno-associated virus from a mixture of various biological materials (such as proteins, nucleic acids and lipids). Summary of the invention

[0003] Technical issues

[0004] The technical task of this specification is to provide a method for producing recombinant adeno-associated virus (rAAV) of desired composition with high yield and high quality.

[0005] Technical Solution

[0006] In order to achieve the technical task, the method for producing recombinant adeno-associated viruses disclosed in this article includes a pre-culture process and an osmotic shock process. The pre-culture process allows host cells to produce recombinant adeno-associated viruses more efficiently and in larger quantities, thereby helping to improve yield. The osmotic shock process causes the host cells to release most of the produced recombinant adeno-associated viruses into the culture medium, allowing the adeno-associated viruses to be recovered directly from the culture medium without destroying the cells. Due to the osmotic shock process, the recombinant adeno-associated viruses can be recovered and purified without causing significant damage to the cells. Therefore, high-quality recombinant adeno-associated viruses can be produced. In addition, due to the osmotic shock process, the recombinant adeno-associated virus production method can omit the cell disruption process, thereby simplifying the adeno-associated virus purification and acquisition process. Therefore, the production method disclosed in the present invention can help achieve further improved yield and high quality by minimizing the loss of viral particles during purification and acquisition.

[0007] The pre-culture process and the osmotic shock process work synergistically with each other in the production method, thereby producing recombinant adeno-associated virus with high yield and high quality.

[0008] Beneficial Effects

[0009] By following the method for producing recombinant adeno-associated virus disclosed herein, recombinant adeno-associated virus can be produced with high yield and high quality. The method for producing recombinant adeno-associated virus disclosed herein is a method for producing recombinant adeno-associated virus that is superior and more economical than conventional production methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 A graph showing the yield improvement effect of the osmotic shock process according to Experimental Example 2.2 depending on the salt concentration is shown, and after the osmotic shock process is performed on each experimental group, the total number of viral genomes (vg) is measured and displayed, wherein NT represents a negative control group that is not subjected to the osmotic shock process, and NaCl is added to the remaining experimental groups as an osmotic shock agent at the corresponding concentration indicated on each label;

[0011] Figure 2 A graph showing the yield improvement effect of the osmotic shock process depending on the salt type according to Experimental Example 2.3 is shown, and after the osmotic shock process is performed on each experimental group, the total number of viral genomes (vg) is measured and displayed, wherein NT represents a negative control group that is not subjected to the osmotic shock process, and the remaining experimental groups use the salt of the type and concentration indicated on each label as an osmotic shock agent;

[0012] Figure 3 A graph showing the yield improvement effect of the pre-culture treatment process according to Experimental Example 3.2 is shown, after the pre-culture treatment process is performed on each experimental group, the total number of viral genomes (vg) is measured and displayed, wherein the control represents a negative control that is not subjected to the pre-culture treatment process, and the remaining experimental groups use various types of materials indicated on the label as pre-culture treatment agents, and each detailed configuration is shown in Table 3 in the paragraph "Experimental Example 3.2. Yield improvement effect when pre-culture treatment is performed using nocodazole and M344";

[0013] Figure 4 A graph showing the yield improvement effect of the pre-culture treatment process according to Experimental Example 3.3 is shown, after the pre-culture treatment process is performed on each experimental group, the total number of viral genomes (vg) is measured and displayed, wherein the control represents a negative control that is not subjected to the pre-culture treatment process, and the remaining experimental groups use various types of materials indicated on the label as pre-culture treatment agents, and each detailed configuration is shown in Table 4 in the paragraph "Experimental Example 3.3. Yield improvement effect when pre-culture treatment is performed using nocodazole and M344";

[0014] Figure 5 A schematic diagram schematically showing the entire production process disclosed herein is shown;

[0015] Figure 6 A photograph of cells taken before the downstream process is performed in Process 2 of Experimental Example 4 (excluding pre-culture treatment, including freezing and thawing processes), and as a result of measuring the cell viability of the process, the cell viability was measured to be 15.8%;

[0016] Figure 7A photograph of cells taken before the downstream process is performed in process 5 of Experimental Example 4 (including pre-culture treatment, including freezing and thawing processes) is shown, and as a result of measuring the cell viability of the process, the cell viability was measured to be 18.2%;

[0017] Figure 8 A cell photograph taken before the downstream process in process 6 of Experimental Example 4 (including pre-culture treatment, including osmotic shock process) is shown, and as a result of measuring the cell viability of the process, the cell viability was measured to be 35.4%;

[0018] Fig. 9 The number of viral genomes (vg) measured in the culture medium before the downstream process is performed in each process of Experimental Example 4 is shown, wherein no chemicals + no treatment represents process 1, none + freeze & thaw represents process 2, none + osmotic shock represents process 3, Suc, Noco, M344 + no treatment represents process 4, Suc, Noco, M344 + freeze & thaw represents process 5, and Suc, Noco, M344 + osmotic shock represents process 6;

[0019] Fig.10 The final number of viral genomes (vg) obtained after ultracentrifugation in each process of Experimental Example 4 is shown, wherein no chemicals + no treatment represents process 1, none + freeze & thaw represents process 2, none + osmotic shock represents process 3, Suc, Noco, M344 + no treatment represents process 4, Suc, Noco, M344 + freeze & thaw represents process 5, and Suc, Noco, M344 + osmotic shock represents process 6;

[0020] Fig.11 The results of Coomassie Brilliant Blue staining after each process in each process of Experimental Example 4 are shown, wherein Harvest Cell Culture Fluid represents a sample when the culture medium is harvested before downstream processing, and PEG Sup. represents a supernatant sample after filtration and PEG precipitation. In addition, 1: (-) Chemicals represents Process 1, 2: (-) Chemicals and Freeze / Thaw represents Process 2, 3: (-) Chemicals and Osmotic Shock represents Process 3, 4: (+) 3 Chemicals represents Process 4, 5: (+) 3 Chemicals and Freeze / Thaw represents Process 5, and 6: (+) 3 Chemicals and Osmotic Shock represents Process 6;

[0021] Fig.12The results of Coomassie Brilliant Blue staining of the cell pellet samples after filtration and PEG precipitation in each process of Experimental Example 4 are shown, wherein 1: (-) chemical represents process 1, 2: (-) chemical and freeze / thaw represents process 2, 3: (-) chemical and osmotic shock represents process 3, 4: (+) 3 chemicals represent process 4, 5: (+) 3 chemicals and freeze / thaw represents process 5, and 6: (+) 3 chemicals and osmotic shock represents process 6;

[0022] Fig.13 The results of Coomassie Brilliant Blue staining of the supernatant samples after filtration and the nuclease (benzonase) process in each process of Experimental Example 4 are shown, wherein 1: (-) chemicals represent process 1, 2: (-) chemicals and freeze / thaw represent process 2, 3: (-) chemicals and osmotic shock represent process 3, 4: (+) 3 chemicals represent process 4, 5: (+) 3 chemicals and freeze / thaw represent process 5, and 6: (+) 3 chemicals and osmotic shock represent process 6;

[0023] Fig.14 The results of negative staining TEM photographs taken according to Experimental Example 4.6 for Process 2 of Experimental Example 4 are shown, and the results of optical photography confirm that the background is dirty, the morphology of the virus particles is unclear, and the ratio of complete capsids to empty capsids is 40%;

[0024] Fig.15 The results of negative staining TEM photographs taken according to Experimental Example 4.6 for Process 5 of Experimental Example 4 are shown, and the photographed results confirm that the background is dirty, the morphology of the virus particles is unclear, and the ratio of complete capsids to empty capsids is 67%;

[0025] Fig.16 The results of negative staining TEM photographs taken according to Experimental Example 4.6 for Process 3 of Experimental Example 4 are shown, and the photographed results confirm that the background is clear, the morphology of the virus particles is clear, and the ratio of complete capsids to empty capsids is 82%;

[0026] Fig.17 The results of negative staining TEM photographs taken according to Experimental Example 4.6 for Process 6 of Experimental Example 4 are shown, and the photographed results confirm that the background is clear, the morphology of the virus particles is clear, and the ratio of complete capsids to empty capsids is 87%; and

[0027] Fig.18 The silver staining results of the final sample obtained after performing all steps of each process in Experimental Example 4 are shown, wherein W / O chemical F / T represents process 2, W / O chemical osmotic shock represents process 3, W / chemical F / T represents process 5, and W / chemical osmotic shock represents process 6. DETAILED DESCRIPTION

[0028] Hereinafter, with reference to the accompanying drawings, the contents of the present disclosure will be described in more detail through specific embodiments and examples. It should be noted that the accompanying drawings include some but not all embodiments of the present disclosure. The subject matter of the present disclosure disclosed in this specification can be implemented in various ways and is not limited to the examples of the specific embodiments described herein. These embodiments should be deemed to be provided to meet the legal requirements applicable to this specification. Those skilled in the art will be able to think of many modifications and other embodiments of the present disclosure disclosed herein. Therefore, it should be understood that the contents of the present disclosure disclosed herein are not limited to the specific embodiments described herein, and modifications and other embodiments thereof are also included within the scope of the claims.

[0029] This specification discloses a method for producing a recombinant adeno-associated virus (rAAV), comprising:

[0030] (a) preparing a host cell,

[0031] wherein the host cell comprises a vector encoding the rAAV component,

[0032] enabling the host cell to express the rAAV;

[0033] (b) adding sugar, nocodazole and M344 to a culture medium containing the host cells;

[0034] (c) culturing the host cell,

[0035] wherein the culturing enables the rAAV to be expressed in the host cell;

[0036] (d) applying osmotic shock by adding salt to the culture medium containing the host cells,

[0037] wherein the osmotic shock promotes the release of the rAAV from the host cell into the culture medium; and

[0038] (e) obtaining the rAAV from the culture medium without lysing the host cells.

[0039] In one embodiment, the serotype of rAAV is selected from one or more of the following:

[0040] Wild-type serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10;

[0041] Synthetic (variant) serotypes, including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2; and

[0042] Other AAV variant serotypes.

[0043] In one embodiment, step (e) comprises:

[0044] (e-1) separating the culture medium from the host cells in the product of step (d);

[0045] (e-2) filtering the culture medium;

[0046] (e-3) subjecting the product of step (e-2) to PET precipitation;

[0047] (e-4) adding a nuclease to the product of step (e-3) in the presence of a salt;

[0048] (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and

[0049] (e-6) subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation.

[0050] Public Content

[0051] Definition of terms

[0052] about

[0053] As used herein, the term "about" refers to an amount, level, value, amount, frequency, percentage, dimension, size, amount, weight or length that varies by 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 0% based on a reference amount, level, value, amount, frequency, percentage, dimension, size, amount, weight or length.

[0054] Nucleic acid sequence representation

[0055] The symbols "A, T, C, G and U" used herein are interpreted as meanings understood by those skilled in the art. Depending on the context and technology, the symbols can be appropriately interpreted as bases, nucleosides or nucleotides on DNA or RNA. For example, when the symbols refer to bases, the symbols can be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G) or uracil (U) itself. When the symbols refer to nucleosides, the symbols can be interpreted as adenosine (A), thymidine (T), cytidine (C), guanosine (G) or uridine (U) respectively. When the symbols refer to nucleotides in a sequence, the symbols need to be interpreted as meaning the nucleotides containing each nucleoside.

[0056] Limitations of conventional techniques

[0057] The method for producing recombinant adeno-associated virus can be divided into the following processes: a) upstream process of producing recombinant adeno-associated virus by host cells; and b) downstream process of harvesting, filtering, separating and purifying recombinant adeno-associated virus produced in host cells. The upstream process is directly related to the process of expressing each component of the recombinant adeno-associated virus by host cells. The downstream process is directly related to the method of separating and purifying only the target recombinant adeno-associated virus from a mixture of various biological materials (such as proteins, nucleic acids and lipids).

[0058] The research on conventional recombinant adeno-associated virus production methods has the limitation of focusing only on improving the upstream process or the downstream process, especially focusing on the process improvement in the process. At present, there is very little research on how to design the entire method (including upstream and downstream processes) for producing recombinant adeno-associated viruses so as to obtain high-quality recombinant adeno-associated virus particles with high efficiency.

[0059] Method for producing recombinant adeno-associated virus (rAAV)

[0060] Overview of methods for producing rAAV

[0061] The method for producing recombinant adeno-associated virus (rAAV) disclosed herein includes preparing host cells; treating host cells in pre-culture; culturing host cells; providing osmotic shock; and obtaining the produced recombinant adeno-associated virus from host cells and / or culture medium containing them. The method for producing recombinant adeno-associated virus can be divided into the following processes: a) upstream process of producing adeno-associated virus by host cells and b) downstream process of separating and purifying adeno-associated virus produced in host cells. In the upstream process, the method for producing recombinant adeno-associated virus allows host cells to produce recombinant adeno-associated virus in a more efficient manner and with higher yield by pre-culture treatment. In addition, the production method allows most of the recombinant adeno-associated viruses produced by host cells to be released into the culture medium by an osmotic shock process, thereby omitting the cell disruption process in the downstream process. This allows the recombinant adeno-associated virus to be recovered with higher quality. The method for producing recombinant adeno-associated virus includes a pre-culture treatment process in the upstream process, and an osmotic shock process is adopted immediately before the downstream process. Therefore, the method allows the process to produce a synergistic effect, and thus maximizes yield and quality.

[0062] Hereinafter, the method for producing the recombinant adeno-associated virus will be described in more detail.

[0063] Host cell preparation process

[0064] The method for producing a recombinant adeno-associated virus disclosed herein includes a host cell preparation process. The host cell preparation process refers to a process of preparing a host cell capable of producing a recombinant adeno-associated virus to be produced.

[0065] The host cell preparation process is not subject to other restrictions, as long as the host cell capable of producing the recombinant adeno-associated virus to be produced is prepared. The process of preparing the host cell can be carried out by appropriately selecting a method known to those skilled in the art and modifying it to be suitable for the method disclosed herein. For example, the host cell preparation process can use a method known in (paper).

[0066] An example of the host cell preparation process is illustrated in “Host cell preparation process” in “Possible embodiments of the present invention”.

[0067] Pre-cultivation process

[0068] The method for producing a recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process. The pre-culture treatment process refers to a process that allows host cells to produce recombinant adeno-associated viruses more efficiently before culturing host cells to produce recombinant adeno-associated viruses.

[0069] The pre-culture treatment process includes the addition of a pre-culture agent, which contains sugar, nocodazole and / or M344.

[0070] The pre-culture treatment process disclosed herein is used to increase the yield of recombinant adeno-associated virus, rather than stopping the cell cycle and interfering with cell growth. As a result of the pre-culture treatment, the host cells are able to produce more recombinant adeno-associated virus in culture. More specific details about the pre-culture treatment are described in the section "Pre-culture Process".

[0071] Host cell culture process

[0072] The method for producing recombinant adeno-associated virus disclosed herein includes a host cell culture process. The host cell culture process refers to a process of appropriately treating host cells and / or a culture medium containing host cells so that host cells that have completed pre-culture treatment can produce recombinant adeno-associated virus. The term "appropriately treated" includes, for example, adding a specific substance to the host cells (e.g., adding a nutrient medium), placing the host cells in a predetermined environment for a predetermined time (e.g., culturing host cells in an incubator at room temperature for a predetermined time), changing the environment of the host cells to a new environment (e.g., replacing the culture medium for re-cultivation), or using a predetermined device to generate a predetermined impact (e.g., using a vibrator to vibrate the host cells and culture medium). The term includes all technical ideas that can be recognized by those skilled in the art.

[0073] The host cell culture process is not otherwise limited as long as the host cell can produce recombinant adeno-associated virus. The process of culturing host cells can be performed by appropriately selecting a method known to those skilled in the art and modifying it to be suitable for the method disclosed herein.

[0074] Osmotic shock process

[0075] The method for producing recombinant adeno-associated virus disclosed herein includes an osmotic shock process. The osmotic shock process refers to a process in which host cells producing host cells and containing recombinant adeno-associated virus are subjected to osmotic shock, so that the host cells release the recombinant adeno-associated virus into the culture medium.

[0076] By allowing the recombinant adeno-associated virus to be released into the culture medium, the method for producing the recombinant adeno-associated virus can purify and / or obtain the recombinant adeno-associated virus without disrupting the cells. When the recombinant adeno-associated virus is obtained without disrupting the cells, the acquisition process is simplified, the recombinant adeno-associated virus particles lost during the acquisition process are minimized, and intact recombinant adeno-associated virus particles can be recovered. Therefore, the osmotic shock process helps to improve the quality of the recombinant adenovirus produced by the method for producing the recombinant adeno-associated virus. More specific details about the osmotic shock process are described in the "Osmotic Shock Process" paragraph.

[0077] The process of obtaining recombinant adeno-associated virus

[0078] The method for producing a recombinant adeno-associated virus disclosed herein includes a process for obtaining a recombinant adeno-associated virus. The process for obtaining a recombinant adeno-associated virus refers to a process for obtaining a recombinant adeno-associated virus produced by a host cell and / or a culture medium containing a host cell. Due to the presence of an osmotic shock process, the process for obtaining a recombinant adeno-associated virus is performed without disrupting the cells.

[0079] The process of obtaining recombinant adeno-associated virus is not otherwise limited, as long as the recombinant adeno-associated virus can be obtained. The process of obtaining recombinant adeno-associated virus can be performed by appropriately selecting a method known to those skilled in the art and modifying it to suit the method disclosed herein.

[0080] In one embodiment, the process of obtaining the recombinant adeno-associated virus can be to obtain the recombinant adeno-associated virus from the host cell and / or the culture medium containing the host cell by chromatography. Specifically, the chromatography can be the method disclosed in Rieser R, Koch J, Faccioli G, Richter K, Menzen T, Biel M, Winter G, Michalakis S. Comparison of Different Liquid Chromatography-Based Purification Strategies for Adeno-Associated Virus Vectors. Pharmaceutics. 2021; 13 (5): 748. Https: / doi.org / 10.3390 / pharmaceutics13050748, or a suitable modification thereof.

[0081] In another embodiment, the process of obtaining the recombinant adeno-associated virus can be obtained from the host cell and / or the culture medium containing the host cell by ultracentrifugation. Specifically, the ultracentrifugation method can be the method disclosed in Sena-Esteves M, Gao G. Purification of Recombinant Adeno-Associated Viruses (rAAVs) by Iodixanol Gradient Centrifugation. Cold Spring Harb Protoc. 2020 Feb 3; 2020 (2): 095612. doi: 10.1101 / pdb.prot095612. PMID: 32015002., or a suitable modification thereof.

[0082] Characteristics of methods for producing recombinant adeno-associated viruses

[0083] Summary of characteristics of methods for producing recombinant adeno-associated viruses

[0084] The method for producing recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process and an osmotic shock process. By including these processes, the method can produce recombinant adeno-associated virus with high quality and high yield.

[0085] In order to compare the characteristics of various recombinant adeno-associated virus production methods and select an excellent production method, it is necessary to compare the yield and quality of the produced recombinant adeno-associated virus. In this article, it is inappropriate to use only one standard to compare the yield and quality, and it is necessary to use multiple standards to compare the yield and quality.

[0086] In this specification, it is intended to disclose various criteria for evaluating recombinant adeno-associated viruses produced by various production methods. In addition, based on this, the inventors hope to reveal that the production method disclosed herein is significantly superior to the traditional production method in many aspects.

[0087] Production Method 1 - Methods for evaluating the quality and yield of produced rAAV

[0088] As a criterion for evaluating the quality of the recombinant adeno-associated virus produced and obtained, the production volume or yield is disclosed herein. This is an indicator of how much recombinant adeno-associated virus is produced when the same amount of host cells (i.e., cells producing recombinant adeno-associated virus) is used. In order to mass-produce recombinant adeno-associated viruses, it is basically effective to select a production method in which each host cell produces a large number of virus particles (or vectors). Therefore, the production volume or yield of recombinant adeno-associated viruses is a basic quantitative indicator for comparing the superiority and inferiority between production methods.

[0089] In one embodiment, the production amount of recombinant adeno-associated virus can be determined by measuring the number of total viral genomes (vg) in the measurement target. In another embodiment, the yield of recombinant adeno-associated virus of each production method can be compared by measuring and comparing the number of viral genomes produced in the same amount of host cells.

[0090] Evaluation Method for Production Method 2 - Ratio of Complete Capsid to Empty Capsid

[0091] As a criterion for evaluating the quality of the recombinant adeno-associated virus produced and obtained, the complete capsid-empty capsid ratio is disclosed herein. Herein, a complete capsid refers to a recombinant adeno-associated virus particle in which the genetic material is properly packaged in the capsid. In contrast, an empty capsid refers to a particle in which the genetic material is not properly packaged in the capsid. Empty capsids may be toxic when administered to living organisms. Therefore, when using recombinant adeno-associated viruses as therapeutic agents, it is a very important task to remove empty capsids and increase the proportion of complete capsids during the production process. The higher the ratio of complete capsids to empty capsids, the higher the quality of the recombinant adeno-associated virus produced.

[0092] In one embodiment, the ratio of complete capsids to empty capsids can be obtained by negatively staining the produced recombinant adeno-associated virus samples and then taking and analyzing TEM images.

[0093] Evaluation Methods for Production Method 3 - Genome Integrity

[0094] As a standard for evaluating the quality of the recombinant adeno-associated virus produced and obtained, the genome integrity ratio is disclosed herein. In this article, genome integrity refers to the proportion of particles in which the "expected genetic material" in the capsid is correctly packaged by measuring the ratio of the particles by digital-PCR of the produced recombinant adeno-associated virus. This measures the percentage of recombinant adeno-associated viruses produced according to the design. This is used as a standard for measuring the quality of the recombinant adeno-associated virus produced. Compared with the complete capsid-empty capsid ratio, it is a method for measuring the quality of the obtained virus particles from a different angle, so this method can be used as a complementary quality standard.

[0095] In one embodiment, the genomic integrity of the produced recombinant adeno-associated viruses is measured by PCR to determine whether the transgene of the recombinant adeno-associated virus in each sample includes ITR and bGHpA target gene. Therefore, the genomic integrity can be measured as the ratio of the number of viruses containing both ITR and bGHpA target gene to the total number of recombinant adeno-associated viruses produced.

[0096] Evaluation Method of Production Method 4 - Purity

[0097] As a standard for evaluating the quality of the recombinant adeno-associated virus produced and obtained, the purity of the final product obtained is disclosed herein. In this article, purity refers to a measure of how pure the final product obtained contains only the recombinant adeno-associated virus. For example, when the final product obtained contains many cell byproducts (proteins and nucleic acids) other than the recombinant adeno-associated virus, the purity is low. When the final product obtained contains only the recombinant adeno-associated virus, the purity is significantly high. In one embodiment, purity can be measured by checking the amount of background bands that appear by silver staining and Coomassie brilliant blue staining. Typically, the substance used as a therapeutic agent is the recombinant adeno-associated virus itself. Under conditions where it is unclear that the presence of impurities can cause side effects or toxicity, the high purity of the final product is also an important criterion.

[0098] Characteristics of methods for producing recombinant adeno-associated viruses

[0099] The method for producing recombinant adeno-associated viruses disclosed herein includes 1) a pre-culture treatment process and 2) an osmotic shock process in terms of configuration, so that the downstream process can be carried out without breaking the cells. Due to these characteristics, compared with conventional production methods that do not include this configuration, the production method disclosed herein can 1) produce recombinant adeno-associated viruses in high yields, 2) show a high complete capsid-empty capsid ratio, 3) show a high percentage of genome integrity, and 4) have a high purity final product. In addition, the production method disclosed herein increases the production volume and quality of recombinant adeno-associated virus particles, reduces the time and cost required for the purification process, and can produce recombinant adeno-associated viruses more economically. In short, using the recombinant adeno-associated virus production method disclosed herein, recombinant adeno-associated viruses of the expected composition can be produced with significantly higher yields and significantly higher quality than conventional production methods.

[0100] Host cell preparation method

[0101] The method for producing recombinant adeno-associated virus disclosed herein includes a host cell preparation process. The host cell is capable of producing recombinant adeno-associated virus. In order to be able to produce recombinant adeno-associated virus, the host cell contains: 1) nucleic acid encoding the envelope (capsid) of the recombinant adeno-associated virus; and 2) nucleic acid encoding the predetermined genetic material to be included in the envelope. In addition, the host cell may also contain nucleic acid 3) encoding various substances and information to ensure that the envelope and genetic material can be expressed in the host cell, and further ensure that the genetic material is well contained (packaged) in the expressed envelope. The host cell may contain 1) to 3) nucleic acids in the form of a well-known vector (e.g., a plasmid). In order to prepare the host cell, the process of transfecting the nucleic acid 1) to 3) into a predetermined cell line may be necessary. As described above, the process of preparing the host cell can be carried out by appropriately selecting a method known to those skilled in the art and modifying it to be suitable for the method disclosed herein. When a suitable environment is provided, the host cell can produce a recombinant adeno-associated virus. In the following process, the cell referred to as "host cell" refers to a cell capable of producing a recombinant adeno-associated virus.

[0102] Pre-cultivation process

[0103] Overview of the pre-culture process

[0104] The method for producing recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process. The pre-culture treatment process allows host cells to more efficiently produce recombinant adeno-associated virus by treating host cells with a pre-culture agent containing one or more selected from the group consisting of sugar, nocodazole and M344. Specifically, 1) sugar is used to increase the amount of recombinant protein (herein, recombinant adeno-associated virus) produced by host cells. 2) Nocodazole is used to increase the production of recombinant adeno-associated virus by fixing the host cells in a specific cell cycle. 3) M344 is used to increase the production of the virus by inhibiting the decomposition mechanism of the recombinant adeno-associated virus envelope protein. This allows host cells to produce recombinant adeno-associated virus more efficiently and in larger quantities.

[0105] sugar

[0106] The pre-culture treatment process may include adding sugar to the host cells. The addition of sugar may mean treating the host cells with a pre-culture agent containing sugar. Sugar is not limited as long as the sugar can be used as a nutrient in the cell. For example, sugar may be sucrose or sorbitol, but is not limited thereto. When the host cells are treated with sugar, the amount of the recombinant protein (herein, recombinant adeno-associated virus) produced by the host cells may increase. Sugar does not affect the downstream process of the recombinant adenovirus production process, and only affects the process of the host cell producing the recombinant adeno-associated virus.

[0107] Nocodazole

[0108] The pre-culture treatment process can include adding nocodazole to the host cells. Adding nocodazole can refer to treating the host cells with a pre-culture agent containing nocodazole. Nocodazole is an anti-mitotic agent. Known nocodazole acts on cells to interfere with cell division and proliferation by interfering with the separation of chromosomes. When treating host cells with nocodazole, host cells are fixed in the G2 / M cell cycle. Therefore, when compared with cells not treated with nocodazole, host cells have experienced an increase in average cell volume, expressing more recombinant proteins (i.e., recombinant adeno-associated virus particles) on average.

[0109] M344

[0110] The pre-culture treatment process may include adding M344 to the host cells. The addition of M344 may refer to treating the host cells with a pre-culture agent containing M344. M344 is a histone deacetylase inhibitor. M344 can inhibit the deacetylation of histones in cells and the degradation of ubiquitinated proteins, including viral capsid proteins. When M344 is added to host cells, the degradation of recombinant adeno-associated virus proteins in the host cells is inhibited, and more viral particles are expressed.

[0111] Osmotic shock process

[0112] Overview of the Osmotic Shock Process

[0113] The method for producing recombinant adeno-associated virus disclosed herein includes an osmotic shock process. The osmotic shock process refers to a process in which the osmotic pressure outside the host cell is maintained higher than the osmotic pressure inside the host cell for a predetermined period of time. As long as the purpose is achieved, the "method of increasing osmotic pressure" is not limited thereto. For example, the osmotic shock process may include adding an osmotic shock agent containing salt to the host cell. In addition, additional substances may be added to stabilize the recombinant adeno-associated virus released during the osmotic shock process. For example, the additional material may be, but is not limited to, a non-ionic surfactant.

[0114] Salt

[0115] The osmotic shock process includes adding an osmotic shock agent containing a salt to the host cell. In this article, the salt is used to maintain the high osmotic pressure outside the host cell (i.e., in the culture medium), and is not subject to other restrictions, as long as the salt is non-toxic to the host cell. For example, the salt can be a salt containing a monovalent ion, such as sodium chloride (NaCl) or potassium chloride (KCl). For another example, the salt can be a salt containing a divalent ion, such as magnesium chloride (MgCl2).

[0116] Nonionic surfactants

[0117] The osmotic shock agent used in the osmotic shock process may further include a nonionic surfactant. In this article, the nonionic surfactant stabilizes the recombinant adeno-associated virus particles released by the host cells into the culture medium, thereby allowing more recombinant adeno-associated virus particles to be recovered from the culture medium. For example, the nonionic surfactant can be Plucuronic acid (PF68), but is not limited thereto.

[0118] [Possible Embodiments of the Invention]

[0119] Host cell preparation process

[0120] Example 1. Host cell preparation process

[0121] The process of preparing, introducing and / or providing a host cell.

[0122] Example 2. Culture medium inclusions

[0123] In Example 1, the process of preparing, introducing and / or providing host cells refers to the process of preparing, introducing and / or providing host cells and a culture medium containing the host cells.

[0124] Example 3. rAAV expression possibilities

[0125] In any of Examples 1 to 2, the host cell is capable of expressing a recombinant adeno-associated virus (rAAV).

[0126] Example 4. rAAV vector inclusions

[0127] In Example 3, the host cell contains a rAAV expression vector.

[0128] Example 5. Restriction on rAAV serotypes

[0129] In any of embodiments 3 to 4, the rAAV is a serotype selected from one or more of the following:

[0130] Wild-type serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10;

[0131] Synthetic (variant) serotypes, including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2; and

[0132] Other AAV variant serotypes.

[0133] Example 6. Restriction of host cells

[0134] In any one of embodiments 1 to 5, the host cell is one or more selected from the following:

[0135] HEK293T; and Expi293F.

[0136] Pre-cultivation process

[0137] Example 7. Pre-culture process

[0138] The process of adding, mixing, treating and / or introducing pre-culture agents to host cells.

[0139] Example 8. Addition of pre-culture agent to culture medium

[0140] In Example 7, the process of adding, mixing, treating and / or introducing the preculture agent to the host cells refers to the process of adding, mixing, treating and / or introducing the preculture agent into the culture medium containing the host cells.

[0141] Example 9. Pre-culture agent description

[0142] In Example 7, the pre-culture agent includes one or more selected from the following:

[0143] Sugar; nocodazole; and M344.

[0144] Example 10. Pre-culture process time description

[0145] In any one of Examples 7 to 9, the preculture agent is applied at a predetermined time point after a previous process (eg, a host cell preparation process).

[0146] In this article, the predetermined time point is selected from the following:

[0147] A time point selected from a real number between 0 and 1440 represents a time point after any number of minutes have passed, for example, 30 minutes later (at 30 minutes);

[0148] A time point selected from a real number between 0 and 1440 represents a time point after any number of minutes, for example, after 60 minutes (after);

[0149] A time point selected from a real number between 0 and 1440 represents a time point before any number of minutes have passed, for example, after (before) 90 minutes;

[0150] A time point selected from a real number between 0 and 1440 represents a time point within two arbitrary numerical ranges, for example, after 180 minutes and before 300 minutes (after A and before B); or

[0151] At a time point before, about 30 minutes, about 1 hour, about 1 hour and 30 minutes, about 2 hours, about 2 hours and 30 minutes, about 3 hours, about 3 hours and 30 minutes, about 4 hours, about 4 hours and 30 minutes, or about 5 hours later.

[0152] Example 11. Conceptualization of the yield improvement process

[0153] A process for increasing the production of a recombinant adeno-associated virus comprising any one of Examples 7 to 10.

[0154] Osmotic shock process

[0155] Example 12. Osmotic shock process

[0156] The process of adding, mixing, treating and / or introducing an osmotic shock agent to host cells.

[0157] Example 13. Addition of osmotic shock reagent to culture medium

[0158] In Example 12, the process of adding, mixing, treating and / or introducing an osmotic shock agent into host cells refers to the process of adding, mixing, treating and / or introducing an osmotic shock agent into a culture medium containing host cells.

[0159] Example 14. Osmotic shock reagent description

[0160] In any one of embodiments 12 to 13, the osmotic shock agent comprises one or more selected from the following:

[0161] Salt; and

[0162] Nonionic surfactant.

[0163] Example 15. Restrictions on salt types

[0164] In embodiment 14, the salt comprises one or more selected from the group consisting of:

[0165] Sodium chloride (NaCl); potassium chloride (KCl); and magnesium chloride (MgCl2).

[0166] Example 16. Limitation of salt concentration

[0167] In any of Examples 14 to 15, the salt concentration is one or more selected from the following:

[0168] A concentration selected from about 0.1 M, about 0.2 M, about 0.3 M, about 0.4 M, about 0.5 M, about 0.6 M, about 0.7 M, about 0.8 M, about 0.9 M, about 1.0 M, about 1.1 M, about 1.2 M, about 1.3 M, about 1.4 M, about 1.5 M, about 1.6 M, about 1.7 M, about 1.8 M, about 1.9 M, or about 2.0 M;

[0169] A concentration within a range consisting of two values ​​selected from the group consisting of about 0.1 M, about 0.2 M, about 0.3 M, about 0.4 M, about 0.5 M, about 0.6 M, about 0.7 M, about 0.8 M, about 0.9 M, about 1.0 M, about 1.1 M, about 1.2 M, about 1.3 M, about 1.4 M, about 1.5 M, about 1.6 M, about 1.7 M, about 1.8 M, about 1.9 M, and about 2.0 M, e.g., about 0.1 M to about 1.5 M;

[0170] a concentration selected from about 0.1 M or less, about 0.2 M or less, about 0.3 M or less, about 0.4 M or less, about 0.5 M or less, about 0.6 M or less, about 0.7 M or less, about 0.8 M or less, about 0.9 M or less, about 1.0 M or less, about 1.1 M or less, about 1.2 M or less, about 1.3 M or less, about 1.4 M or less, about 1.5 M or less, about 1.6 M or less, about 1.7 M or less, about 1.8 M or less, about 1.9 M or less, or about 2.0 M or less; and

[0171] A concentration selected from about 0.1 M or greater, about 0.2 M or greater, about 0.3 M or greater, about 0.4 M or greater, about 0.5 M or greater, about 0.6 M or greater, about 0.7 M or greater, about 0.8 M or greater, about 0.9 M or greater, about 1.0 M or greater, about 1.1 M or greater, about 1.2 M or greater, about 1.3 M or greater, about 1.4 M or greater, about 1.5 M or greater, about 1.6 M or greater, about 1.7 M or greater, about 1.8 M or greater, about 1.9 M or greater, or about 2.0 M or greater.

[0172] Example 17. Restriction on nonionic surfactants

[0173] In any of Examples 14 to 16, the nonionic surfactant is PF68.

[0174] Example 18. Osmotic shock time description

[0175] In any one of Embodiments 12 to 17, the process is performed for a predetermined time.

[0176] In this article, the scheduled time is selected from the following:

[0177] The time selected from the real number 0-1440 represents the elapsed time of any number of minutes, for example, 30 minutes;

[0178] The time selected from the real number 0-1440 represents the time after any number of minutes, for example, more than 60 minutes;

[0179] A time selected from a real number between 0 and 1440, representing a time before any number of minutes have passed, such as under 90 minutes; or

[0180] A time of about 30 minutes or less, about 30 minutes, about 1 hour, about 1 hour and 30 minutes, about 2 hours, about 2 hours and 30 minutes, about 3 hours, about 3 hours and 30 minutes, about 4 hours, about 4 hours and 30 minutes or about 5 hours.

[0181] Example 19. Limitation of medium osmotic pressure

[0182] In any one of embodiments 12 to 18, as a result of the process, the osmotic pressure outside the host cell is maintained at a concentration selected from the following:

[0183] Example 20. Conceptualization of the Quality Improvement Process

[0184] A process for improving the quality of a recombinant adeno-associated virus, comprising any one of Examples 12 to 19.

[0185] Example 21. Impact of quality improvement

[0186] In Example 20, improving the quality of the recombinant adeno-associated virus refers to any one selected from the following:

[0187] An increase in the ratio of complete capsid to empty capsid of the obtained recombinant adeno-associated virus;

[0188] The purity of the obtained recombinant adeno-associated virus is increased, or the cell debris contained in the obtained recombinant adeno-associated virus is reduced; and

[0189] The genome integrity of the obtained recombinant adeno-associated virus is increased.

[0190] rAAV acquisition process

[0191] Example 22. rAAV acquisition process

[0192] A process for obtaining, extracting and / or purifying recombinant adeno-associated virus (rAAV) without disturbing, lysing and / or destroying host cells.

[0193] Example 23. Chromatographic process

[0194] In Example 22, the rAAV acquisition process further includes:

[0195] (e-1) separating the culture medium from the host cells in the product obtained in the previous process;

[0196] (e-2) filtering the culture medium;

[0197] (e-3) subjecting the product obtained in step (e-2) to affinity chromatography; and

[0198] (e-4) The product obtained in step (e-3) is subjected to anion exchange chromatography.

[0199] Example 24. Ultracentrifugation process

[0200] In Example 22, the rAAV acquisition process further includes:

[0201] (e-1) separating the culture medium from the host cells in the product of step (d);

[0202] (e-2) filtering the culture medium;

[0203] (e-3) subjecting the product of step (e-2) to PET precipitation;

[0204] (e-4) adding a nuclease to the product of step (e-3) in the presence of a salt;

[0205] (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and

[0206] (e-6) subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation.

[0207] rAAV production method

[0208] Example 25. rAAV production method

[0209] A method for producing a recombinant adeno-associated virus (rAAV), comprising:

[0210] (a) performing the host cell preparation method of any one of Examples 1 to 6;

[0211] (b) subjecting the host cell prepared in step (a) to the pre-culture process of any one of Examples 7 to 11;

[0212] (c) culturing, incubating, proliferating and / or growing the host cells that have completed step (b);

[0213] (d) subjecting the host cell having completed step (c) to the osmotic shock process of any one of Examples 12 to 21; and

[0214] (e) performing any one of the processes for obtaining the recombinant adeno-associated virus of Examples 22 to 24 on the host cells that have completed step (d).

[0215] [Experimental example]

[0216] Hereinafter, the disclosure provided by this specification will be described in more detail by experimental examples and embodiments. These embodiments are only intended to illustrate the contents disclosed in this specification. It is obvious to those skilled in the art that the scope of the disclosure of this specification should not be interpreted as being limited by these embodiments.

[0217] Experimental Example 1. Experimental Methods and Materials

[0218] Experimental Example 1.1. Preparation of recombinant adeno-associated virus expression plasmid

[0219] In three recombinant adeno-associated virus plasmids - Addgene #202364 (pAAVCMV.PI.eGFP.WPRE.bGH), Addgene #327732pRepCap9 and Addgene #244764pHelper

[0220] In the experiment, pAAV was transformed into NEB stable competent cell line (CAT.C3040H), while the other two plasmids were transformed into Dyne bio DH5a strain (DYO1350). The culture method includes subculturing in 3L units and then freezing and storing Escherichia coli (E. coli) cells transformed with each plasmid to produce frozen cell stocks. These frozen cells are then subcultured in large volumes (culture medium: LB broth (BDDIFCO 244620)). Plasmids are prepared by using plasmid extraction kits (Nucleobond PC 10000EF, Giga kit for endotoxin-free plasmid DNA (Macherey-Nagel, CAT.740548)).

[0221] Experimental Example 1.2. Host cell preparation

[0222] Expi293F cells (Cat#A14527, Thermo) were grown in Expi293 expression medium (Cat#A14351-02, Thermo) supplemented with 1% penicillin-streptomycin (Cat#15140122, Thermo). Then, the cells were maintained under serum-free suspension culture conditions. Herein, serum-free suspension culture conditions were as follows: 120 rpm stirring rate in a shaking incubator (Cat#NB-206CL, N-biotek, Korea); 37°C; 8% CO2; and 85% relative humidity.

[0223] For large-scale production of recombinant adeno-associated virus vectors, cells were cultured in 250 mL of culture medium in 1 L Erlenmeyer flasks (Cat#784011, Nest) with shaking at 120 rpm.

[0224] Experimental Example 1.3. Transfection of recombinant adeno-associated virus expression plasmid into host cells

[0225] Expi293F cells were cultured at 2.5 × 10 6 The density of cells / 1mL was inoculated in Expi293F expression medium and cultured for 3 hours. Then, 25-kDa linear PEI (Cat#23966-1, Polyscience, USA) and three plasmids (pHelper [Cat#112867, Addgene], pRC9n [Cat#112865, Addgene] and pAAV [Cat#105530, Addgene]) were used to transfect cells respectively. Specifically, the plasmid was mixed in DMEM (Cat#10569010, Thermo) with 1 / 10 volume of the cells to be transfected. Next, PEI was added to the DNA diluted in DMEM. After another 20 minutes of culture, the DNA-PEI complex was added to the cells.

[0226] Experimental Example 1.4. Harvest before Purification of Recombinant Adeno-Associated Virus 1 - Osmotic Shock

[0227] After 96 hours of transfection according to Experimental Example 1.3, an osmotic shock reagent (using a 0.5M NaCl aqueous solution) was added to the host cells and the conditions were maintained for 3 hours. Then, the host cell culture was collected into a 1000mL polypropylene conical tube by pouring into a shake flask. Next, the cell culture was centrifuged at 3300X g for 30 minutes at 4°C using a high-speed centrifuge (Cat#SU-R22, Hanil) and an angle rotor (Cat#A1000-4.Hanil). The cells were discarded and the supernatant was used for purification using a filtrate 0.45PES filtration system.

[0228] Experimental Example 1.5. Harvest before recombinant adeno-associated virus purification 2 - freezing and thawing

[0229] According to experimental example 1.3, after transfection for 96 hours, the cells were frozen and thawed for more than 6 cycles. In this article, -197 ° C liquid nitrogen was used to freeze the cells, and the cells were thawed in a water bath at 37 ° C. Then, the recombinant adeno-associated virus particles in each culture medium were precipitated in 40% PEG 8000 (Cat# V3011, Promega), 2.5M NaCl and pH 7.4 of 1 / 4 cell culture volume. Next, each precipitate was cultured overnight at 4 ° C, and the recombinant adeno-associated virus in each culture medium was precipitated by centrifugation at 3,300xg for 20 minutes. The precipitate was resuspended in resuspension buffer (1xPBS, 250mMNaCl, 0.001% PF-68 and pH 7.5). After nuclease treatment (50U / mL, at 37 ° C for 1 hour), cell debris was centrifuged at 4,000rpm for 30 minutes.

[0230] Experimental Example 1.6. Purification of recombinant adeno-associated virus - ultracentrifugation

[0231] For the recombinant adeno-associated virus harvested by Experimental Example 1.4 or Experimental Example 1.5, the following method was used to perform an ultracentrifugation process to purify the recombinant adeno-associated virus:

[0232] 1) Use a pipette needle attached to a 10 mL syringe to pipette the rAAV into a Beckman Quick Seal tube.

[0233] 2) 6 mL of 15% iodixanol (Cat# PB-1893, Progen), 6 mL of 25% iodixanol, 6 mL of 40% iodixanol and 5 mL of 60% iodixanol were layered in sequence from the bottom of the Beckman Quick seal tube into which the recombinant adeno-associated virus was pipetted.

[0234] 3) Then, add 1X PBS to completely fill the Beckman Quick Seal tube.

[0235] 4) Centrifuge the Beckman Quick Seal tubes from step 3) at 350,000 x g for 1.5 hours at 10°C using a 70Ti rotor.

[0236] 5) Next, to recover the recombinant adeno-associated virus particles, a Beckman Quick seal tube was secured to a clamping stand at eye level and an 18G needle was inserted into the top of the tube to allow air to enter.

[0237] 6) Then, another 18G needle was inserted into the tube just below the interface of the 40% and 60% iodixanol layers, with the bevel of the needle pointing upward.

[0238] 7) Using an 18G needle, extract approximately 4 mL of the recombinant adeno-associated virus sample contained in the 40% iodixanol layer.

[0239] 8) Centrifuge the extracted samples again at 350,000 x g for 1.5 hours at 10°C using a 70Ti rotor.

[0240] 9) Then, repeat the process from step 5) to step 7) to obtain the purified recombinant adeno-associated virus.

[0241] Experimental Example 1.7. Concentration and buffer exchange

[0242] First, Viva Spin 20 concentrates were coated with 0.1%, 0.01% and 0.001% PF-68, respectively. Then, the recombinant adeno-associated virus samples extracted according to Experimental Example 1.6 were added to 10mL of preparation buffer (1xPBS, 220mM NaCl, 5% D-sorbitol and pH 7.5) pre-distributed on the top of Vivaspin 20 100,000MWCO (cat#VS2020, Sartorius) concentrators, and centrifuged at 3000x g for 10 minutes. After most of the solution passed through the filter, 10mL PBS was added, and the washing and rotation were repeated 5 times. After the final wash, the preparation buffer solution was repeatedly rotated until 200 μL remained, and the virus in each sample was then aliquoted and stored at -80°C for future use.

[0243] Experimental Example 1.8. Silver staining

[0244] For use in SDS-PAGE gels, recombinant adeno-associated virus samples were prepared by adding an appropriate amount of NuPAGE lithium dodecyl sulfate (LDS) sample buffer (Cat#NP0007, Thermo). Then, the samples were placed at 70°C for 10 minutes. Next, the same amount of recombinant adeno-associated virus in each sample was loaded onto a Bolt 4-12% Bis-Tris gel (Cat#NW04122BOX, Thermo), and then electrophoresed in Bolt 2-(N-morpholine) ethanesulfonic acid (MES) SDS running buffer (Cat#B0002, Thermo). After electrophoresis, the gel was stained using the SilverXpress silver staining kit (Cat#LC6100, Thermo) according to the manufacturer's instructions.

[0245] Experimental Example 1.9. Coomassie Brilliant Blue Staining

[0246] Before Coomassie Brilliant Blue staining, the recombinant adeno-associated virus sample was cultured at 95°C for 10 minutes. Then, 200V was run through the gel for 40 minutes until the loading dye reached the bottom of the gel. The gel was soaked in distilled water and cultured twice for 5 minutes each time. Next, the gel was placed in Coomassie Brilliant Blue R-250 staining solution (Cat# EBC001-1000, Enzynomics) and cultured for 1 hour under gentle stirring. Then, the gel was decolorized with a decolorizing solution (80% distilled water, 10% methanol and 10% acetic acid). Then, the decolorizing solution was removed and decolorized with a new decolorizing solution.

[0247] Experimental Example 1.10. qRT-PCR

[0248] For qRT-PCR, DNase I was added to the sample, and the sample was incubated at 37°C for 30 minutes. Then, proteinase K was added, and the sample was incubated at 55°C for 30 minutes. Next, the sample was inactivated by standing at 95°C for 15 minutes.

[0249] In this paper, pTR UF-11 plasmid (ATCC MBA-331) was used as a standard plasmid, and reference standard stock solution AAV8 (ATCC VR-1816) was used as a positive control.

[0250] The primers used in qRT-PCR are as follows:

[0251] 1) ITR (forward: GGAACCCCTAGTGATGGAGTT (sequence ID number 1), reverse: CGGCCTCAGTGAGCGA (sequence ID number 2), Prv: CACTCCCTCTCTGCGCGCTCG (sequence ID number 3))

[0252] 2) bGH (Forward: GCCAGCATCTGTTGT (SEQ ID No. 4), Reverse: GGAGTGGCACCTTCCA (SEQ ID No. 5), Prv: TCCCCCGTGCCTTCCTTGACC (SEQ ID No. 6))

[0253] The run protocol used was 10 minutes at 95° C., followed by 40 cycles of (30 seconds at 95° C. and 1 minute at 60° C.) conditions. After the process was completed, the samples were analyzed with QuantStudio3 (Applied Biosystem).

[0254] Experimental Example 1.11. Digital PCR

[0255] To perform digital PCR, DNase I was added to the sample and the sample was incubated at 37°C for 30 minutes. Then, proteinase K was added and the sample was incubated at 55°C for 30 minutes. Next, the sample was placed at 95°C for 15 minutes to inactivate the sample. Then, the sample was incubated from 10 5 Serial dilution up to 10 7 .

[0256] The primers used in digital-PCR are as follows:

[0257] 1) ITR (forward: GGAACCCCTAGTGATGGAGTT (sequence ID number 1), reverse: CGGCCTCAGTGAGCGA (sequence ID number 2), Prv: CACTCCCTCTCTGCGCGCTCG (sequence ID number 3))

[0258] 2) bGH (Forward: GCCAGCATCTGTTGT (sequence ID number 4), Reverse: GGAGTGGCACCTTCCA (sequence ID number 5), Prv: TCCCCCGTGCCTTCCTTGACC (sequence ID number 6))

[0259] The following process was used as a running protocol: 10 minutes at 95° C., 40 cycles of 30 seconds at 94° C. and 1 minute at 60° C., and 10 minutes at 98° C. After the process was completed, analysis was performed using the QIACuity dPCR system (Qiagen).

[0260] Experimental Example 1.12. TEM analysis

[0261] TEM was used for analysis to visualize the recombinant adeno-associated virus particles. Negative staining analysis was performed to analyze the complete capsid-empty capsid ratio. Specifically, 1) 10 μL of the sample was placed in a carbon support film (formvar / carbon) coated with a Ni grid for 5 minutes, 2) the sample was stained with 5% uranyl acetate for 2 minutes. 3) After washing the dye used, the sample was dried in air for 30 minutes. 4) The sample was analyzed using a transmission electron microscope (Tecnai G2 spirit twin (FEI, Netherlands, accelerating voltage 120 kV)) from Match Finder.

[0262] Experimental Example 2. Experiment on the yield improvement effect of the recombinant adeno-associated virus production process (including the osmotic shock process)

[0263] Experimental Example 2.1. Experimental conditions and methods

[0264] Based on the osmotic shock conditions, the following experiments were performed to determine the yield improvement effect of the rAAV production process including the osmotic shock process:

[0265] According to Experimental Examples 1.1 to 1.3, host cells capable of producing recombinant adeno-associated viruses of the AAV9 serotype were prepared.

[0266] For each experimental group, 2.5 × 10 6 cells / mL, and a total of 16 culture vessels were used for each experimental group.

[0267] Based on the time of transfection of the recombinant adeno-associated virus expression plasmid into the host cells, the osmotic shock reagent was added after 4 days, the conditions were maintained for 3 hours, the sample medium and / or cells were harvested, and the viral genome (vg) counts were measured.

[0268] Experimental Example 2.2. Effect of salt addition on yield improvement according to concentration

[0269] According to Experimental Example 2.1, the yield improvement effect of the osmotic shock process at each salt concentration was measured.

[0270] The composition of the osmotic shock reagent for each experimental group is shown in the table below.

[0271] [Table 1]

[0272] Label Culture medium volume (mL) Transfection (mL) Salt shock (mL) Total volume (mL) NT 30 3 0 33 0.1M NaCl 30 3 0.66 33.66 0.2M NaCl 30 3 1.32 34.32 0.5M NaCl 30 3 3.3 36.3 1.0M NaCl 30 3 6.6 39.6

[0273] The results showed that as the salt concentration causing osmotic shock increased, the number of viral genomes recovered from the culture medium increased ( Figure 1 ). This indicates that when the salt concentration is increased to 1.0 M, the host cells actively release the recombinant AAV particles into the culture medium.

[0274] Experimental Example 2.3. Salt addition and yield improvement effect by salt type

[0275] According to Experimental Example 2.1, the yield improvement effect of the osmotic shock process of each salt type was determined.

[0276] The composition of the osmotic shock reagent for each experimental group is shown in the table below.

[0277] [Table 2]

[0278] Label Culture medium volume (mL) Transfection (mL) Salt shock (mL) Total volume (mL) NT 30 3 0 33 0.5M NaCl 30 3 3.3 36.6 0.5M KCl 30 3 5.5 38.5 <![CDATA[0.5M MgCl2]]> 30 3 16.5 39.5

[0279] The results showed that NaCl, KCl, and MgCl2 all showed a significant increase in the number of viral genomes recovered from the culture medium compared to the negative control (NT) without osmotic shock ( Figure 2 ). This can be explained by the host cells releasing recombinant AAV particles into the culture medium regardless of the salt type.

[0280] Experimental Example 3. Experimental results of improving the yield of a recombinant adeno-associated virus production process including a pre-culture treatment process Test

[0281] Experimental Example 3.1. Experimental conditions and methods

[0282] The following experiment was conducted to determine the yield improvement effect of the recombinant adeno-associated virus production process (including pre-culture treatment) according to the pre-culture treatment conditions:

[0283] According to Experimental Examples 1.1 to 1.3, host cells capable of producing recombinant adeno-associated viruses of the AAV9 serotype were prepared.

[0284] For each experimental group, 2.5 × 10 6 cells / mL, and a total of 8 culture vessels were used for each experimental group.

[0285] Based on the time of transfection of recombinant adeno-associated virus expression plasmid into host cells, pre-culture treatment process is carried out after 4 hours, and after 4 days, osmotic shock reagent is added, the condition is maintained for 3 hours, sample culture medium and / or cells are harvested to measure the number of viral genomes (vg). In this article, pre-culture treatment process is carried out by adding pre-culture agent to host cells.

[0286] Experimental Example 3.2. Yield improvement effect of pre-culture treatment with nocodazole and M344

[0287] According to Experimental Example 3.1, when pre-culture treatment was performed with nocodazole and / or M344, the yield improvement effect was measured.

[0288] The composition of the pre-culture treatments for each experimental group is shown in the table below:

[0289] [Table 3]

[0290] Label Pre-culture agent Comparison none PEI (1mg / ml) PEI (1mg / ml) Nocodazole PEI (1 mg / ml), Nocodazole (4 uM) M344 PEI (1mg / ml), M344 (2.5uM) Nocodazole + M344 PEI (1 mg / ml), Nocodazole (4uM), M344 (2.5uM)

[0291] The experimental results showed that when nocodazole and M344 were added during the pre-culture treatment, the yield of recombinant adeno-associated virus in host cells increased ( Figure 3 ). It is noteworthy that when nocodazole and M344 were added simultaneously, the yield obtained during the pre-culture treatment was much higher than the yield obtained when nocodazole and M344 were added separately. In short, when both nocodazole and M344 were added during the pre-culture treatment, nocodazole and M344 were shown to produce a synergistic effect and had a significant impact on improving yield.

[0292] Experimental Example 33. Yield improvement effect of pre-culture treatment with sugar, nocodazole and M344

[0293] According to Experimental Example 3.1, when pre-culture treatment was performed with nocodazole, M344 and / or sugar, the yield improvement effect was measured.

[0294] The composition of the pre-culture treatments for each experimental group is shown in the table below:

[0295] [Table 4]

[0296] Label Pre-culture agent Comparison none Nocodazole + M344 PEI, Nocodazole (4uM), M344 (2.5uM) Sugar + Nocodazole + M344 PEI, sugar, nocodazole (4uM), M344 (2.5uM)

[0297] The experimental results showed that during the pre-culture treatment, the yield improvement was higher when nocodazole and M344 were added together compared with the addition of sugar (sucrose) alone ( Figure 4 ).

[0298] Experimental Example 4. Yield and yield of a recombinant adeno-associated virus production method including pre-culture treatment and osmotic shock process Experiments on quality improvement effects

[0299] Experimental Example 4.1. Production methods to be compared

[0300] In this experimental example, the method for producing recombinant adeno-associated virus (including pre-culture treatment and osmotic shock process) was compared with the conventional commonly used production method. Figure 5 Schematically depicted in .

[0301] The specific experimental methods are as follows:

[0302] Upstream Process

[0303] 1) Prepare a recombinant adeno-associated virus expression plasmid according to Experimental Example 1.1.

[0304] 2) Prepare host cells according to Experimental Example 1.2.

[0305] 3) According to Experimental Example 1.3, the recombinant adeno-associated virus expression plasmid prepared in step 1) is transformed into the host cell prepared in step 2).

[0306] 4) After the process of step 3) was carried out, the compound was added 4 hours later.

[0307] 5) One day after transformation, the host cells are subjected to a pre-culture treatment. According to the embodiment, the pre-culture treatment is omitted.

[0308] 6) 4 days after transformation, the cells are treated for downstream processing. According to the embodiment, the cells are treated by i) freezing and thawing or performing osmotic shock (see Experimental Example 1.4 or Experimental Example 1.5).

[0309] 7) After the treatment in step 6), downstream processes are performed.

[0310] Downstream Process

[0311] 1) The product obtained from the upstream process was filtered using a 0.45 μm PES filter, then precipitated with 40% PEG 8000 at 4°C for 1 hour with stirring, and filtered at 4°C overnight.

[0312] 2) The filtered product was centrifuged at 3000 g for 20 minutes at 4°C.

[0313] 3) The supernatant obtained by centrifugation was treated with nuclease in the presence of 2 mM MgCl 2 at 50 units / mL at 37° C. for 45 minutes.

[0314] 4) The nuclease-treated product was centrifuged at 2500 g for 30 minutes at 4°C.

[0315] 5) The product obtained by centrifugation was subjected to the ultracentrifugation method according to Experimental Example 1.6.

[0316] 6) The product obtained from step 5) was subjected to silver staining according to Experimental Example 1.8, Coomassie Brilliant Blue staining according to Experimental Example 1.9, and qRT-PCR according to Experimental Example 1.10. The characteristics of the products obtained from each process were analyzed.

[0317] 7) The product obtained in step 5) was finally formulated using a 100K PES concentrator and finally analyzed according to Experimental Examples 1.7 to 1.12.

[0318] The production method of recombinant adeno-associated virus is shown in the following table:

[0319] [Table 5]

[0320] Label Pre-culture treatment Cell preparation prior to downstream processing Downstream Process Process 1 X X X Process 2 X Freezing and thawing O Process 3 X Osmotic shock O Process 4 O X X Process 5 O Freezing and thawing O Process 6 O Osmotic shock O

[0321] Experimental Example 4.2. Comparison of cell survival rates of various methods

[0322] Figures 6 to 84 shows the results of comparing cell viability by TEM analysis immediately after the upstream process of Experimental Example 4.1 was performed on each example.

[0323] As a result of the experiment, process 2 (15.8%) and process 5 (18.2%) including the freezing and thawing process showed significantly lower cell survival rates than process 6 (35.4%) including the osmotic shock process. This suggests that a lot of damage was done to the cells during the freezing and thawing process, and when the osmotic shock process was included, less cell damage occurred compared to the typical freezing and thawing process.

[0324] Experimental Example 4.3. Comparison of the yield of each method

[0325] Fig. 9 and Fig.10 The following table shows the yield of recombinant adeno-associated virus obtained by performing all the processes of Experimental Example 4.1 on each example.

[0326] [Table 6]

[0327]

[0328] The experimental results show that when the pre-culture treatment process is included during the cell culture period, the host cells produce a large amount of recombinant adeno-associated virus, regardless of the recombinant adeno-associated virus recovery method.

[0329] Experimental Example 4.4. Comparison of the purity of recombinant adeno-associated viruses obtained by various methods

[0330] For each embodiment, Figures 11 to 13 Coomassie blue staining results are shown for comparison of purity.

[0331] refer to Figures 11 to 13 , it was confirmed that the purity of the recombinant adeno-associated virus obtained by the freezing and thawing process (process 2 and process 5) was significantly lower than the purity of the recombinant adeno-associated virus obtained by the osmotic shock process (process 3 and process 6). Specifically, when comparing process 2 and process 3, it was confirmed that the column appearing in process 2 showed a significantly higher background band than the column appearing in process 3. This is considered to be because when the freezing and thawing process is included, the cells are broken and many cell fragments are generated.

[0332] Experimental Example 4.5. Comparison of genome integrity of recombinant adeno-associated viruses obtained by various methods For each embodiment, the genome integrity results according to Experimental Example 1.10 are shown in the following table:

[0333] [Table 7]

[0334] process ITR BG Genome integrity Process 2 3.49E+13 2.03E+13 58％ Process 3 1.86E+13 1.38E+13 75％ Process 5 3.09E+13 1.68E+13 54％ Process 6 2.74E+13 1.75E+13 64％

[0335] The experimental results show that when the recombinant adeno-associated virus is prepared according to the embodiment of applying osmotic shock, the genome integrity is higher than the genome integrity when the recombinant adeno-associated virus is prepared by disrupting cells using a freezing and thawing method. Even if the pre-culture treatment process is not included, the same trend is shown. This shows that the osmotic shock process is an important process for producing the expected recombinant adeno-associated virus with high quality.

[0336] Experimental Example 4.6. Comparison of the ratio of complete capsid to empty capsid of recombinant adeno-associated viruses obtained by various methods

[0337] For each embodiment, the results of TEM analysis performed according to Experimental Example 1.11 show that Figures 14 to 17 middle.

[0338] As a result of the analysis, the intact / empty ratios in process 2 and process 5, in which cells were disrupted by freezing and thawing, were only 40% and 67%, respectively. In contrast, in process 3 and process 6, which included an osmotic shock process, high intact / empty ratios of 82% and 87%, respectively, were shown. This indicates that the osmotic shock process has a very large effect on the increase in the intact / empty ratio (compare process 2 with process 3, and process 5 with process 6). This indicates that the pre-culture treatment process also contributes to the increase in the intact / empty ratio to a certain extent (compare process 2 with process 5, and process 3 with process 6).

[0339] Experimental Example 4.7. Comparison of the yield and purity of recombinant adeno-associated viruses obtained by various methods

[0340] The yield results of the entire process of Experimental Example 4.1 are shown in the following table:

[0341] [Table 8]

[0342] process vg / ml Total VG volume percentage Process 2 7.82E+13 2.35E+13 0.3ml 100％ Process 3 5.15E+13 1.54E+13 0.3ml 66％ Process 5 8.02E+13 8.02E+13 1.0ml 342％ Process 6 8.58E+13 8.58E+13 1.0ml 366％

[0343] In addition, in order to compare the purity of the obtained recombinant adeno-associated virus, the silver staining results performed according to Experimental Example 1.8 are as follows: Fig.18 shown.

[0344] The experimental results confirmed that 1) the yield was significantly higher in the case of pre-culture treatment compared to the process without pre-culture treatment, and 2) compared to the process including conventional freezing and thawing process, when using the osmotic shock process, recombinant adeno-associated virus particles with significantly higher purity can be obtained. In summary, the method for producing recombinant adeno-associated virus disclosed herein includes a pre-culture treatment process and an osmotic shock process. By including these processes, the method can produce recombinant adeno-associated virus with high quality and high yield compared to conventional production methods.

[0345] Industrial Applicability

[0346] The method for producing recombinant adeno-associated virus disclosed herein can be used to produce recombinant adeno-associated virus with high quality and high yield. The method is a method for producing recombinant adeno-associated virus that is more excellent and economical than conventional production methods.

Claims

1. A method for producing a recombinant adeno-associated virus (rAAV), comprising: (a) preparing a host cell, wherein the host cell comprises a vector encoding a component of the rAAV, such that the host cell is capable of expressing the rAAV; (b) adding sugar, nocodazole and M344 to a culture medium containing the host cells; (c) culturing the host cell, wherein the culturing enables the rAAV to be expressed in the host cell; (d) applying osmotic shock by adding salt to the culture medium containing the host cells, wherein the osmotic shock promotes the release of the rAAV from the host cell into the culture medium; and (e) obtaining the rAAV from the culture medium without lysing the host cells.

2. The method according to claim 1, in, The serotype of the rAAV is selected from one or more of the following: Wild-type serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10; Synthetic (variant) serotypes, including AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV6.2; and Other AAV variant serotypes.

3. The method according to claim 1 or 2, in, Step (e) comprises: (e-1) separating the culture medium from the host cells in the product of step (d); (e-2) filtering the culture medium; (e-3) subjecting the product of step (e-2) to PET precipitation; (e-4) adding a nuclease to the product of step (e-3) in the presence of a salt; (e-5) subjecting the product of step (e-4) to a first iodixanol gradient ultracentrifugation; and (e-6) subjecting the product of step (e-5) to a second iodixanol gradient ultracentrifugation.

Images