Application of CD84 as therapeutic target in preparation of medicine for preventing and treating inflammatory bowel disease

Abstract

The invention provides application of CD84 as a therapeutic target in preparation of drugs for preventing and treating inflammatory bowel diseases, and belongs to the technical field of biological medicines. The CD84 is applied to development, screening or preparation of drugs for preventing and / or treating inflammatory bowel diseases as a therapeutic target. According to the application, a dextran sodium sulfate (DSS)-induced inflammatory bowel disease classical animal model is taken as an experimental subject, and the anti-CD84 antibody is taken as a drug to block the biological function of CD84, so that the degree of DSS-induced mouse enteritis can be effectively relieved, the colorectal length can be recovered, and the secretion level of inflammatory factors can be reduced. Therefore, a new strategy is provided for targeted therapy of the inflammatory bowel disease by taking the CD84 as a therapeutic target.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of CD84 as a therapeutic target in the preparation of drugs for preventing and treating inflammatory bowel disease. Background Art

[0002] Inflammatory bowel disease (IBD) is a chronic progressive disease, mainly including ulcerative colitis (UC) and Crohn's disease (CD). It spreads from the rectum to the surrounding areas and even to the vicinity of the appendix. Its pathological diagnosis mainly focuses on four aspects: intestinal mucosal structure, intestinal lamina propria cell structure, inflammatory cell infiltration and epithelial cell structure destruction. The dysregulation of intestinal macrophages will lead to the loss of tolerance to commensal bacteria, which is also the basis for the chronic inflammation of IBD. Various inflammatory factor signals activated by abnormal intestinal microenvironment will directly induce typical polarization of monocytes, especially pro-inflammatory M1 macrophages. M1 macrophage polarization is mediated by the activation of Toll-like receptors (TLR) induced by TNF-α, IFN-γ, etc., which in turn produces high levels of pro-inflammatory factors such as IFN-γ, IL-1β, IL-6, IL-12 to fight against foreign immunogens, but it will also lead to abnormal tissue damage and repair. STAT1 is an important signal mediating the polarization of M1 macrophages. IFN-γ activates TLRs, which in turn activate downstream STAT1, mediating the secretion of a variety of classic inflammatory factors of M1 macrophages, such as CXCL9 and CXCL10. Excessive activation of M1 macrophages is an important factor leading to the progression of IBD, which causes continuous damage to intestinal epithelial cells by continuously activating inflammatory-related signals. Targeting macrophage polarization is also currently considered a new strategy for the treatment of IBD.

[0003] CD84 (SLAMF5) is a member of the signaling lymphocyte activation molecule (SLAM) family. It is mainly expressed in bone marrow-derived lymphocytes, monocytes, macrophages, etc., and plays an important role in immune cell communication, differentiation, and microenvironment regulation. Currently, CD84 is often used as a biomarker for some immune-related diseases in clinical practice. For example, in rheumatoid arthritis, CD84 +Patients can benefit more from anti-TNF-α therapy; in patients with systemic lupus erythematosus, high expression of CD84 is significantly positively correlated with disease progression. Some in vitro studies have also demonstrated the potential clinical value of anti-CD84 therapy, such as CD84 neutralizing antibodies can significantly alleviate T cell differentiation in RA mouse models and alleviate the malignant progression of chronic lymphocytic leukemia mouse models, indicating that CD84 may be a reliable clinical target. At present, the function of CD84 and the molecular signal transduction involved in it are not fully understood. Some studies have revealed the role of CD84 in monocyte / macrophage activation, such as CD84's involvement in lipopolysaccharide-induced MAPK activation in bone marrow-derived macrophages, indicating that CD84 may be involved in the differentiation and regulation of macrophages. In summary, CD84 may be a target with clinical potential, and understanding its specific functions and molecular signal transduction in macrophage activation is of great significance for the development of innovative drugs.

[0004] Currently, available IBD treatments include non-targeted and targeted therapies. Non-targeted therapeutic drugs include aminosalicylic acid, glucocorticoids, and immunomodulators. These non-targeted drugs have the advantages of rapid onset of action and reduced surgical and hospitalization rates, but they have the disadvantages of high treatment costs and strong side effects, such as headaches, nausea, and hormone-induced "moon faces" that affect beauty, as well as emotional instability, fatigue, and rashes. In terms of targeted therapy, seven biologics have been officially approved by the U.S. Food and Drug Administration (FDA) for the treatment of IBD, including targeting TNF-α, targeting IL-12 / IL-23, targeting JAK, targeting cell adhesion molecules, and targeting NLRP3 inflammasomes. Clinical results have shown that targeted therapy has obvious therapeutic advantages over non-targeted therapy.

[0005] Although biological targeted therapy is effective for many patients, some patients still do not respond to initial treatment, indicating that these therapeutic targets have certain limitations and there is an urgent need to develop a new IBD therapeutic target. Summary of the invention

[0006] In view of this, the object of the present invention is to provide a use of CD84 as a therapeutic target in the preparation of a drug for preventing and treating inflammatory bowel disease.

[0007] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating inflammatory bowel disease.

[0008] Preferably, the inflammatory bowel disease includes Crohn's disease and ulcerative colitis.

[0009] Preferably, the CD84 comprises macrophage CD84.

[0010] Preferably, the drug comprises an agent that inhibits the biological function of CD84.

[0011] Preferably, the drug is a drug that inhibits the polarization of macrophages to M1 macrophages.

[0012] Preferably, the M1 macrophages induce intestinal epithelial damage.

[0013] Preferably, the drug is a drug that alleviates the severity of enteritis, alleviates colorectal lesions and reduces the level of inflammatory factors.

[0014] Preferably, the relief of colorectal lesions comprises restoring colorectal length.

[0015] Preferably, the inflammatory factors include at least one of the following: TNF-α, IL-1β and IL-6.

[0016] The present invention also provides the use of CD84 gene or protein as a marker in the preparation of a reagent or a kit for diagnosing inflammatory bowel disease.

[0017] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating inflammatory bowel disease. Experimental results show that CD84 is highly expressed in the intestine of DSS-induced IBD mouse models, and CD84 regulates M1 macrophage polarization by participating in JAK1 / STAT1 signal activation, and CD84 deficiency can alleviate intestinal epithelial damage caused by M1 macrophages. At the same time, enteritis usually leads to shortening of colorectal lesions. The present invention also statistically analyzes the length of the colorectum of mice in the control group, model group and drug-treated group, and the results show that compared with the control group, the colorectum of mice in the model group was significantly shortened, while the length of the colorectum of mice with CD84 knocked out was significantly restored, which proves that blocking the function of CD84 can significantly alleviate colorectal lesions caused by DSS. The present invention also detects the secretion of inflammatory factors in the three treatment groups. The results show that compared with the control group, the secretion level of key inflammatory factors in the model group was significantly increased, while the protein levels of TNF-α, IL-1β, and IL-6 in the serum of mice with CD84 knocked out were significantly reduced, proving that blocking CD84 can significantly reduce the level of serum inflammatory factors in IBD mice, thereby reducing the inflammatory response of mice. It can be seen that the above experimental results show that the treatment and prevention of inflammatory bowel disease can be effectively achieved by blocking or knocking down the biological function of CD84 or knocking down the expression of CD84. Therefore, CD84 can be widely used as a therapeutic target in the development, screening or preparation of drugs for the prevention and / or treatment of inflammatory bowel disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results of CD84 expression level in intestinal tissue of DSS-induced IBD mice are shown in Figure 2.

[0019] Figure 2The results show the effect of CD84 knockdown on inhibiting LPS / IFN-γ-induced JAK1 / STAT1 signaling activation;

[0020] Figure 3 The results show the effect of CD84 knockdown on the inhibition of LPS / IFN-γ-induced M1 polarization;

[0021] Figure 4 The results show the effect of CD84 knockdown on inhibiting the expression of inflammatory factors in M1 macrophages induced by LPS / IFN-γ;

[0022] Figure 5 The results show that knockdown of CD84 alleviates M1-induced intestinal epithelial cell damage;

[0023] Figure 6 The results showed that CD84 deficiency in macrophages could significantly alleviate the severity of DSS-induced IBD.

[0024] Figure 7 The results show that the lack of CD84 in macrophages can alleviate the intestinal shrinkage caused by DSS;

[0025] Figure 8 The results show that the lack of CD84 in macrophages can alleviate the intestinal epithelial barrier damage caused by DSS;

[0026] Fig. 9 The results show that the loss of CD84 in macrophages affects the polarization of M1 macrophages in mice with alleviated IBD. DETAILED DESCRIPTION

[0027] The present invention provides the use of CD84 as a therapeutic target in the development, screening or preparation of drugs for preventing and / or treating inflammatory bowel disease.

[0028] In the present invention, the inflammatory bowel disease is not a single disease, but a general term for a group of diseases. The inflammatory bowel disease preferably includes Crohn's disease and ulcerative colitis. Crohn's disease mostly occurs in the digestive tract, and ulcerative colitis mainly occurs near the rectum and anus.

[0029] In the present invention, the inflammatory bowel disease is preferably induced by dextran sulfate sodium salt. The induction concentration of dextran sulfate sodium salt is preferably 3 to 5wt%. In an embodiment of the present invention, a mouse inflammatory bowel disease model induced by dextran sulfate sodium salt was used as an experimental subject. Compared with the control group (NaCl injection), the DAI score of the model group mice began to increase on the 4th day of modeling. At the same time, enteritis usually leads to shortening of colorectal lesions. Compared with the control group, the colorectum of the model group was significantly shortened. The results of serum inflammatory factor detection showed that the protein content of inflammatory factors TNF-α, IL-1β, and IL-6 in the model group was significantly higher than that in the control group. This shows that the present invention successfully constructed a mouse inflammatory bowel disease model.

[0030] In the present invention, the CD84 preferably includes CD84 of macrophages. The drug preferably includes an agent that inhibits the biological function of CD84. The agent includes an agent that interferes with the expression of the CD84 gene and an agent that inhibits the CD84 protein. The agent that interferes with the expression of the CD84 gene is preferably siRNA. The nucleotide sequence of the siRNA is shown in SEQ ID NO:4. In an embodiment of the present invention, the expression of the CD84 gene is inhibited by siRNA, the polarization of M1 macrophages is regulated by participating in the activation of JAK1 / STAT1 signals, and the intestinal epithelial damage caused by M1 macrophages is alleviated. In another embodiment of the present invention, male macrophage-specific CD84-deficient mice were used as materials to establish a DSS-induced mouse 7-day IBD model, and the results showed that the absence of CD84 in macrophages can significantly alleviate the severity of DSS-induced enteritis in mice.

[0031] In the present invention, the drug is preferably a drug that alleviates the severity of enteritis, alleviates colorectal lesions, and reduces the level of inflammatory factors. The alleviation of colorectal lesions preferably includes restoring the length of the colorectum. The inflammatory factors preferably include at least one of the following: TNF-α, IL-1β, and IL-6.

[0032] In the present invention, the dosage form of the drug includes injection, powder, etc. The present invention has no special restrictions on the preparation method of the drug, and the preparation method of the drug known in the art can be used. The present invention has no special restrictions on the use method of the drug, and the drug dosage known in the art can be used.

[0033] The present invention also provides the use of CD84 gene or protein as a marker in the preparation of a reagent or a kit for diagnosing inflammatory bowel disease.

[0034] In the present invention, compared with healthy mice, the CD84 gene is highly expressed in the inflammatory bowel disease mouse model, and a significant difference can be achieved. Therefore, the CD84 gene or protein has good detection specificity and sensitivity, and can be used as a detection marker for auxiliary diagnosis of inflammatory bowel disease. In the present invention, the reagent for detecting the expression level of the CD84 gene or protein is used in the preparation of a reagent or kit for diagnosing inflammatory bowel disease.

[0035] The application of CD84 provided by the present invention as a therapeutic target in the preparation of drugs for preventing and treating inflammatory bowel disease is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1

[0037] Detection of high expression of CD84 in the intestine of DSS mice

[0038] 1. Experimental Methods

[0039] Male C57BL / 6 (6-8 weeks old) were used as experimental animals. A 7-day IBD model of DSS-induced mice was established. The model was established with 3% DSS solution on days 1 to 7. During the modeling period, the control group used sterile drinking water, and the model group and the drug-treated group were given 3% DSS solution. After 7 days, the mice were killed, the colorectal part of the mice was separated, and RNA was extracted after quick freezing in liquid nitrogen. The specific steps were to add 1 mL Trizol to the tissue, let it stand for 10 minutes to fully lyse, add 0.2 mL chloroform to each EP tube, vortex for 15 seconds, let it stand at room temperature for 3 minutes, and then centrifuge at 4°C 12000rpm for 15 minutes, then transfer the upper aqueous phase to a new 1.5 mL RNase free EP tube, add an equal volume of isopropanol to mix, let it stand at room temperature for 10 minutes, and then centrifuge at 4°C 12000rpm for 10 minutes. At this time, white flocculent precipitates can be seen at the bottom. The supernatant was discarded, and 1 mL of 75% ethanol prepared with DEPC water was added to wash the precipitate. The precipitate was centrifuged at 7000 rpm at 4°C for 5 min. The washing was repeated once, and the supernatant was aspirated. The precipitate was dried at room temperature for 10 min. 20 μL of RNase free water was added to dissolve the RNA, and then the expression of CD84 was quantitatively detected by qRT-PCR.

[0040] 2. Experimental results

[0041] Thaw the frozen RNA in an ice box and use an ultra-micro spectrophotometer to measure the concentration. Calculate the corresponding volume of each sample according to the mass of 1000ng. Add 4μL 5× Super Mix, appropriate amount of RNA, and RNase free water to 20μL in eight rows of tubes, place the eight rows of tubes in a PCR instrument, and set the program to 42℃15min and 95℃3min for reverse transcription. qPCR was prepared into a 20 μL system, including: 2 μL reverse transcription product cDNA, 10 μL SuperMix, 1 μL upstream primer (GGAGAAGAGGGTAATGTCCTTCA, SEQ ID NO: 1), 1 μL downstream primer (CCATTGCGATGTCTGC ACA, SEQ ID NO: 2), 6 μL RNase free water, and then eight rows of tubes were placed in the Roche LC96 instrument, and the program was set as pre-denaturation: 95°C, 300s; denaturation: 95°C 30s; annealing: 55°C 30s; extension: 72°C 30s, a total of 40 cycles. The expression of the target gene was detected and data processing was performed.

[0042] The results are as follows Figure 1 As shown, compared with the control group, the expression of CD84 in the intestinal tissue of mice in the DSS model group was significantly increased, with a significant difference.

[0043] Example 2

[0044] CD84 regulates M1 macrophage polarization by participating in JAK1 / STAT1 signaling activation

[0045] 1. Experimental Methods

[0046] THP1 monocytes were inoculated in six-well plates under sterile conditions at a density of approximately 1×10 6 / well, add PMA after 24h to make the working solution concentration 100ng / mL to induce monocyte adhesion. After that, siRNA will be used to knock down the CD84 gene. The experiment is divided into four groups: Scrambled siRNA, Scrambled siRNA+LPS / IFN-γ, CD84 siRNA, and CD84 siRNA+LPS / IFN-γ. The sequence of Scrambled siRNA is CUUACGCUGAGUACUUCGA (SEQ ID NO: 3), and the sequence of CD84 siRNA is GCUACAACCUGCAAAUCUAUU (SEQ ID NO: 4). In each group, 200μL of OPTI-MEM was used as the dispersion system in each well, 2μg of siRNA and 6μL of transfection reagent (Lipo2000) were added, and they were incubated for 5min respectively. Then the two were mixed, and the bottom of the tube was flicked to mix them thoroughly. After incubation for 10min, they were added to the well plate. After 24 hours of small interfering RNA knockdown, LPS (100 ng / mL) and IFN-γ (20 ng / mL) were added to the two stimulation groups to co-stimulate THP1 cells to induce the M1 model, and samples were collected after 24 hours.

[0047] 2. Experimental results

[0048] After the experiment, the activation of JAK1 / STAT1, a key signal for M1 macrophage polarization, and the expression of key M1 markers were detected as follows:

[0049] 2.1CD84 regulates JAK1 / STAT1 signal: Cells were collected with RIPA lysis buffer, ultrasonically disrupted 7 times, centrifuged at 4℃12000rpm for 10min, and the supernatant was taken as protein extract. The protein concentration was quantified using the BCA kit, and the absorbance was measured at 562nm using an enzyme marker. A standard curve was made based on the absorbance and protein standard concentration, and the sample loading volume was calculated. 5X Loading buffer was added to the protein extract, boiled at 100℃ for 7min, loaded according to the calculated sample volume, and protein electrophoresis was performed in sequence according to the concentrated gel 80V 30min and the separation gel 120V 1h. After the protein electrophoresis was completed, the gel plate was removed, the gel block near the target protein was cut and placed in the transfer folder, and the membrane was transferred at 100V for 2h. After the transfer was completed, it was blocked in 5% skim milk prepared in TBST solution for 1h. After that, the membrane position corresponding to the target protein was cut, placed in an incubation box containing the corresponding antibody, and incubated overnight at 4℃ on a shaker. The next day, the incubation box was taken out to recover the primary antibody, and an appropriate amount of TBST solution was added for washing. The corresponding secondary antibody was added and placed on a shaker for incubation at room temperature for 2 hours. After washing, the image was developed. A chemiluminescence imager was used to take pictures and analyze the band results.

[0050] Depend on Figure 2It can be seen that compared with the control group, the phosphorylation levels of STAT1, JAK1, JNK, P38, and Erk in the Scrambled siRNA+LPS / IFN-γ group were significantly increased, while after CD84 knockdown, their phosphorylation levels were significantly decreased, indicating that CD84 can directly regulate JAK1 / STAT1 signal transduction.

[0051] 2.2CD84 knockdown alleviates M1 macrophage polarization: The cells were collected with RIPA lysis buffer, ultrasonically disrupted 7 times, and centrifuged at 4°C and 12000rpm for 10min. The supernatant was taken as a protein extract, and the protein concentration was quantified using a BCA kit. The specific method is as follows: The absorbance value was measured at 562nm with an enzyme marker, and a standard curve was made based on the absorbance and protein standard concentration to calculate the sample loading volume. 5X Loading buffer was added to the protein extract, boiled at 100°C for 7min, loaded according to the calculated sample volume, and protein electrophoresis was performed in sequence according to the concentrated gel 80V 30min and the separation gel 120V 1h. After the protein electrophoresis was completed, the gel plate was removed, the gel block near the target protein was cut off and placed in the transfer folder, and the membrane was transferred at 100V for 2h. After the transfer was completed, it was blocked in 5% skim milk prepared in TBST solution for 1h. After that, the membrane position corresponding to the target protein was cut, placed in an incubation box containing the corresponding antibody, and incubated overnight at 4°C on a shaker. The next day, the incubation box was taken out to recover the primary antibody, and an appropriate amount of TBST solution was added for washing. The corresponding secondary antibody was added and placed on a shaker for incubation at room temperature for 2 hours. After washing, the image was developed. A chemiluminescence imager was used to take pictures and analyze the band results.

[0052] Depend on Figure 3 It can be seen that compared with the control group, the expression of M1 markers iNOS and CD86 in the LPS / IFN-γ model group was significantly increased, while the expression level of markers in the CD84 siRNA+LPS / IFN-γ group was significantly lower than that in the Scrambled siRNA+LPS / IFN-γ group, indicating that knockdown of CD84 can significantly inhibit the polarization of M1 macrophages.

[0053] 2.3CD84 knockdown inhibits the expression of inflammatory factors in M1 macrophages: Add 1mL Trizol to each well, blow down the cells, transfer to a 1.5mL RNase free centrifuge tube, and let stand for 5-10min to fully lyse the cells. Add 200μL chloroform to each tube, vortex thoroughly for 15s, and let stand at room temperature for 2-3min. Centrifuge at 4℃12000rpm for 15min, transfer 400μL of the upper water layer to a new RNase free1.5mL centrifuge tube, add 400μL isopropanol, mix well, and let stand at room temperature for 10min. Centrifuge at 4℃ and 12000rpm for 10min to obtain flocculent precipitate as RNA, discard the supernatant, add 1mL 75% ethanol, wash the precipitate, repeat once, absorb the excess solution, evaporate at room temperature, and RNA becomes colorless, indicating that the ethanol evaporates cleanly. Add RNase free water to dissolve, place in an ice box for 15min, and use a micro-spectrophotometer to detect and record the RNA concentration. Then, the RNA was reversed into cDNA, and the reverse program was: 42℃15min, 95℃3min. Then, the RT-PCR system was configured: 2×SYBR Green Mix 10μL per tube, 1μL of upstream and downstream primers per tube, 6μL of RNasefree water, and 2μL of cDNA template. After completion, the expression of the target gene was detected using Roche LC96. The primers involved are shown in Table 1 below:

[0054] Table 1 Primer sequences

[0055]

[0056] like Figure 4 As shown, CD84 knockdown could inhibit the expression of inflammatory factors IL-6, TNF-α and IL-1β in M1 macrophages induced by LPS / IFN-γ.

[0057] Example 3

[0058] CD84 deficiency alleviates intestinal epithelial damage caused by M1 macrophages

[0059] 1. Experimental Methods

[0060] THP1 monocytes were inoculated in transwell chambers under sterile conditions at a density of approximately 1*10 5 / well, add PMA after 24h to make the working solution concentration 100ng / mL to induce monocyte adhesion. Then siRNA will be used to knock down the CD84 gene. The CD84 siRNA sequence is GCUACAACCUGCAAAUCUAUU (SEQ ID NO: 4), and the Scrambled siRNA sequence is CUUACGCUG AGUACUUCGA (SEQ ID NO: 3). The experiment is divided into four groups: Scrambled siRNA, Scrambled siRNA+LPS / IFN-γ, CD84 siRNA, and CD84 siRNA+LPS / IFN-γ. Each well uses 200μL of OPTI-MEM as the dispersion system, adds 2μg of siRNA and 6μL of transfection reagent (Lipo2000), and incubates for 5min respectively. Then mix the two, flick the bottom of the tube to mix them thoroughly, incubate for 10min, and then add them to the well plate. After 24h of small interfering RNA knockdown, LPS (100ng / mL) and IFN-γ (20ng / mL) were added to the two stimulation groups to co-stimulate THP1 cells to induce the M1 model. After 24h, the transwell chamber was transferred to a 12-well plate that had been inoculated with intestinal epithelial cells Caco-2 in advance. After 24h of co-culture, the Caco-2 cells collected by RIPA lysis buffer were ultrasonically disrupted 7 times, centrifuged at 12000rpm at 4℃ for 10min, and the supernatant was taken as the protein extract. The protein concentration was quantified using the BCA kit, and the absorbance was measured at 562nm using an ELISA reader. A standard curve was prepared based on the absorbance and protein standard concentration, and the sample loading volume was calculated. 5X Loading buffer was added to the protein extract, boiled at 100℃ for 7min, and the sample was loaded according to the calculated sample volume. Protein electrophoresis was performed in the order of 80V for 30min on the concentrated gel and 120V for 1h on the separation gel. After the protein electrophoresis is completed, the gel plate is removed, and the gel block near the target protein is cut and placed in the transfer clip, and the membrane is transferred at 100V for 2h. After the transfer is completed, it is blocked in 5% skim milk prepared in TBST solution for 1h. After that, the membrane position corresponding to the target protein is cut, placed in an incubation box containing the corresponding antibody, and incubated overnight at 4°C on a shaker. The next day, the incubation box is taken out to recover the primary antibody, and an appropriate amount of TBST solution is added for washing, and the corresponding secondary antibody is added. It is placed on a shaker and incubated at room temperature for 2h, and it can be developed after washing. Use a chemiluminescence imager to take pictures and analyze the band results to detect the expression of epithelial damage markers.

[0061] 2. Experimental results

[0062] The results are as follows Figure 5As shown, the expression of tight junction proteins Occludin and ZO-1 in Caco-2 cells cultured with Scrambled siRNA+LPS / IFN-γ macrophages was significantly downregulated, proving that M1 macrophages caused serious intestinal barrier damage; and the inhibition of these two markers by CD84 siRNA+LPS / IFN-γ macrophages was significantly reduced, proving that CD84 deficiency can alleviate intestinal epithelial damage caused by M1 macrophages.

[0063] Example 4

[0064] CD84 deficiency in macrophages can alleviate DSS-induced IBD

[0065] 1. Experimental Methods

[0066] Using the Cre-LoxP system, CD11b Cre Mouse and CD84 fl / fl After more than three generations of crossbreeding, male macrophage-specific CD84-deficient mice (CD11b Cre CD84 fl / fl , CD84-CKO) and littermate wild-type mice (CD11b Cre CD84 - / - , WT). The DSS-induced 7-day IBD model in mice was established. The model was established with 3% DSS solution from day 1 to day 7. During the modeling period, the control group used sterile drinking water, and the model group and the drug group were given 3% DSS solution. The mice were killed 7 days later and the severity of IBD in the mice was analyzed.

[0067] 2. Experimental results

[0068] During the experiment, the disease activity index (DAI) of mice was scored every day. After the experiment, the colorectal length and serum inflammatory factor levels of each group of mice were tested. The experimental results are as follows:

[0069] 2.1DAI score: During the modeling period, the survival indicators of mice were observed and recorded every day. The disease activity index of mice was statistically analyzed based on the weight loss ratio, feces viscosity and blood in stool. The detailed scoring rules are shown in Table 2.

[0070] The experimental results are as follows Figure 6 As shown, it can be seen that from the third day of modeling, the DAI score of the model group began to increase, while the DAI score of the CD84-CKO group mice was significantly lower than that of the WT group mice, proving that the absence of CD84 in macrophages can significantly alleviate the severity of DSS-induced enteritis in mice.

[0071] Table 2 DAI scoring rules for IBD mice

[0072]

[0073] 2.2 Colorectal length: Enteritis usually leads to shortened colorectal lesions, so the severity of IBD can be determined by measuring the length of the colorectum. The colorectal sections of mice were separated and the lengths were counted.

[0074] The results are as follows Figure 7 As shown, the colorectum of mice in the WT-DSS model group was significantly shortened, while the degree of colorectal shrinkage in CD84-CKO-DSS mice was significantly lower than that in the WT group. Further statistics on the specific lengths showed that the colorectal length of CD84-CKO-DSS mice was significantly better than that in the WT-DSS group, proving that the absence of CD84 in macrophages can significantly alleviate colorectal lesions caused by DSS.

[0075] 2.3 Intestinal barrier damage: The degree of intestinal barrier damage was determined by detecting the expression of tight junction proteins Occludin and ZO-1 in intestinal tissue homogenates. RNA was extracted from intestinal tissues, and then the expression of the two genes was detected using qPCR.

[0076] like Figure 8 As shown, the intestinal barrier of mice in the DSS group showed obvious damage, but the loss of CD84 in macrophages could significantly restore the expression of the two proteins, proving that the loss of CD84 in macrophages could significantly alleviate the intestinal barrier damage caused by DSS.

[0077] 2.4 Activation degree of M1 macrophages: When mice were killed, primary bone marrow-derived macrophages (BMDM) were isolated by cutting the leg bones of the mice, flushing out the bone marrow cells in the femur and tibia of the mice with 1 mL of DMEM, lysing them with red blood cell lysis buffer for 3 minutes, and then washing with sterile PBS to obtain BMDM. The protein of BMDM was extracted, and the expression of M1 marker factors iNOS and CD86 was detected.

[0078] The results are as follows Fig. 9 As shown, the expression of M1 marker factors in BMDM of mice in the WT-DSS group was significantly increased, while the expression of M1 marker factors in the CD85-CKO-DSS group was very low, proving that the absence of CD84 in macrophages can significantly inhibit the transformation of macrophages to M1 in the IBD model.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of CD84 as a therapeutic target in the development, screening or preparation of drugs for the prevention and / or treatment of inflammatory bowel disease.

2. The use according to claim 1, characterized in that: The inflammatory bowel diseases include Crohn's disease and ulcerative colitis.

3. The application according to claim 1, characterized in that: The CD84 includes CD84 of macrophages.

4. The use according to claim 1, characterized in that: The medicament includes an agent that inhibits the biological function of CD84.

5. The use according to claim 1, characterized in that: The drug is a drug that inhibits the polarization of macrophages to M1 macrophages.

6. The use according to claim 5, characterized in that: The M1 macrophages induce intestinal epithelial damage.

7. The use according to claim 1, characterized in that: The medicine is a medicine for alleviating the severity of enteritis, alleviating colorectal lesions and reducing the level of inflammatory factors.

8. The use according to claim 7, characterized in that: The relief of colorectal lesions includes restoration of colorectal length.

9. The use according to claim 7, characterized in that: The inflammatory factors include at least one of the following: TNF-α, IL-1β and IL-6.

10. Use of CD84 gene or protein as a marker in the preparation of reagents or kits for diagnosing inflammatory bowel disease.

Images