Single molecule gene sequencing method based on mosfet devices

By improving the combination of MOSFET devices with a single polymerase protein, high-precision single-base recognition and low-cost gene sequencing were achieved, solving the problems of difficult single-base rate control and high sequencing costs in existing technologies. This technology is suitable for real-time single-molecule sequencing in the field of precision medicine.

CN119859575BActive Publication Date: 2025-10-21PEKING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411785992.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-06
Publication Date
2025-10-21
Estimated Expiration
2044-12-06

AI Technical Summary

Technical Problem

Existing third-generation single-molecule electrical sequencing methods suffer from difficulties in controlling the rate of single-base sequencing and high error rates. Furthermore, second-generation sequencing technologies are costly, making it difficult to achieve high-throughput, low-cost gene sequencing.

Method used

Using MOSFET devices as electrical detection elements, a single polymerase protein, KlenowFragment, is connected via the confinement effect. The charge fluctuations of KlenowFragment in the MOSFET gate region are used to detect the single-base polymerization behavior of the DNA template strand. The characteristics of different deoxynucleotide single bases are distinguished by modified deoxynucleotide substrate molecules. The results are then analyzed by combining the expression of the cancer suppressor gene NPM-415.

Benefits of technology

It achieves high-precision single-base identification, reduces sequencing costs, and increases sequencing throughput and read length. It is suitable for real-time single-molecule electrical sequencing in the field of precision medicine and has broad application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119859575B_ABST
    Figure CN119859575B_ABST
Patent Text Reader

Abstract

The application provides a MOSFET device-based single-molecule gene sequencing method, and belongs to the technical field of single-molecule gene sequencing. The MOSFET device is coated with chromium and gold successively on the gate and source-drain regions, a PMMA coating layer is coated on the gate, a hole capable of accommodating a single polymerase is developed through high-precision electron beam exposure and development, a PDMS microchannel is attached around the gate to form a micro reaction chamber, a negatively charged polymerase is driven into the PMMA hole with high potential by using a negative pressure circulation scanning method, a gold-sulfur bond is formed between the polymerase and gold atoms on the bottom gate, and the single polymerase is modified on the gate. The application further upgrades and improves a product-level MOSFET device, forms a single-polymerase chain reaction as a sequence information feedback source, realizes high-precision reading of sequences by using intrinsic physiological functions of biomolecules, and constructs an effective signal analysis method to improve information reading efficiency, and improve the accuracy and efficiency of single-molecule sequencing technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of single-molecule gene sequencing, and in particular relates to a single-molecule gene sequencing method based on MOSFET devices. Background Art

[0002] Currently, single-molecule electrical sequencing offers high throughput, label-free, and real-time capabilities, and holds great potential for application in next-generation gene sequencing. However, the recently developed third-generation single-molecule electrical sequencing method, which utilizes nanopore detection as its primary approach and is integrated into arrayed sequencing chips (MinION platforms), significantly increases sequencing throughput and read length. However, this method suffers from drawbacks such as difficulty controlling the rate of single-base sequencing and a high error rate. Therefore, the development of innovative, highly accurate, and single-base-aware single-molecule electrical sequencing methods remains urgent.

[0003] MOSFET devices have extremely wide application value in the field of biological detection. In the early second-generation sequencing (Ion Torrent of Thermo Fisher), developers used MOSFET to + Ion sensitivity enables the detection of H in DNA polymerase chain single base polymerization + Precisely capturing the release process achieved the goal of single-base sequencing accuracy and successfully applied this technology to the sequencing market. However, the low throughput and bulk PCR amplification characteristics of second-generation sequencing technologies have kept sequencing costs prohibitively high. Therefore, developing a sequencing platform with single-molecule sensitivity, combined with stable and mass-producible MOSFET devices, will significantly increase sequencing throughput and read length, eliminate the need for PCR amplification, further reduce sequencing costs, and achieve the goal of lightweight and low-cost sequencing in the field of genetic sequencing. Summary of the Invention

[0004] The purpose of this invention is to develop a high-precision single-molecule electrical sequencing technology with broad practical value. Using a production-grade MOSFET device as the electrical detection element, the technology connects a single polymerase protein, the Klenow Fragment (KF), through confinement. The surface charge fluctuations caused by the protein's conformational changes during single-base polymerization are projected onto the MOSFET gate region. By real-time detection of the source-drain output current, the technology captures the single-base polymerization behavior of the DNA template strand. Furthermore, the technology introduces modified deoxynucleotide substrate molecules (sulfated deoxynucleotides and dideoxynucleotides) to distinguish the characteristic relaxation times and polymerization continuity of different deoxynucleotide single-base polymerizations, enabling reliable discrimination of the electrical characteristics of four bases. The sequencing accuracy of this technology was validated by combining analysis of the gene NPM-415, which is associated with the expression of a cancer suppressor factor.

[0005] The technical solution adopted in the present invention is:

[0006] The first aspect of the present invention aims to provide a single-molecule gene sequencing biosensor based on a MOSFET device. The gate and source / drain regions of the MOSFET device are successively plated with chromium and gold. After the gate is coated with a PMMA coating, a hole that can only accommodate a single polymerase is developed through high-precision electron beam exposure. A PDMS microchannel is attached around the gate to form a micro-reaction chamber. The negatively charged polymerase is driven into the high-potential PMMA hole using a negative pressure cycle scanning method, forming a gold-sulfur bond with the gold atom of the bottom gate, thereby completing the modification of a single polymerase on the gate.

[0007] Furthermore, the gate center region of the MOSFET device has a gate hole exposed by a pattern of approximately 20 nm, and the polymerase is a negatively charged KF polymerase having an amino acid sequence shown in SEQ ID NO.1.

[0008] Furthermore, the coating is chromium and gold, wherein chromium: 5 nm, gold: 100 nm.

[0009] The second aspect of the present invention provides a method for preparing the above-mentioned single-molecule electrical biosensor based on MOSFET devices, comprising:

[0010] 1. Regional transformation and microfluidic packaging of MOSFET devices

[0011] 1.1) Use template overlay to expose only the gate and source / drain surface areas, and then use wet etching to remove the Al / Al2O3 on the gate and source / drain surfaces of production-grade MOSFET devices;

[0012] 1.2) Subsequently, chromium and gold were deposited on the gate and source / drain regions using thermal evaporation technology, with 5 nm of chromium and 100 nm of gold, and the remaining photoresist was removed with acetone;

[0013] 2. Single-molecule polymerase modification of MOSFET devices

[0014] 2.1) A layer of PMMA is spin-coated and thermally cured on the device surface. A prefabricated window with an aperture of approximately 20 nm is then exposed in the center of the gate using a high-precision electron beam lithography system.

[0015] 2.2) Low-temperature development of the electron-beam exposed device using a 3 / 1 volume ratio of isopropyl alcohol to MIBK to obtain a 20 nm pattern of exposed gate holes.

[0016] 2.3) The custom-made PDMS microfluidic reactor was cleaned with oxygen plasma for 30 seconds to improve the PDMS substrate adhesion. Finally, the PDMS microfluidic channel was bonded to the gate epitaxial region of the device to form a micro-reaction chamber for physiological liquid phase testing.

[0017] 2.4) A 20 μL physiological buffer solution containing DNA polymerase is injected into the microfluidic reaction chamber. A gate probe is immersed in the top of the solution. A negative pressure cycle is used to drive the negatively charged KF polymerase into the bottom of the ~20 nm pore with a high potential.

[0018] 2.5) The subthreshold swing in the scanning transfer curve and the invariance of the curve after cyclic scanning demonstrate the successful connection of the gold-sulfur bond between the thiol group of a single KF polymerase in the pore and the gold atom of the gate.

[0019] Furthermore, in step 1.1) of the above method, the template overlay conditions are: photolithography for 40 s, and development for 15 s; and the wet etching method conditions are: Transene Aluminum Etchant Type A etching solution, and immersion at 50° C. for 45 min.

[0020] Furthermore, in step 2.1 of the above method, the spin coating thermal curing conditions are 180° C. and 2 min.

[0021] Furthermore, in step 2.2) of the above method, low-temperature development is performed at 4°C for 40 seconds.

[0022] Furthermore, in step 2.4) of the above method, the physiological buffer solution containing DNA polymerase includes 200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM TCEP, and has a pH of 7.8.

[0023] The third aspect of the present invention provides the above-mentioned single-molecule gene sequencing method based on MOSFET devices, comprising:

[0024] 1) The reaction chamber is replaced with a physiological buffer solution containing 1 μM template-primer complex and substrate;

[0025] 2) The test process involves applying a +0.1 V gate voltage to the gate region and a +0.1 V voltage to the source and drain regions, turning on the MOSFET constant current region. A lock-in amplifier combined with a current amplifier is used to record the source and drain currents of the device in real time at a sampling frequency of 57.6 kHz.

[0026] Furthermore, in the above method, the substrates include 2.5 μM adenine deoxynucleotide, 2.5 μM thiothymidine deoxynucleotide, 1.25 μM thiocytosine dideoxynucleotide, 1.25 μM thiocytosine deoxynucleotide, 1.25 μM guanine dideoxynucleotide, or 1.25 μM guanine deoxynucleotide; the buffer solution includes 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, and 100 μM DTT; and the pH is 7.8.

[0027] The technical effect achieved by the present invention is that the present invention realizes an electrical single-molecule gene sequencing technology based on MOSFET devices. Through further upgrading and improving product-level MOSFET devices, a sequencing technology with a single polymerase chain reaction as the sequence information feedback source is formed, which utilizes the intrinsic physiological functions of biological molecules to realize high-precision reading of the sequence, and constructs an effective signal analysis method to improve the effectiveness of information reading and improve the accuracy and efficiency of single-molecule sequencing technology. Combined with the biological sample sequence NPM-415, real-time single-molecule electrical sequencing is carried out to achieve the goal of accurate single-base identification, proving the practical value of this technology in the field of precision medicine and providing an important application reference for realizing the broad-spectrum application of MOSFET in the single-molecule sequencing market. This technical solution can also be used for sequencing applications of other functional biological enzymes combined with MOSFET devices, such as other types of DNA polymerases, RNA, DNA degrading enzymes and polypeptide degrading enzymes, etc., which can achieve the universal single-molecule sequencing goals of RNA, DNA and polypeptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Single-molecule polymerase modification process based on MOSFET devices.

[0029] Figure 2 Output curve of the modified MOSFET device (a), transfer curve of the MOSFET device before and after single-molecule polymerase modification (b), blank control electrical test of the MOSFET device before protein modification, and real-time electrical test of the chain polymerization process after single KF polymerase modification (c). DETAILED DESCRIPTION

[0030] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0031] 1. A method for preparing a single-molecule electrical biosensor based on a MOSFET device, comprising:

[0032] (1) Regional transformation and microfluidic packaging of MOSFET devices

[0033] 1) Use template overlay (photolithography for 40 seconds, development for 15 seconds) to expose only the gate and source / drain surface areas. Then, wet etching (Transene Aluminum Etchant Type A, immersion at 50°C for 45 minutes) is used to remove the Al / Al2O3 on the gate and source / drain surfaces of production-grade MOSFET devices.

[0034] 2) Subsequently, chromium and gold (chromium: 5 nm, gold: 100 nm) were deposited on the gate and source / drain regions using thermal evaporation technology, and the remaining photoresist was removed with acetone.

[0035] (II) Single-molecule polymerase modification of MOSFET devices

[0036] 1) A layer of PMMA is spin-coated and thermally cured (180°C, 2 min) on the device surface. A prefabricated window with an aperture of approximately 20 nm is then exposed in the center of the gate using a high-precision electron beam lithography system.

[0037] 2) The device after electron beam exposure was developed at low temperature (4 °C) for 40 s using isopropyl alcohol / MIBK (3 / 1, v / v) to obtain gate holes with a ~20 nm pattern exposure.

[0038] 3) The custom-made PDMS microfluidic reactor was cleaned with oxygen plasma for 30 seconds to improve the PDMS substrate adhesion. Finally, the PDMS microfluidic channel was bonded to the gate epitaxial region of the device to form a micro-reaction chamber for physiological liquid phase testing.

[0039] 4) 20 μL of physiological buffer solution containing DNA polymerase (200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM TCEP, pH 7.8) is injected into the microfluidic reaction chamber. A gate probe at one end is immersed in the top of the solution. Through negative pressure cycling, the negatively charged KF polymerase is driven into the bottom of the ~20 nm pore with a high potential.

[0040] 5) The subthreshold swing in the scanning transfer curve and the invariance of the curve after cyclic scanning can prove the successful connection of the gold-sulfur bond between the thiol group of the single KF polymerase in the hole and the gold atom of the gate ( Figure 1 ).

[0041] 2. A method for electrical real-time sequencing of a single-molecule polymerase-modified MOSFET device, comprising:

[0042] 1) The reaction chamber is replaced with a physiological buffer solution containing the template-primer complex (1 μM) and substrate.

[0043] Substrates include adenine deoxynucleotide: 2.5 μM, thiothymine deoxynucleotide: 2.5 μM, thiocytosine dideoxynucleotide: 1.25 μM, thiocytosine deoxynucleotide: 1.25 μM, guanine dideoxynucleotide: 1.25 μM, or guanine deoxynucleotide: 1.25 μM.

[0044] The buffer solution is 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, and 100 μM DTT. The pH value is 7.8.

[0045] 2) Applying a +0.1 V gate voltage to the gate region and a +0.1 V voltage to the source and drain regions activates the MOSFET's constant current mode. Using a lock-in amplifier (HF2LI) combined with a current amplifier (DL1211), the source and drain currents of the device are recorded in real time at a sampling frequency of 57.6 kHz. The DNA chain polymerization process of the synthetic cell sequence template chain NPM-415 is tested to verify sequencing feasibility.

[0046] 3. DNA Sequencing Example Using Single-Molecule Polymerase-Modified MOSFET Devices

[0047] 1) The enzyme used in the example is a single-sulfhydryl mutant KF polymerase, and the amino acid sequence of the enzyme is as follows (SEQ ID NO.1):

[0048] Protein molecular weight = 614 MW = 69229.9

[0049] Isoelectric point = 6.14

[0050] 001 MVQIPQNPLI LVDGSSYLYR AYHAFPPLTN SAGEPTGAMY GVLNMLRSLI MQYKPTHAAV

[0051] 061 VFDAKGKTFR DELFEHYKSH RPPMPDDLRA QIEPLHAMVK AMGLPLLAVS GVEADDVIGT

[0052] 121 LAREAEKAGR PVLISTGDKD MAQLVTPNIT LINTMTNTIL GPEEVVNKYG VPPELIIDFL

[0053] 181 ALMGDSSDNI PGVPGVGEKT AQALLQGLGG LDTLYAEPEK IAGLSFRGAK TMAAKLEQNK

[0054] 241 EVAYLSYQLA TIKTDVELEL TCEQLEVQQP AAEELLGLFK KYEFKRWTAD VEAGKWLQAK

[0055] 301 GAKPAAKPQE TSVADEAPEV TATVISYDNY VTILDEETLK AWIAKLEKAP VFAFDTETDS

[0056] 361 LDNISANLVG LSFAIEPGVA AYIPVAHDYL DAPDQISRER ALELLKPLLE DEKALKVGQN

[0057] 421 LKYDRGILAN YGIELRGIAF DTMLESYILN SVAGRHDMDS LAERWLKHKT ITFEEIAGKG

[0058] 481 KNQLTFNQIA LEEAGRYAAE DADVTLQLHL KMWPDLQKHK GPLNVFENIE MPLVPVLSRI

[0059] 541 ERNGVKIDPK VLHNHSEELT LRLAELEKKA HEIAGEEFNL SSTKQLQTIL FEKQGIKPLK

[0060] 601 KTPGGAPSTS EEVLEELALD YPLPKVILEY RGLAKLKSTY TDKLPLMINP KTGRVHTSYH

[0061] 661 QAVTATGRLS STDPNLQNIP VRNEEGRRIR QAFIAPEDYV IVSADYSQIE LRIMAHLSRD

[0062] 721 KGLLTAFAEG KDIHRATAAE VFGLPLETVT SEQRRSAKAI NFGLIYGMSA FGLARQLNIP

[0063] 781 RKEAQKYMDL YFERYPGVLQ YMERTRAQAK EQGYVETLDG RRLYLPDIKS SNGARRAAAE

[0064] 841 RAAINAPMQG TAADIIKRAM IAVDAWLQAE QPRVRMIMQV HDELVFEVHK DDVDAVAKQI

[0065] 901 HQLMENCTRL DVPLLVEVGS GENWDQAH

[0066] 2) The specific NPM-415 gene sequence used in the example is as follows:

[0067] Template (SEQ ID NO.2):

[0068] CCAGAGACAAGAAAGACAACTAAAGGAATTCATTTATTACGATTTGATAA

[0069] TTTATTAATAATCATATAACAAGTGTAAAAATACTGACTAATTTCACAAAC

[0070] CTTAATTTAATGTAGACTCATATTTAAAAGAACCTCAGTATAGAAATAGAT

[0071] CTCAATTGAGAGACCACCATCTTACTTTTTATCTACAACTTGATACGTTTC

[0072] TCTGTAAATTAAATAACTACAGATACTTCACAACACCAAGGAATTGGTGT

[0073] AAAGAAAAAAAAAAAAAGGTCCGATAAGTTCTAGAGACCGTCACCTCCTT

[0074] CAGAGAAATTCTTTTATCAAATTTGTTAAACAATTTTTTAAAAGGCAGAAT

[0075] AAAGTAAAGACATTGTCAACTATAGACCGACAGGAAAAATATTACGTCTC

[0076] ACTCTTGAAAGGGATGGCACAAACTATTTACAACAGG

[0077] Primer (SEQ ID NO.3):

[0078] GGTCTCTGTTCTTTCTGTTGATTTCC​

[0079] 3) Performance testing of MOSFET devices after modification

[0080] A blank physiological buffer solution (37 °C, 10 mM Tris, 50 mM NaCl, 10 mMMgCl2, 100 μM DTT, pH 7.8) was injected into the reaction cavity, and the output curve of the device (V DS :0-500 mV、V GS : 20-340mV), proving that the device has good gate responsiveness after modification ( Figure 2 a).

[0081] 4) Blank control experiment of MOSFET devices

[0082] A blank physiological buffer solution (37 °C, 10 mM Tris, 50 mM NaCl, 10 mMMgCl2, 100 μM DTT, pH 7.8) was added to the reaction chamber, and the current signal was recorded in real time ( Figure 2 c) The current value presents a single Gaussian distribution.

[0083] 5) Single-molecule polymerase modification based on MOSFET devices

[0084] Using a high-precision electron beam lithography system, a hole with a diameter of approximately 20 nm was created on the PMMA surface of the gate. A buffer solution containing the polymerase protein (100 nM KF, 37 °C, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, pH 7.8) was injected into the reaction chamber. Using a negative pressure cyclic scanning method, a single polymerase was modified on the gate surface. The MOSFET modified with a single polymerase exhibited a transfer curve with current fluctuations, demonstrating the successful attachment of the polymerase protein ( Figure 2 b).

[0085] 6) Real-time DNA sequencing experiments based on single-molecule polymerase-modified MOSFET devices

[0086] A single polymerase-modified MOSFET device was tested in real time in a physiological buffer solution (37 °C, 1 μM primer-template complex chain, 2.5 μM dATP, 2.5 μM dTTPSα, 1.25 μM ddCTPSα, 1.25 μM dCTPSα, 1.25 μM ddGTP, 1.25μM dGTP, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, pH 7.8). It was observed that after the addition of substrate and template chains, the conductance value of the MOSFET device showed a two-state distribution, proving that the chain polymerization process of the NPM-415 sequence by KF polymerase was successfully captured ( Figure 2 c).

[0087] Through the above embodiments of the present invention, the present invention provides regional transformation and microfluidic packaging of MOSFET devices, as well as single-molecule polymerase modification of MOSFET devices, to obtain a biosensor based on MOSFET devices. Through DNA sequencing examples, the performance of the MOSFET device after transformation was verified, proving that the device has good gate responsiveness after transformation. In real-time testing, real-time single-molecule electrical sequencing was performed in combination with the biological sample sequence NPM-415, achieving the goal of accurate single-base identification, proving the practical value of this technology in the field of precision medicine, and providing an important application reference for realizing the broad-spectrum application of MOSFET in the single-molecule sequencing market. The single-molecule gene sequencing technology based on MOSFET of the present invention can realize real-time single-base sequencing of non-amplified genes. It can further carry out highly integrated, small-sized, portable, high-throughput, low-cost gene sequencing.

[0088] It should be further explained that the above implementation modes are only used to understand the technical solutions of the present invention, and are not used to limit the scope of protection of the present invention. Any obvious changes and adjustments made to the technical solutions of the present invention that belong to the technical concept of the present invention should also fall within the scope of protection of the present invention.

Claims

1. Single-molecule gene sequencing biosensor based on MOSFET device, characterized by: The gate and source / drain regions of the MOSFET device are successively coated with chromium and gold. After the gate is coated with PMMA, high-precision electron beam exposure is used to develop a hole that can only accommodate a single polymerase. The PDMS microchannel is fitted around the gate to form a micro reaction chamber. The negatively charged polymerase is driven into the high-potential PMMA hole using a negative pressure cycle scanning method, forming a gold-sulfur bond with the gold atom at the bottom gate, completing the modification of a single polymerase on the gate.

2. The single-molecule gene sequencing biosensor based on a MOSFET device according to claim 1, characterized in that: The central area of ​​the gate has a gate hole with a 20 nm pattern exposure. The polymerase is a negatively charged KF polymerase having an amino acid sequence shown in SEQ ID NO.

1.

3. The single-molecule gene sequencing biosensor based on a MOSFET device according to claim 1, characterized in that: The coating is chromium and gold, with chromium: 5 nm and gold: 100 nm.

4. The method for preparing a single-molecule gene sequencing biosensor based on a MOSFET device according to any one of claims 1 to 3, characterized in that: include:

1. Regional transformation and microfluidic packaging of MOSFET devices 1.1) Use template overlay to expose only the gate and source / drain surface areas, and then use wet etching to remove the Al / Al2O3 on the gate and source / drain surfaces of production-grade MOSFET devices; 1.2) Subsequently, chromium and gold were deposited on the gate and source / drain regions using thermal evaporation technology, with chromium 5 nm and gold 100 nm, and the remaining photoresist was removed with acetone; 2. Single-molecule polymerase modification of MOSFET devices 2.1) A layer of PMMA was spin-coated and thermally cured on the device surface. A 20 nm aperture prefabricated window was then exposed in the center of the gate using a high-precision electron beam lithography system. 2.2) Low-temperature development of the electron-beam exposed device using a 3 / 1 volume ratio of isopropyl alcohol to MIBK to obtain a 20 nm pattern of exposed gate holes. 2.3) The custom-made PDMS microfluidic reactor was cleaned with oxygen plasma for 30 seconds to improve the PDMS substrate adhesion. Finally, the PDMS microfluidic channel was bonded to the gate epitaxial region of the device to form a micro-reaction chamber for physiological liquid phase testing. 2.4) 20 μL of physiological buffer solution containing DNA polymerase is injected into the microfluidic reaction chamber. A gate probe is immersed in the upper part of the solution. A negative pressure cycle is used to drive the negatively charged KF polymerase into the bottom of the 20 nm pore with a high potential. 2.5) The successful connection of the gold-sulfur bond between the thiol group of a single KF polymerase in the pore and the gold atom of the gate is demonstrated by the subthreshold fluctuation in the scanning transfer curve and the invariance of the curve after cyclic scanning.

5. The preparation method according to claim 4, characterized in that: In step 1.1), the template overlay conditions are: photolithography for 40 seconds and development for 15 seconds; the wet etching method conditions are: Transene Aluminum Etchant Type A etching solution, immersion at 50°C for 45 minutes.

6. The preparation method according to claim 4, characterized in that: In step 2.1), the spin coating thermal curing conditions are 180°C and 2 min.

7. The preparation method according to claim 4, characterized in that: In step 2.2), low-temperature development is performed at 4°C for 40 seconds.

8. The preparation method according to claim 4, characterized in that: In step 2.4), the physiological buffer solution containing DNA polymerase includes 200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, and 100 μM TCEP, with a pH of 7.

8.

9. A single-molecule gene sequencing method, characterized in that: The single-molecule gene sequencing biosensor based on a MOSFET device according to any one of claims 1 to 3 is realized, comprising: 1) The reaction chamber is replaced with a physiological buffer solution containing 1 μM template-primer complex and substrate; 2) The test process involves applying a +0.1 V gate voltage to the gate region and a +0.1 V voltage to the source and drain regions, turning on the MOSFET constant current region. A lock-in amplifier combined with a current amplifier is used to record the source and drain currents of the device in real time at a sampling frequency of 57.6 kHz.

10. The single-molecule gene sequencing method according to claim 9, wherein: Substrates included adenine deoxynucleotide: 2.5 μM, thiothymine deoxynucleotide: 2.5 μM, thiocytosine dideoxynucleotide: 1.25 μM, thiocytosine deoxynucleotide: 1.25 μM, guanine dideoxynucleotide: 1.25 μM, or guanine deoxynucleotide: 1.25 μM; The buffer solution consisted of 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, and had a pH of 7.8.

Citation Information

Patent Citations

  • Single-molecule photoelectric detection device with single-photon sensitivity and preparation method of single-molecule photoelectric detection device

    CN116583122A

  • Integrated single-molecule gene sequencing technology based on MOSFET (Metal-Oxide-Semiconductor Field Effect Transistor) device

    CN116926177A