Alternaria algida HZNK494 and application thereof

Abstract

The invention discloses an alpine stellate microzymes HZNK494 and an application of the alpine stellate microzymes HZNK494. The saccharomyces cerevisiae HZNK494 is named as the saccharomyces cerevisiae HZNK494, and is preserved in the general microbiological culture collection center of the China Committee for Culture Collection of Microorganisms on November 8, 2023, the preservation address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.28902. The saccharomyces cerevisiae HZNK494 is named as saccharomyces cerevisiae HZNK494. The bacterial strain is obtained by screening and identifying blueberry fruits for the first time, and after the bacterial strain is applied to a fermentation process of special berries such as blueberries, raspberries, mulberries and strawberries and a single raw material or a composite raw material of medicinal and edible resources for biological deacidification, the bacterial strain is found to be capable of effectively reducing the acidity of the fruit wine; moreover, foreign impurities which are brought by other deacidification processes and influence the quality of the fruit wine are not introduced, and the high-quality functional fruit wine which is harmonious in fragrance, taste and mouth feel can be produced.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a saitano-shaped yeast HZNK494 and an application thereof. Background Art

[0002] my country has a large cultivation area for blueberries, raspberries, mulberries, strawberries and other special berries and medicinal and edible resources, with high yields and abundant resources. After fresh sales, there are still a large number of surplus fruits that need to be processed and value-added. Blueberries, raspberries and mulberries have common characteristics such as high sugar content, rich organic acids and high anthocyanin content, which are very suitable for fermentation and processing into functional fruit wines. However, due to their own high organic acid content, the processed products are often sour, with an uncoordinated taste and poor quality.

[0003] Harmonious acidity is the key to the quality of fruit wine. The right amount of organic acid can give the fruit wine a mellow and refreshing feeling, inhibit the growth and reproduction of some harmful microorganisms, and balance the bitterness of the fruit wine itself; but too much organic acid will make the wine sour and astringent, rough and hard, and the body of the wine is not harmonious, which directly affects the taste and quality of the fruit wine. Therefore, it is necessary to reduce the acidity of fruit wine brewed from blueberries, raspberries, mulberries, etc.

[0004] As we all know, the acidity of fruit wine products comes from the excessive organic acids in the raw materials themselves on the one hand, and from the organic acids produced by metabolism during the fermentation process on the other hand. At present, the main methods of reducing acidity are as follows: (1) adding alkali to neutralize the raw materials before fermentation or adding alkali to neutralize the products after fermentation to deacidify. This method seriously affects the taste of the terminal fruit wine products; (2) shortening the fermentation time. Although this method can reduce some of the acidity, the sugar content of the raw materials is not fully utilized, resulting in excessive sugar, low alcohol, insufficient flavor substances, poor taste, and is not suitable for dry red series fruit wines; (3) after fermentation, the product is deacidified by bentonite clarification and adsorption. This method will also adsorb and remove a large amount of functional substances such as anthocyanins and phenols during deacidification, which not only affects the taste but also causes a large loss of nutritional functional substances; (4) low-temperature deacidification of wine. This method requires a large number of storage tanks with refrigeration functions, which has high refrigeration and insulation costs, long deacidification time (generally more than 1 year), and the deacidification effect is not obvious.

[0005] Therefore, developing more practical and effective deacidification methods has become a key technical link in the production process of specialty fruit wines such as blueberry, raspberry, mulberry and strawberry. Summary of the invention

[0006] The invention aims to provide a Saito saturn yeast HZNK494 and its application, so as to provide a new way to deacidify fruit wine.

[0007] To achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0008] A Saturnis poradiversa HZNK494, named Saturnis poradiversa HZNK494, was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28902.

[0009] The Saito saturn yeast HZNK494 was screened and identified from blueberry fruit for the first time in the present invention. After applying the strain to the fermentation process of single raw materials or composite raw materials such as blueberry, raspberry, mulberry, strawberry for biological deacidification, it was found that the strain can not only effectively reduce the acidity of fruit wine, but also will not introduce foreign impurities that affect the quality of fruit wine brought by other deacidification processes, and can produce high-quality functional fruit wine with harmonious aroma, flavor and mouthfeel.

[0010] Therefore, the present invention also provides the use of the above-mentioned Saturnella saccharomyces cerevisiae HZNK494 in fruit wine fermentation.

[0011] Preferably, the fruit raw material of the fruit wine includes at least one of blueberry, raspberry, mulberry and strawberry.

[0012] The present invention also provides a fruit wine, which is obtained by fermenting a fermentation strain containing at least the above-mentioned Saturnella saccharomyces cerevisiae.

[0013] The present invention also provides a fruit wine acid reduction fermentation process, the acid reduction fermentation process comprising the following steps:

[0014] (1) preparing the above-mentioned Saito Saturn yeast HZNK494 into a seed suspension;

[0015] (2) crushing the fruit raw materials to obtain initial fruit pulp;

[0016] (3) adjusting the sugar content of the initial fruit syrup to 20%-24% to obtain a sugar-adjusted syrup;

[0017] (4) inoculating the seed fungus suspension together with traditional brewing yeast into the fruit syrup for fermentation to obtain the fruit wine.

[0018] Preferably, in step (1), the concentration of the seed fungus suspension is 10 6 -10 9 CFU / mL.

[0019] Preferably, in step (4), the inoculation amount of the seed bacteria suspension is 3%-5% of the weight of the sugar syrup.

[0020] Preferably, in step (4), the fermentation is carried out at 25-30° C. for 20-25 days.

[0021] Compared with the prior art, the technical effects of the present invention are embodied in:

[0022] The present invention screened and identified for the first time a Saito saturn yeast HZNK494 with the function of degrading organic acids from blueberry fruits. After applying the strain to the fermentation process of single raw materials or composite raw materials such as blueberry, raspberry, mulberry, strawberry, etc., it was found that the strain could not only effectively reduce the acidity of the fruit wine, but also would not introduce foreign impurities that affect the quality of the fruit wine brought by other deacidification processes, and could produce high-quality functional fruit wine with coordinated aroma, flavor and mouthfeel. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The colony characteristics of the Saito star yeast HZNK494 strain of the present invention on the YPD agar medium;

[0024] Figure 2 The bacterial characteristics of the Saito Saturn yeast strain HZNK494 of the present invention under a microscope;

[0025] Figure 3 is the ITS rRNA phylogenetic tree of the Saturnella saitoensis HZNK494 strain of the present invention;

[0026] Figure 4 The color difference comparison analysis results of blueberry wines fermented with different strains;

[0027] Figure 5 The GC-IMS difference spectra of volatile organic compounds in different blueberry wine samples;

[0028] Figure 6 The fingerprints of volatile organic compounds in different blueberry wine samples;

[0029] The volatile organic compounds from left to right in the figure are annotated as follows: 2-Ethyl-1-hexanol: 2-ethyl-1-hexanol, 1-Heptanol: 1-heptanol, (Z)-3-Hexenol: (Z)-3-hexenol, 1-Hexanol: 1-hexanol, cis-2-Penten-1-ol: cis-2-penten-1-ol, 1-Penten-3-ol: 1-penten-3-ol, 1-Pentanol: 1-pentanol, 1-Butanol: 1-butanol, 2-Propenal: 2-propylene Aldehyde, Nonanal: Nonanal, Heptanal: Heptanal, Heptanone: 2-Heptanone, 3-Heptanone: 3-Heptanone, 2-Pentanone: 2-Pentanone, 2-Butanone: 2-Butanone, Acetone: Acetone, (E)-2-Heptenal: (E)-2-Heptenal, (E)-2-Pentenal: (E)-2-Pentenal, Hexanal: Hexanal, Acetal: Acetal, Acetaldehyde: Acetaldehyde, cis-3-Hexenyl acetate: cis-3-hexenyl acetate, Isobutylisobutyrate: isobutyl isobutyrate, Pentyl acetate: Pentyl acetate, Isopropyl butyrate: isopropyl butyrate, Methyl butyrate: methyl butyrate, beta-Pinene: Pinene, Benzene: Benzene, Allyl propyl sulfide: Allyl sulfide, Dimethyl sulfide: Dimethyl sulfide, Linalool oxide: Linalool oxide, Acetoin: Acetoin, 4-Methyl-2-pentanone: 4-methyl-2-pentanone, Butyl hexanoate: Butyl hexanoate, Isoamylacetate: Isoamyl acetate, Isobutyl acetate: Isobutyl acetate, Methyl hexanoate: methyl hexanoate, 3-Methyl-1-butanol: 3-methyl-1-butanol, 2-Methyl-1-propanol: 2-methyl-1-propanol, 1-Propanol: 1-propanol, Methanol: methanol, 2-Methylpropanal: 2-methylpropanal, 3-Methylbutanal: 3-methylbutanal, 2-Propanol: 2-propanol, Propanal: propanal, Butanoic acid: butanoic acid, Phenylacetaldehyde: phenylacetaldehyde, 3-Methyl-2-butenal: 3-methyl-2-butenal, Ethyl isobutyrate: ethyl isobutyrate,Ethylhexanoate: ethyl hexanoate, Acetic acid: acetic acid, Methyl 2-methylbutanoate: methyl 2-methylbutanoate, Ethyl propanoate: ethyl propanoate, Linalool: linalool, (E)-2-Hexenal: (E)-2-hexenal, Ethyloctanoate: ethyl octanoate, Hexyl acetate: hexyl acetate, Ethyl2-methylbutanoate: ethyl 2-methylbutanoate, Ethyl 3-methylbutanoate: ethyl 3-methylbutanoate, Methyl 3-methylbutanoate: methyl 3-methylbutanoate, Propyl acetate: propyl acetate, Ethyl butanoate: ethyl butanoate, Ethyl lactate: ethyl lactate, Ethyl acetate: ethyl acetate, Cyclopentanone: cyclopentanone, Ethanol: ethanol, 2-Methyl-3-heptanone: 2-methyl-3-heptanone;

[0030] Figure 7 This is the PCA score diagram of volatile organic compounds in different blueberry wine samples. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0032] Example 1 Screening and identification of bacterial strains

[0033] The present embodiment is a Saturn-shaped yeast (Saturnispora diversa) HZNK494, which has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 8, 2023, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28902.

[0034] This strain was screened from rabbiteye blueberries collected from the planting base of Hangzhou Gaofeng Blueberry Planting Co., Ltd. in Tonglu County, Zhejiang Province in June 2022. The screening process is as follows:

[0035] (1) Separation

[0036] The blueberries were crushed and added to a sterile 500 mL triangular flask. The mixture was naturally fermented in a shaking incubator at 28 °C for 7 days. 10 mL of the sample was taken every day and diluted 10 times with sterile saline. -3 , 10 -4 , 10 -5Three appropriate dilutions were spread on Red Bengal isolation medium (RBA agar) so that the colonies on the plate could be separated from each other, and cultured at 28°C for 2-3 days to select typical colonies with yeast characteristics.

[0037] The formula of Red Bengal isolation medium (RBA) (g / L) is as follows: 5.0% peptone, 10.0% glucose, 1.0% potassium dihydrogen phosphate, 0.5% magnesium sulfate (anhydrous), 0.033% red Bengal, 0.1% chloramphenicol, and 20.0% agar. Preparation method of Red Bengal medium (RBA agar): weigh 36.6g of medium powder in 1L distilled water, heat and boil until completely dissolved, sterilize at 121℃ for 15min, cool to about 50℃, and set aside.

[0038] (2) Purification

[0039] Typical colonies were streaked on yeast extract peptone glucose medium (YPD agar) and cultured at 28°C for 2 days for isolation and purification; typical colonies were picked on YPD agar, streaked on YPD agar again, and cultured at 28°C for 2 days for secondary purification; this method was used for co-purification and culture for 5 times to obtain a purified strain.

[0040] The formula of yeast extract peptone glucose medium (YPD agar) (g / L): peptone 10.0, glucose 20.0, yeast extract powder 14.0, agar 14.0. Preparation method: weigh 50.0g in 1L distilled water, heat and boil until completely dissolved, sterilize at 121℃ for 20min, cool to about 50℃, and set aside.

[0041] (3) Acid reduction performance screening

[0042] Different colonies were selected from the above purified strains and inoculated into YPD liquid medium containing citric acid at a mass concentration of 12 g / L, respectively. The culture was carried out in an oscillating incubator at 28°C and 150 r / min for 72 h. The total acid content of organic acids was determined every 24 h by acid-base titration according to GB12456-2021. The average value was taken after 3 repetitions. The strains with acid reduction effect were screened by acid reduction rate, and a non-brewery yeast strain with good acid reduction effect was obtained, named HZNK494. The acid reduction effect of the strain on citric acid during 72 h fermentation in citric acid YPD liquid medium is shown in Table 1.

[0043] The formula of YPD liquid medium (g / L) is: peptone 20.0, glucose 20.0, yeast extract powder 10.0. Preparation method: weigh 50.0 g in 1 L of distilled water, heat and boil until completely dissolved, and sterilize at 121°C for 20 min for later use.

[0044] Table 1 Effect of HZNK494 strain fermentation process on citric acid reduction

[0045]

[0046] (4) Identification of HZNK494 strain

[0047] 1) Morphological identification

[0048] The HZNK494 strain was cultured on YPD agar at 28°C for 72 h, and the colonies formed by the growth were as follows: Figure 1 As shown in Figure 1, the colonies are round, milky white, smooth on the surface, and with flat edges. Microscopic examination revealed that the HZNK494 strain was spherical or ellipsoidal in shape, with a size of (3.0-4.0)×(3.0-5.0) μm (see Figure 2 ).

[0049] 2) Identification of main physiological and chemical reactions

[0050] The physiological and biochemical reactions of the HZNK494 strain were identified using the VITEK 2Compact fully automatic microbial analysis system of BioMérieux. The results are shown in Table 2.

[0051] Table 2 Identification of the main physiological and biochemical reactions of HZNK494 strain

[0052]

[0053]

[0054] 3) Molecular biological identification

[0055] DNA of HZNK494 strain was extracted, primers were designed for PCR amplification of ITS rRNA gene, and Beijing Biomarker Biotechnology Co., Ltd. was commissioned to perform amplification and sequencing, and the sequence obtained was:

[0056] CCTCTAAATCGTTATGTATATTGAAGCCAATTAAACCTTTAAATTTTTCAAAGGGGTTTCTTGCTTCCCGCACAGAAGAAGAGCCCAGCGAAATGCAAAAATTAATGGATTTGGGGGCCATGGAAAATCGTCGTTTTTTGAACCCCCTCTCCCCCGGGGGGTTTTCCGGG GGGGGGTGTTTGTTGGGGCGTCGTTTCTTTTTTTGGGGGGGGTTAAAAAAAATTTTGTTTAAAATTGACCCCCCCCCCCCCTTCTACCCGGAGGAAAAAATCAATCCCACCCCAAATGGGGGAAGAACCCCCGTTAAATTTAAGCTTTTCAAAAGGGGGAAAAAA (SEQ ID No.1).

[0057] After comparing the above sequences with known sequences in GenBank, the fungal species were determined and classified into genus or species. The specific results are shown in Table 3 and Figure 3 shown.

[0058] Table 3 Identification results of HZNK494 strain

[0059]

[0060] English annotations for the table header: 1. Description: description; 2. Scientific Name: Latin name of the strain; 3. MaxScore: final score of the hit sequence; 4. Total Score: final total score of the hit sequence; 5. Query Cover: percentage of sequences involved in the comparison and scoring in the total length of the entire sequence; 6. E value: the smaller the E value, the smaller the chance of sequence similarity occurring by chance, and the similarity is more likely to reflect the true biological significance; 7. Per.Ident: the similarity between a row of sequence and the compared sequence during sequence comparison; 8. Acc.Len: series length; 9. Accession: in bioinformatics, 'accession number' is a unique identifier assigned to a single DNA or protein sequence in a database to ensure its uniqueness.

[0061] From Table 3 and Figure 3 It can be seen that the HZNK494 strain is Saturnis poradiversa.

[0062] (5) Characteristic performance indicators of HZNK494 strain

[0063] After culture, it was found that the suitable culture temperature of the Saito star yeast HZNK494 of this example was 25-30°C, the tolerance to sulfur dioxide in the liquid culture medium was 350 mg / L, and the tolerance to alcohol in the liquid culture medium (v / v) was 6%.

[0064] (6) Method for preserving HZNK494 strain

[0065] The Saito star yeast HZNK494 was inoculated into the YPD agar test tube slant, cultured at 28°C for 48-72 hours, and then glycerol was added and stored at -80°C or vacuum freeze-dried.

[0066] Example 2 Application of Saturnella saccharomyces cerevisiae HZNK494 in blueberry wine fermentation

[0067] 1. Fermentation process

[0068] The blueberry wine of the present embodiment is prepared by an acid reduction fermentation process comprising the following steps:

[0069] The Saito Saturn yeast HZNK494 was prepared into a seed bacterial suspension;

[0070] Specifically, the Saito star yeast HZNK494 was first streaked on YPD agar and cultured at 28°C for 48 hours for activation; after activation, it was inoculated into YPD liquid medium and cultured at 28°C for 48 hours to prepare a seed suspension. The concentration of the seed suspension was 10 9 CFU / mL;

[0071] (2) crushing the fruit raw materials to obtain initial fruit pulp;

[0072] (3) adjusting the sugar content of the initial fruit syrup to 20% with white sugar to obtain a sugar-adjusted syrup;

[0073] (4) The seed fungus suspension was inoculated into the sugar-adjusted syrup at a weight ratio of 3% together with traditional brewing yeast (special yeast for wine and fruit wine, produced by Angel Yeast Co., Ltd., and the inoculation amount was in accordance with the manufacturer's instructions), and fermented at 25° C. for 20-25 days to obtain the blueberry wine of this embodiment.

[0074] 2. Fruit wine quality analysis

[0075] A single strain of traditional brewing yeast (special yeast for wine and fruit wine, produced by Angel Yeast Co., Ltd.) was used as the fermentation strain, and blueberry wine was prepared using the same fermentation process as above as the control group. The various properties of the two wines were tested and analyzed.

[0076] 1) Wine acidity test

[0077] The test found that the acidity of the fruit wine made by traditional technology was 6.87g / L, while the acidity of the fruit wine fermented by Saito Saturnysaccharomyces HZNK494 was 4.91g / L. It can be seen that the acidity of the fruit wine prepared by Saito Saturnysaccharomyces HZNK494 decreased significantly (p < 0.05), with a decrease rate of 28.53%.

[0078] 2) Alcohol content test of fruit wine

[0079] The test found that the alcohol content of the fruit wine made by traditional technology (hereinafter referred to as the control group fruit wine) was 11.87 degrees, while the alcohol content of the fruit wine obtained by fermentation with Saito Saturn Yeast HZNK494 (hereinafter referred to as the experimental group fruit wine) was 11.80 degrees. There was no significant difference between the two (p>0.05), indicating that fermentation with Saito Saturn Yeast HZNK494 will not affect the final alcohol content of the fruit wine product.

[0080] (3) Color quality test of fruit wine

[0081] The test results are as follows Figure 4 shown.

[0082] Depend on Figure 4 It can be seen that compared with the fruit wine in the control group, the L value, a value and b value of the fruit wine in the experimental group increased to a certain extent (p < 0.05). Although the color difference a value of the fruit wine decreased to a certain extent, there was no significant difference (p > 0.05). This shows that the use of the Saito Saturn yeast HZNK494 strain to prepare fruit wine will not affect the color quality of the dry red characteristics of the fruit wine product.

[0083] (4) Evaluation of volatile flavor substances

[0084] 1) Sample collection

[0085] Gas phase ion mobility spectrometry (GC-IMS) was used to compare and analyze the differences in volatile flavor substances between the experimental group fruit wine and the control group fruit wine. In order to facilitate analysis, the two groups of sample information were first numbered. The sample information table is shown in Table 4.

[0086] Table 4 Sample information table

[0087]

[0088]

[0089] 2) Comparative analysis of volatile component spectra

[0090] After obtaining the spectra of each sample, the spectrum of the blueberry juice sample B0-S before fermentation was used as a reference, and the spectra of other samples were subtracted from the reference to obtain the difference comparison diagram of different samples. The results are as follows: Figure 5 shown.

[0091] If the volatile organic compound content in the target sample and the reference is the same, the subtracted background is white, red represents that the concentration of the compound in the target sample is higher than that in the reference, and blue represents that the concentration of the compound in the target sample is lower than that in the reference. Figure 5 It can be seen intuitively that after fermentation, the volatile organic compounds in blueberry wine increased significantly.

[0092] 3) Fingerprint analysis of volatile organic compounds

[0093] In order to further compare the types and contents of volatile organic compounds in each sample, fingerprint analysis was performed. The results are as follows: Figure 6 shown.

[0094] Depend on Figure 6 It can be seen that the contents of substances such as linalool, E-2-hexenal, ethyl octanoate, hexyl acetate, ethyl 2-methylbutyrate, ethyl 3-methylbutyrate, methyl 3-methylbutyrate, propyl acetate, ethyl butyrate, ethyl lactate, ethyl acetate, methyl acetate, and cyclopentanone are relatively high in sample B2-E; while the contents of substances such as butyric acid, phenylacetaldehyde, 3-methyl-2-butenal, ethyl isobutyrate, and ethyl hexanoate are relatively high in sample B1-E.

[0095] 4) Cluster analysis

[0096] In order to further compare the types of volatile organic compounds in each sample, a cluster analysis of volatile organic compounds was performed. The results are as follows: Figure 7 shown.

[0097] Depend on Figure 7 It can be seen that the total amount of volatile organic substances in the fruit wine fermented with the HZNK494 strain (B2-M, B2-E) and the fruit wine not fermented with the HZNK494 strain (B1-M, B1-E) is not that different; but overall, the volatile organic substances in the fruit wine fermented with the HZNK494 strain are richer than those in the fruit wine not fermented with the HZNK494 strain.

[0098] Example 3 Application of Saturnus saccharomyces cerevisiae HZNK494 in the fermentation of blueberry and raspberry composite fruit wine

[0099] 1. Fermentation process

[0100] The fermentation process of this embodiment is substantially the same as that of embodiment 2, except that the fruit raw material is a mixture of blueberries and raspberries in a mass ratio of 85:15.

[0101] The obtained blueberry-raspberry compound fruit wine experimental sample was used for subsequent analysis.

[0102] 2. Fruit wine quality analysis

[0103] A single traditional brewing yeast (special yeast for wine and fruit wine, produced by Angel Yeast Co., Ltd.) was used as the fermentation strain, and the same fermentation process as above was adopted to prepare a blueberry and raspberry compound fruit wine reference substance, and the acidity of the two fruit wines was tested and analyzed.

[0104] The results showed that the acidity of the blueberry raspberry compound fruit wine reference was 8.12 g / L, and the acidity of the blueberry raspberry compound fruit wine experimental product was 5.26 g / L. Compared with the blueberry raspberry compound fruit wine reference product, the acidity decreased significantly (p < 0.05), with a decrease rate of 35.22%.

Claims

1. A Saito Saturn yeast HZNK494, characterized in that Named as Saturnispora diversa HZNK494, the strain was deposited in the General Microbiology Center of China Culture Collection Administration on November 8, 2023. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 28902.

2. Use of the Saturnella saccharomyces cerevisiae HZNK494 as claimed in claim 1 in fruit wine fermentation.

3. The use according to claim 2, characterized in that The fruit raw material of the fruit wine includes at least one of blueberry, raspberry, mulberry and strawberry.

4. A fruit wine, characterized in that: The product is prepared by fermentation using a fermentation strain containing at least the Saturnella saccharomyces cerevisiae described in claim 1.

5. A process for reducing acidity and fermentation of fruit wine, characterized in that: The following steps are involved: (1) preparing a seed suspension of the Saturnella saccharomyces cerevisiae HZNK494 described in claim 1; (2) crushing the fruit raw materials to obtain initial fruit pulp; (3) adjusting the sugar content of the initial fruit syrup to 20%-24% to obtain a sugar-adjusted syrup; (4) inoculating the seed fungus suspension together with traditional brewing yeast into the fruit syrup for fermentation to obtain the fruit wine.

6. The acid-reducing fermentation process according to claim 5, characterized in that: In step (1), the concentration of the seed suspension is 10 6 -10 9 CFU / mL.

7. The acid-reducing fermentation process according to claim 5, characterized in that: In step (4), the inoculation amount of the seed bacteria suspension is 3%-5% of the weight of the sugar syrup.

8. The acid-reducing fermentation process according to claim 5, characterized in that: In step (4), fermentation is carried out at 25-30° C. for 20-25 days.

Images