Polypeptide for catalyzing hydroxylation of lignans, coding gene, preparation method and application

Abstract

The invention discloses a polypeptide for catalyzing hydroxylation of lignans, a coding gene, a preparation method and application, and belongs to the technical field of gene engineering and enzyme engineering. The polypeptide for catalyzing hydroxylation of lignans is polypeptide SchCYP719C7, and the amino acid sequence of the polypeptide is selected from (1) an amino acid sequence as shown in SEQ ID No.1; (2) an amino acid sequence which is generated by substituting, deleting and / or adding one or more amino acids to the amino acid sequence as shown in SEQ ID No.1 and has the same catalytic activity as (1); or (3) a truncated body of (1) or (2) having the same catalytic activity as (1). The polypeptide SchCYP719C7 has the effect of catalyzing monohydroxy addition or polyhydroxy addition on a dibenzyl butane type lignan benzene ring, lays a foundation for biological research on synthesis of various lignans in schisandra chinensis, and has great application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and specifically relates to a polypeptide catalyzing the hydroxylation of lignans and a coding gene, a preparation method and an application thereof. Background Art

[0002] Schisandra chinensis ( Schisandra chinensis ) is a woody plant of the genus Schisandra in the family Schisandraceae. Schisandra has a wide range of medicinal values, including anti-liver damage, broad central nervous system inhibitory effects, cardiotonic effects, enhancing the body's defense against nonspecific stimuli, and inhibiting anthrax Bacillus, Staphylococcus aureus, Staphylococcus albus, Salmonella typhi, Vibrio cholerae, etc. Dibenzylbutane-type lignans can be isolated from Schisandra.

[0003] Dibenzylbutane-type lignans are a class of lignans with minimal modification between the 8 and 8' carbons of the phenylpropanoid precursors, and some of these structural lignans show antiviral activity. For example, nordihydroguaiaretic acid (NDGA) exhibits a dose-dependent inhibitory effect on the production and nonstructural protein-1 secretion of dengue virus (DENV); progomisin has platelet-activating factor antagonist activity and inhibits HIV-1IIIB-induced syncytium formation.

[0004] The structural diversity of dibenzylbutane lignans is inseparable from the multiple substitutions on the benzene ring. The substitution form on the benzene ring is hydroxyl substitution, and then it undergoes methylation, acylation, glycosylation, etc. to form a rich structure. Dibenzylbutane lignans are also considered to be the biosynthetic precursors of biphenylcyclooctene lignans. The benzene rings of biphenylcyclooctene lignans often have multiple hydroxyl or methoxy substitutions. Therefore, the enzyme responsible for the hydroxylation of the benzene ring plays a key role in the diverse biosynthesis of lignans.

[0005] The functional enzyme analysis of the hydroxylation step of dibenzylbutane-type lignans promotes the development of their biosynthesis, provides a more convenient path to explore and utilize the potential medicinal molecules of this type of lignans, and lays an important foundation for the subsequent biosynthesis of diverse lignans. Summary of the invention

[0006] In view of the above-mentioned prior art, the present invention provides a polypeptide and encoding gene for catalyzing the hydroxylation of lignans, a preparation method and application, and provides a new polypeptide that can catalyze the hydroxylation of lignans, which can catalyze the monohydroxyl addition or polyhydroxyl addition on the benzyl ring of dibenzylbutane-type lignans, laying a foundation for the synthetic biology research of various lignans in Schisandra chinensis.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is: to provide a polypeptide that catalyzes the hydroxylation of lignans, wherein the polypeptide that catalyzes the hydroxylation of lignans is a polypeptide Sch CYP719C7, whose amino acid sequence is selected from: (1) the amino acid sequence shown in SEQ ID No. 1; (2) an amino acid sequence produced by substitution, deletion and / or addition of one or more amino acids to the amino acid sequence shown in SEQ ID No. 1, and having the same catalytic activity as (1); or (3) A truncated form of (1) or (2) having the same catalytic activity as (1).

[0008] The present invention also discloses a gene encoding a polypeptide that catalyzes the hydroxylation of lignans. Sch The coding gene sequence of CYP719C7 is selected from: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.2, and the encoded polypeptide has the same catalytic activity as the polypeptide encoded by (1); or (3) A truncated form of (1) or (2) having the same catalytic activity as the polypeptide encoded by (1).

[0009] Furthermore, an expression vector containing the above encoding gene.

[0010] Furthermore, a recombinant microorganism or a transgenic cell line containing the above encoding gene.

[0011] Furthermore, the preparation method of the polypeptide that catalyzes the hydroxylation of lignans comprises the following steps: introducing the above coding gene into a receptor cell, expressing and extracting the polypeptide, and obtaining the polypeptide.

[0012] Furthermore, the polypeptide that catalyzes the hydroxylation of lignans is used to catalyze the hydroxylation of dibenzylbutane-type lignans.

[0013] Furthermore, peptide Sch CYP719C7 catalyzes the addition of at least one hydroxyl group to the benzyl ring of dibenzylbutane-type lignans.

[0014] Furthermore, peptide Sch CYP719C7 catalyzes the addition of dihydroguaiaretic acid to one or two hydroxyl groups.

[0015] Furthermore, peptide Sch CYP719C7 is used to prepare Schisandra neolignan B or progomisin.

[0016] The beneficial effects of the present invention are: the polypeptide of the present invention SchCYP719C7 has the function of catalyzing dihydroguaiaretic acid to form nor-schisandra neolignan B and nor-pregomisin, and can hydroxylate dihydroguaiaretic acid of dibenzylbutane lignan to generate products with one or more hydroxyl groups, which is a key modification step in the formation of schisandra chinensis diverse lignans, laying a foundation for synthetic biology research on the diversification of dibenzylbutane lignans in schisandra chinensis, and has great application value. Sch The compound obtained by CYP719C7 is an active ingredient in medicine, or the compound obtained is used as an intermediate for subsequent synthesis reaction to obtain an active ingredient in medicine, a peptide Sch CYP719C7 has positive application prospects in the pharmaceutical industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 To express peptides Sch Recombinant vector map of CYP719C7; Figure 2 For peptide Sch LC-MS spectrum of the enzyme activity catalyzed reaction of CYP719C7 using dihydroguaiaretic acid as substrate; Figure 3 For peptide Sch LC-MS spectrum of the product of the dihydroguaiaretic acid reaction catalyzed by CYP719C7 after methyltransferase-catalyzed reaction; Figure 4 For peptide Sch CYP719C7 catalyzes the reaction of dihydroguaiaretic acid and subsequent methylation. DETAILED DESCRIPTION

[0018] The specific implementation modes of the present invention are described in detail below with reference to the embodiments.

[0019] Example 1 The steps of transcriptome-based screening of Schisandra CYP450 genes are as follows: (1) UPLC was used to detect the differences in the content of dibenzylbutane-type lignans in Schisandra chinensis fruit, mature stems, old leaves and roots.

[0020] (2) Based on the genome of Schisandra chinensis, the members of the Schisandra chinensis CYP450 gene family were identified, and the HMM model of the CYP450 gene family was used to preliminarily screen the key enzyme protein sequences of CYP450 in Schisandra chinensis.

[0021] (3) Based on the transcriptome data of different tissue parts of Schisandra chinensis, differential gene expression was analyzed. Correlation analysis was performed on the metabolome and transcriptome. By calculating the ranking of the Pearson correlation coefficient, genes with high correlation coefficients with dibenzylbutane-type lignans were selected as candidate genes. The key enzyme genes responsible for hydroxyl addition in the biosynthesis pathway of dibenzylbutane-type lignans in Schisandra chinensis were further screened to obtain expressed polypeptides. Sch CYP719C7 gene, polypeptide Sch The amino acid sequence of CYP719C7 is shown in SEQ ID No. 1, encoding a polypeptide Sch The gene sequence of CYP719C7 is shown in SEQ ID No.2.

[0022] Example 2 Expressed peptide Sch Cloning of the CYP719C7 gene 1. Extraction of total RNA from Schisandra chinensis by CTAB-PVP method (1) Take fresh Schisandra chinensis plant material (leaves or fruits) and quickly grind them into powder in liquid nitrogen.

[0023] (2) Use a centrifuge tube to estimate the amount of 100 mg of powder into a pre-cooled 2 mL centrifuge tube, add 800 μL of 65°C preheated CTAB-PVP extraction buffer, and place it on a vortex oscillator for 30 seconds to fully lyse it; The CTAB-PVP extraction buffer contained 100 mM Tris·HCl (pH 8.0), 2% CTAB (w / v), 2% PVP (polyvinyl pyrrolidone, w / v), 25 mM EDTA, 2 M NaCl, and mercaptoethanol was added to a final concentration of 0.2% (v / v) after high-pressure steam sterilization. The solution was prepared with DEPC-treated, autoclaved double distilled water (ddHO). 2 O).

[0024] (3) Place in a 65°C water bath for 30 min, inverting and mixing every 10 min.

[0025] (4) After cooling to room temperature, add 800 μL of chloroform, invert to mix, and centrifuge at 13,000 rpm for 10 min at 4°C.

[0026] (5) Transfer the supernatant obtained by centrifugation to a new 2 mL centrifuge tube, add 800 μL of chloroform, shake to mix evenly, and centrifuge at 13,000 rpm for 10 min at 4 °C.

[0027] (6) Repeat step (5) once.

[0028] (7) Carefully pipette the supernatant obtained by centrifugation into a new 1.5 mL centrifuge tube, add 8 M LiCl solution (1 / 3 of the supernatant volume), and let stand at -20 °C overnight.

[0029] (8) Centrifuge at 13,000 rpm for 10 min at 4°C and discard the supernatant.

[0030] (9) Add 700 μL of 75% (v / v) ethanol (prepared with DEPC water) to wash the precipitate, and then centrifuge at 13,000 rpm for 10 min at 4°C; repeat the washing of the precipitate three times. After the third centrifugation, discard the supernatant and evaporate the remaining ethanol.

[0031] (10) Add 30 μL of sterile water treated with Proteinase K to dissolve the RNA and obtain total RNA. Use a BioPhotometer plus nucleic acid protein analyzer to measure the concentration and quality of the extracted RNA.

[0032] 2. Encoding polypeptide Sch Full-length amplification of the CYP719C7 gene (1) Primer design Using the software SnapGene to encode polypeptides Sch Full-length primers SchCYP719C7-F / R were designed on both sides of the open reading frame (ORF) of the CYP719C7 gene to amplify the gene; The sequence of SchCYP719C7-F is: CTATAGGGCCCGGGATGGAGATTCAATGGGCTGTG (SEQ ID No. 3); The sequence of SchCYP719C7-R is: CTAGACTTCAGGTTGTTCAAGCAGCGCGAGGCTTG (SEQ ID No. 4).

[0033] (2) cDNA synthesis The total RNA of Schisandra chinensis obtained in the above step was used as a template, and the cDNA template chain was obtained by PCR technology using the PrimerScript RT Master Mix reverse transcription system. The reverse transcription system is shown in Table 1, and the reverse transcription program is: 37°C, 15min; 85°C, 15s. The reverse transcription product was stored at -20°C and diluted before use.

[0034] Table 1 Reverse transcription PCR system

[0035] (3) Target gene amplification The Schisandra cDNA obtained in the above step was diluted and used as a template, and SchCYP719C7-F / R was used as a primer for amplification. The amplification system is shown in Table 2, and the amplification program is shown in Table 3. The PCR reaction product was detected by agarose gel electrophoresis and the band of the target size was cut and recovered to obtain the expressed polypeptide. Sch Gene sequence of CYP719C7.

[0036] Table 2 Target gene amplification system

[0037] Table 3 Target gene amplification procedure

[0038] Example 3 Peptides Sch Construction of expression vector of CYP719C7 1. Amplify the expressed peptide with homology arms Sch CYP719C7 gene fragment The peptide was expressed using the primer pair SchCYP719C7-pESC-His-F / R with homology arms Sch The gene fragment of CYP719C7 is amplified, and the amplification system and procedure are as shown in Table 2 and Table 3 in Example 1. The PCR reaction product is detected by agarose gel electrophoresis and the band of the target size is cut and recovered to obtain the target fragment with homology arms; The sequence of SchCYP719C7-pESC-His-F is: CCGTAATACGACTCACTATAGGGCCCGGGATGGAGATTCAATGGGCTG (SEQ ID No. 5); The sequence of SchCYP719C7-pESC-His-R is: ATAGGGACCTAGACTTCAGGTTGTTCAAGCAGCGCGAGGCTTG (SEQ ID No. 6).

[0039] 2. Construction of homologous recombination expression vector (1) Double digestion of vector: vector pESC-His Sal I and XOt I was used for enzyme digestion. The double enzyme digestion system is shown in Table 4. After the double enzyme digestion system was reacted in a 37°C water bath for 30 min, 10× loading buffer was added to the digestion product to terminate the reaction, and then agarose gel electrophoresis was performed and the band of the correct size was selected for gel recovery to obtain the double enzyme digestion vector.

[0040] Table 4 Double enzyme digestion system

[0041] (2) Homologous recombination, transformation and positive verification: The target fragment with homology arms was connected to the double-enzyme-cut vector pESC-His using a homologous recombination kit (ClonExpress Ultra One Step Cloning Kit V2). The system is shown in Table 5.

[0042] Table 5 Homologous recombination ligation system

[0043] After the above components are fully mixed, react at 37°C for 30 minutes, and immediately cool on ice; transform the ligation product into E. coli DH5α competent cells. The specific steps are: take out the E. coli DH5α competent cells stored at -80°C and thaw them on ice, add all the ligation products, gently blow and mix, and place on ice for 30 minutes; heat shock in a 42°C water bath for 45 seconds and then quickly place on ice for 2 minutes, add 500μL of antibiotic-free LB medium and shake and culture in a 37°C incubator for 1 hour, take 200μL of the transformation solution and spread it on LB solid medium (containing 100μg / mL ampicillin), and culture it in a 37°C incubator for 12h~16h.

[0044] Single clones were selected for colony PCR verification. A bright and single target size band was amplified as a positive single clone. The positive clone was sent for sequencing to encode a polypeptide. Sch The gene sequence of CYP719C7 is shown in SEQ ID No. 2. The correct sequenced single clone stock was taken and the SchCYP719C7-pESC-His plasmid was extracted; the plasmid map is shown in Figure 1 As shown, a total of 8086 bp, ori in the figure indicates the starting point of plasmid replication, Figure 1 There are ori, 2µ ori and f1 ori in it; HIS3 represents the histidine synthesis gene; SchCYP719C7 is the inserted gene sequence encoding the polypeptide SchCYP719C7; AmpR is the ampicillin resistance gene; promoter represents the promoter, Figure 1 There are HIS3 promoter, GAL,10 promoter, AmpR promoter; terminator means terminator, there are ADH1 terminator and CYC1 terminator in the figure; MCS is a multiple cloning site, Figure 1 There are MCS1 and MCS2.

[0045] (3) Yeast transformation and positive verification The constructed SchCYP719C7-pESC-His plasmid was transformed into Saccharomyces cerevisiae WAT11 competent cells. The transformation method is as follows: ① Place the carrier DNA in a 95℃ water bath or metal bath for 3 minutes, then quickly place it in an ice bath and let it stand for 3 minutes. Place it in a 95℃ water bath or metal bath for another 3 minutes, then quickly place it in an ice bath and let it stand for more than 3 minutes.

[0046] ②Take 100µL of WAT11 competent cells melted on ice, add about 2µg of pre-cooled recombinant plasmid, 10µL of Carrier DNA, and 500µL of PEG / LiAc in sequence, pipette and hit several times to mix, and place in a 30℃ water bath for 30min (invert 8 times every 15min to mix).

[0047] ③Put it in a 42℃ water bath for 15 min (invert 8 times at 7.5 min to mix well).

[0048] ④ Centrifuge at 5000rpm for 40s, discard the supernatant, and wash with 400µL ddH 2 Resuspend the cells in 5% paraformaldehyde and centrifuge at 5000 rpm for 30 s to discard the supernatant.

[0049] ⑤Use 50 µL ddH 2 Resuspend the cells in 5% CO, spread on plates, and culture at 29°C for about 96 h.

[0050] ⑥ Pick a single clone on the plate and perform positive verification using the alkaline lysis method to obtain the SchCYP719C7-pESC-His-WAT11 positive clone.

[0051] Example 4 Peptides Sch Expression and enzyme activity analysis of CYP719C7 1. Peptide Sch Expression of CYP719C7 (1) Select the positive clone of strain SchCYP719C7-pESC-His-WAT11 and inoculate it into 50 mL His-deficient medium (8 g His minus media plus 1 L H 2 O, sterilized by high temperature and high pressure), and cultured in a shaking incubator at 29°C and 220 rpm for 2 days.

[0052] (2) The cultured bacterial liquid was centrifuged to collect the cells, and the cells were resuspended in 400 mL of YPL medium containing 2% (v / v) galactose, and cultured in a shaking incubator at 29°C and 220 rpm for 16 h to induce the expression of the target protein; the formula of YPL medium is (1 L): 10 g peptide and 10 g yeast extraction, dissolved in water and fixed to 1 L, and sterilized by high temperature and high pressure.

[0053] (3) Harvesting bacteria: Centrifuge the bacterial solution at 5,000 rpm for 5 min and discard the supernatant.

[0054] (4) Washing: Add 40 mL of TEK washing solution to the centrifuge tube to resuspend the cells, place on ice for 5 min, collect the cells by centrifugation at 4,000 × g for 10 min at 4°C, resuspend the cells with 200 mL of TESB solution, and place on ice for 10 min; TEK washing solution (350 mL): Dissolve 2.60925 g of KCl in TE solution and dilute to 350 mL with TE solution, and mix well; TESB solution (1 L): Dissolve 109.3 g of sorbitol in TE solution and dilute to 1 L with TE solution, and mix well; TE solution (1 L) contains 50 mL of 1 M Tris-HCl solution and 3.2 mL of 0.5 M EDTA solution, and dilute with ddH 2 O to 1L, mix well.

[0055] (5) Lysis: Disrupt the bacterial solution using a homogenizer for 6 min and centrifuge at 12,000 × g for 15 min at 4°C to collect the supernatant.

[0056] (6) Sedimentation: Add 40 g PEG4,000 and 3.52 g NaCl to the supernatant and shake to completely dissolve.

[0057] (7) Incubate on ice for 15 min. Centrifuge at 12,000 × g for 15 min at 4°C and discard the supernatant.

[0058] (8) The precipitate is resuspended in 6 mL of TEG solution to obtain the extracted microsomal protein. The TEG solution (50 mL) contains 40 mL of TEG solution and 10 mL of glycerol. The extracted microsomal protein contains polypeptides. Sch The total protein of CYP719C7. Currently, the common method for CYP450 verification is to extract yeast microsomal protein for verification.

[0059] 2. Peptide Sch Verification of CYP719C7 enzyme activity Peptides Sch The in vitro enzyme activity function of CYP719C7 was identified, and a control group was set up. The microsomal protein in the control group was the microsomal protein extracted with an empty vector by the same steps as above, the substrate was dihydroguaiaretic acid, and the enzyme activity reaction system was shown in Table 6.

[0060] Table 6 Enzyme activity reaction system (250µL)

[0061] Note: The dosage of NADPH, FAD, FMN, Glucose 6-phosphate and Substrates indicates the final concentration in the enzyme activity reaction system. The dosage of Microsome 200μL means: take 200μL of the protein solution obtained by resuspending with TEG solution in the above steps for functional verification.

[0062] The above components were mixed and reacted at 29°C overnight. 200 μL of ethyl acetate was added to extract the reaction solution. The supernatant was taken after centrifugation at 12,000 rpm for 5 min. The extraction was repeated once. After evaporating the organic solvent, the solution was redissolved in chromatographic methanol and the enzyme activity reaction was analyzed by LC-MS.

[0063] The results are as follows Figure 2 and Figure 3 As shown, 3 is dihydroguaiaretic acid, 4 is nor-schisandrin B, 5 is nor-pregomisin, 6 is schineolignin B, and 7 is pregomisin. Compared with the negative control, the molecular weight of the product shows that the peptide Sch CYP719C7 can catalyze the monohydroxy addition of dihydroguaiaretic acid to the benzene ring of dibenzylbutane lignans (to obtain the product nor-schizandrin neolignan B) and the dihydroxy addition of dihydroguaiaretic acid (to obtain the product nor-pregomisin). After further methylation by SchOMT02, the product was compared with the standard to confirm that the methylated product was schizandrin neolignan B or pregomisin, which verified Sch The function and location of CYP719C7 in catalyzing the hydroxylation of dibenzylbutane-type lignans, and the reaction process Figure 4 As shown, Figure 4 SchOMT02 is the enzyme reported in the patent "Lignan Oxymethyltransferase and its application" (CN116478949A).

[0064] Peptides Sch Amino acid sequence of CYP719C7: MEIQWAVAAMVVVGAILIRFWRKEKAVEWPVGPSKLPIIGNLHQISKGGELVHVTLAKFAEEYGPMITVWMGGWRPTIVVSNQELAWEVLVTKATDYASRKLPYMSRFVTADWQTLATSDFGPYWQGLRKGVQNAALNPVNISSQTHLQERDVQAMTEALSMEASKNGGVVRPLVQFRRLTMRLVGRICFAFEFNDEKFMDGMDAAVEETIRLTGHARLVDVFAATRFLPGLSLPFKQTYQVQGRIRDLIRPYFSRCKPNSYMHFLLSQKMSEETVIFNIFEMFLLAVDSTSTSISWALAFMICNQDIQEKLYAEIRRITADRSEEERKWVSVEDVTKMQYVHAIVKETMRMKPIAPLAVPHMAINECNLMGTKIPAGTSVIVNIYKVLYDPKVWEEPYRFTPERFMAKQSDGDASARMRAMDRSFLPFGAGRRVCAGMDLAKLHVALTIANLVNAYQWCPMEGQLPDMTEDLTFVLRMKTPLAVGIKPRAA(SEQ ID No.1); Polypeptide-encoding Sch The gene sequence of CYP719C7:

[0065] Although the specific implementation of the present invention is described in detail in conjunction with the embodiments, it should not be understood as limiting the scope of protection of this patent. Within the scope described in the claims, various modifications and variations that can be made by those skilled in the art without creative work still fall within the scope of protection of this patent.

Claims

1. A polypeptide that catalyzes the hydroxylation of lignans, characterized in that: The polypeptide catalyzing the hydroxylation of lignans is a polypeptide Sch CYP719C7, whose amino acid sequence is selected from: (1) the amino acid sequence shown in SEQ ID No. 1; (2) an amino acid sequence produced by substitution, deletion and / or addition of one or more amino acids to the amino acid sequence shown in SEQ ID No. 1, and having the same catalytic activity as (1); or (3) A truncated form of (1) or (2) having the same catalytic activity as (1).

2. The gene encoding the polypeptide that catalyzes the hydroxylation of lignans according to claim 1, characterized in that The polypeptide Sch The coding gene sequence of CYP719C7 is selected from: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) a nucleotide sequence having more than 80% homology with the nucleotide sequence shown in SEQ ID NO.2, and the encoded polypeptide has the same catalytic activity as the polypeptide encoded by (1); or (3) A truncated form of (1) or (2) having the same catalytic activity as the polypeptide encoded by (1).

3. An expression vector containing the coding gene according to claim 2.

4. A recombinant microorganism or transgenic cell line containing the encoding gene according to claim 2.

5. The method for preparing the polypeptide that catalyzes the hydroxylation of lignans according to claim 1, characterized in that: The method comprises the following steps: introducing the coding gene according to claim 2 into a receptor cell, expressing and extracting the polypeptide, and obtaining the product.

6. The use of a polypeptide for catalyzing the hydroxylation of lignans, characterized in that: The polypeptide catalyzing the hydroxylation of lignans is used to catalyze the hydroxylation of dibenzylbutane-type lignans.

7. The use according to claim 6, characterized in that: The polypeptide Sch CYP719C7 catalyzes the addition of at least one hydroxyl group to the benzyl ring of dibenzylbutane-type lignans.

8. The use according to claim 7, characterized in that: The polypeptide Sch CYP719C7 catalyzes the addition of dihydroguaiaretic acid to one or two hydroxyl groups.

9. The use according to claim 8, characterized in that: The polypeptide Sch CYP719C7 is used to prepare Schisandra neolignan B or progomisin.

Images