DNA polymerase nucleic acid aptamer and application thereof

Abstract

The invention provides a DNA polymerase nucleic acid aptamer and application thereof, and belongs to the technical field of biology. According to the present invention, the 8-hydroxydeoxyguanosine modification is performed on one or more guanine of the aptamer, such that the situation that the aptamer is wrongly adopted as the template so as to produce the non-specific amplification can be effectively prevented, and the modification can further improve the confidentiality of the aptamer sequence.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a DNA polymerase nucleic acid aptamer and its application. Background Art

[0002] Hot start technology is to solve the problem of non-specific amplification during PCR or qPCR reactions. The commonly used hot start method is to block the enzyme, such as the antibody blocking method disclosed in CN115806621A, the chemical modification blocking method disclosed in US6183998B1 and CN116286717A, and the nucleic acid aptamer blocking method disclosed in CN109486824A. The aforementioned blocking methods have their own advantages and disadvantages in different application scenarios. For example, the nucleic acid aptamer blocking method is more applicable in application scenarios such as strict background bacteria control and freeze-drying. At this stage, the modification of nucleic acid aptamers is usually Spacer C3 modification at the 3' end of the nucleic acid aptamer. The purpose is to prevent the nucleic acid aptamer from playing the role of a primer in the amplification system and matching the template for amplification. Summary of the invention

[0003] The purpose of the present application is to provide a DNA polymerase nucleic acid aptamer and its application.

[0004] The inventors of the present application have found that in some PCR systems, nucleic acid aptamers will also be used as templates for amplification, resulting in non-target bands, while causing waste of raw materials (such as primers, dNTPs, etc.) in the system, thereby affecting the amplification of the target band. And nucleic acid aptamer sequences are usually relatively simple, without confidentiality measures, and are easily cracked. The present application modifies and transforms nucleic acid aptamers, and while sufficiently ensuring that the blocking effect of nucleic acid aptamers on Taq enzymes remains unchanged, it can also effectively reduce the possibility of nucleic acid aptamers being amplified as templates, thereby improving the extensiveness of nucleic acid aptamer applications, and also improving the confidentiality of nucleic acid aptamer sequences.

[0005] The first aspect of the present application provides a DNA polymerase nucleic acid aptamer, wherein the nucleic acid aptamer is a single-stranded DNA containing 10-200 nucleotides, and one or more guanine sites of the aptamer are modified with 8-hydroxydeoxyguanosine.

[0006] In some embodiments, the aptamer binds to the active site of the DNA polymerase, which is, for example, the 5'-3' polymerase active domain composed of amino acids 424-832 of the Taq DNA polymerase, such as the thumb region, finger region, and palm region in the domain. The thumb region is responsible for maintaining the tight binding of the DNA polymerase to the primer-template complex, further facilitating the extension of the DNA polymerase; the finger region is responsible for binding dNTPs; the palm region is the active region for binding of divalent metal ions, which is responsible for regulating the surrounding chemical environment when the bound dNTPs react with the 3'-OH end of the primer, thereby mediating and catalyzing the reaction.

[0007] In some embodiments, the nucleic acid aptamer can bind to the active site of the DNA polymerase through a non-covalent bond to inhibit the polymerization activity of the DNA polymerase.

[0008] In some embodiments, the nucleotides are deoxyribonucleotides.

[0009] In some embodiments, the 3' end of the nucleic acid aptamer contains a blocking modification, such as a 3' phosphorylation modification or a spacer modification, and the spacer modification includes but is not limited to Spacer C3 modification, Spacer C6 modification, Spacer C9 modification, dSpacer modification and PC-linker modification known in the art.

[0010] In some embodiments, the aptamer comprises 10-200 nucleotides, including 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, and 200 nucleotides within the range.

[0011] In some embodiments, the sequence of the aptamer is SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.14 or SEQ ID NO.15, wherein one or more guanine sites on each aptamer nucleotide sequence are modified with 8-hydroxydeoxyguanosine.

[0012] In some embodiments, the aptamer is SEQ ID NO. 1, wherein one or more guanines at positions 7, 11, 18, 32, 37, 48, 50, 51, 52, 56, 57, 62, 63, 64, 65, 67, and 70 contain 8-hydroxydeoxyguanosine modifications.

[0013] In some embodiments, the aptamer is SEQ ID NO. 2, wherein one or more guanines at positions 7, 21, 26, 29, 35, 37, 38, 41, 42, 43, 47, 49, 50, 54, 56, 60, 64, 68 and 70 are modified with 8-hydroxydeoxyguanosine.

[0014] In some embodiments, the aptamer is SEQ ID NO. 13, wherein one or more of the guanines at positions 10, 21, 22, 23, 25 and 34 contain 8-hydroxydeoxyguanosine modifications.

[0015] In some embodiments, the aptamer is SEQ ID NO. 14, wherein one or more of the guanines at positions 5, 19, 20, 23, 28, 31, 39, 48, 50, 54, 58 and 60 contain 8-hydroxydeoxyguanosine modifications.

[0016] In some embodiments, the aptamer is SEQ ID NO. 15, wherein one or more guanines at positions 7, 19, 22, 24, 25, 30, 37, 42, 47, 52, 57, 58, 60, 64, 67 and 69 contain 8-hydroxydeoxyguanosine modifications.

[0017] The second aspect of the present application provides a DNA polymerase modified with a nucleic acid aptamer, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0018] In some embodiments, the DNA polymerase is, for example, Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, KOD DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, DNA polymerase IV, DNA polymerase V, T7 DNA polymerase, Bst DNA polymerase, Phi29 DNA polymerase, Klenow DNA polymerase and Bsu DNA polymerase, including but not limited to all DNA polymerases known in the art.

[0019] In some embodiments, the nucleic acid aptamer binds to the DNA polymerase through a non-covalent bond to inhibit the polymerization activity of the DNA polymerase at a non-permissive temperature.

[0020] In some embodiments, the nucleic acid aptamer reversibly binds to the DNA polymerase, and the nucleic acid aptamer dissociates from the DNA polymerase when the temperature is higher than 38°C, 39°C, 40°C, 42°C, 45°C, 48°C, 49°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C or 98°C, thereby releasing the inhibition of polymerization activity.

[0021] The third aspect of the present application provides a nucleic acid amplification composition, which comprises the DNA polymerase, buffer substance, dNTPs, metal salt and primer described in the second aspect.

[0022] In some embodiments, the buffer substance is, for example, a buffer salt, including but not limited to Tris and / or HEPES known in the art.

[0023] In some embodiments, the metal salt comprises Mg 2+ Salt, preferably, the metal salt also includes K + Salt, Na + Salt, Mn 2+ Salt, Zn + Salt, Co + Salt and Ca 2+ One or more salts.

[0024] In some embodiments, the primers comprise at least a pair of an upstream primer and a downstream primer.

[0025] In some embodiments, the composition further comprises a fluorescent dye and / or a probe.

[0026] In some embodiments, the amplification composition further comprises a reverse transcriptase, such as MMLV reverse transcriptase or AMV reverse transcriptase.

[0027] The fourth aspect of the present application provides a nucleic acid amplification method, the method comprising the following steps:

[0028] (1) Preparation containing dNTP, Mg 2+ , template, primers and the amplification system of the DNA polymerase described in the second aspect;

[0029] (2) Amplify under appropriate conditions.

[0030] In some embodiments, the amplification system is a PCR amplification system.

[0031] In some embodiments, the amplification system is a qPCR amplification system, and the amplification system further comprises a fluorescent dye and / or a probe.

[0032] In some embodiments, the amplification system further comprises a buffer substance, which is, for example, a buffer salt, including but not limited to Tris and / or HEPES known in the art.

[0033] In some embodiments, the amplification system further comprises K + Salt, Na + Salt, Mn 2+ Salt, Zn + Salt, Co+ Salt and Ca 2+ One or more salts.

[0034] The fifth aspect of the present application provides a nucleic acid amplification kit, which comprises the DNA polymerase described in the second aspect.

[0035] The sixth aspect of the present application provides the use of the DNA polymerase nucleic acid aptamer described in the first aspect in reducing non-specific PCR amplification.

[0036] In some embodiments, the non-specific amplification includes mismatch amplification between template and primer, and mismatch amplification between primers.

[0037] In some embodiments, the non-specific amplification includes amplification using a nucleic acid aptamer as a template.

[0038] The seventh aspect of the present application provides the use of the DNA polymerase nucleic acid aptamer described in the first aspect in improving the confidentiality of the aptamer sequence. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Melting curves of naked Taq, Taq+AP1 and Taq+AP2 for qPCR amplification detection;

[0040] Figure 2 : Gel electrophoresis of qPCR amplification products of naked Taq, Taq+AP1 and Taq+AP2;

[0041] Figure 3 : Blocking rate curves of naked Taq, Taq+AP1 and Taq+AP2 measured at 37℃ and 50℃;

[0042] Figure 4 : Amplification curves of naked Taq, Taq+AP1 and Taq+AP2 detected in system B;

[0043] Figure 5a : The base complementary pairing diagram between the upstream primer and AP2 in system B;

[0044] Figure 5b : Melting curves of qPCR amplification detection with and without Taq enzyme using AP2 as template;

[0045] Figure 6a : Melting curves of qPCR amplification detection using TaqDNA polymerase with AP2 and AP2-8-OXO-dGTP as templates, respectively;

[0046] Figure 6b: Melting curves of qPCR amplification detection using Pfu DNA polymerase with AP2 and AP2-8-OXO-dGTP as templates, respectively;

[0047] Figure 6c : Melting curves of qPCR amplification detection using KOD DNA polymerase with AP2 and AP2-8-OXO-dGTP as templates, respectively;

[0048] Figure 6d : Melting curves of qPCR amplification using Phanta DNA polymerase with AP2 and AP2-8-OXO-dGTP as templates, respectively;

[0049] Figure 6e : Melting curves of qPCR amplification using DNA polymerase I with AP2 and AP2-8-OXO-dGTP as templates, respectively;

[0050] Figure 7 : Melting curves of naked Taq, Taq+AP2 and Taq+AP2-8-OXO-dGTP for qPCR amplification detection;

[0051] Figure 8 : Amplification curves of naked Taq, Taq+AP2 and Taq+AP2-8-OXO-dGTP detected in system B;

[0052] Figure 9a : Melting curves of qPCR amplification detection using aptamer AP2 and aptamer AP2 modified with 8-OXO-dGTP at site 25 as templates;

[0053] Figure 9b : Melting curves of qPCR amplification detection using aptamer AP2 and aptamer AP2 modified with 8-OXO-dGTP at site 33 as templates;

[0054] Fig.9c : Melting curves of qPCR amplification detection using aptamer AP2 and aptamer AP2 modified with 8-OXO-dGTP at site 35 as templates;

[0055] Fig.10a : Melting curve of qPCR amplification detection using 46 bp aptamers (without modification or with 8-OXO-dGTP modification) as templates;

[0056] Fig.10b : Melting curve of qPCR amplification detection using aptamers with a length of 66 bp (without modification or with 8-OXO-dGTP modification) as templates;

[0057] Fig.10c : Melting curve of qPCR amplification detection using 76 bp aptamers (without modification or with 8-OXO-dGTP modification) as templates;

[0058] Fig.11 : Sequence analysis results of single-stranded library construction and sequencing using nucleic acid aptamers AP1 and AP1-8-OXO-dG as templates.

[0059] Specific implementation (embodiment)

[0060] The technical solution of the present application is further explained below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are merely simple examples of the present application and do not represent or limit the scope of protection of the present application. The scope of protection of the present application shall be subject to the claims.

[0061] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0062] Example 1

[0063] The nucleic acid aptamer with significant hot start effect was synthesized and screened. Specifically, the nucleic acid aptamer sequence was obtained as follows:

[0064] Nucleic acid aptamer AP1 (SEQ ID NO.1): 5'-TATCTAGTTTGTCCAATGTATCAATCTACATGCATTGCAACACTAATGCGGGATTGGTCTCGGGGCGTTGCAATCT-Spacer C3

[0065] Nucleic acid aptamer AP2 (SEQ ID NO.2): 5'-ATACCAGCTTATTCAATTCCGTAACGTTGTTGCAGTGGATGGGTTTGCGGACTGAGCAAGATAGTAAGTGCAATCT-Spacer C3

[0066] Taq enzyme (Vazyme#P101) was used to prepare naked Taq (naked 5U / μl), AP1 aptamer-modified Taq enzyme: Taq+AP1 (AP1 blocked 5U / μl), and AP2 aptamer-modified Taq enzyme: Taq+AP2 (AP2 blocked 5U / μl). The aptamer AP1 / AP2 blocked Taq enzyme (Vazyme#P101) according to the molecular number of 1:1. The three groups of enzymes were used for qPCR amplification and melting curve detection under system A. The results are shown in the figure. Figure 1 As shown, the A system is:

[0067] Upstream primer F (SEQ ID NO.3): GTTTCGGTACGCATTCTTTGTG

[0068] Downstream primer R (SEQ ID NO.4): CGGATATGACTGGGACAACCA

[0069] qPCR reaction system:

[0070]

[0071] qPCR reaction procedure:

[0072]

[0073]

[0074] Agarose gel electrophoresis:

[0075] 9 μl of qPCR reaction product plus 1 μl of 10×DNA Loading Buffer (Vazyme#P022) were vortexed and mixed, and electrophoresed on 2% agarose gel for 20 min and developed.

[0076] Result analysis:

[0077] like Figure 1 Melting curve results show that the melting curve peak at Tm = 75°C is the primer dimer peak, and the melting curve peak at Tm = 84°C is the main product peak. The lower the primer dimer peak, the better the degree of enzyme blocking. The naked Taq group has a clear primer dimer peak, the primer dimer peak of the Taq+AP2 group is lower than that of the naked Taq group, and the primer dimer peak of the Taq+AP1 group disappears completely. The results show that the blocking rates of the three enzyme groups are: Taq+AP1>Taq+AP2>naked Taq.

[0078] The qPCR products of the three sets of reagents were subjected to agarose gel electrophoresis. Figure 2 The results showed that the naked Taq group had obvious primer dimer bands and almost no main band, the main bands of the Taq+AP2 group and the Taq+AP1 group became stronger, the dimer band became weaker, and the blocking effect of the Taq+AP1 group was better than that of the Taq+AP2 group.

[0079] Example 2

[0080] In order to further verify the hot start effect of aptamer blocking Taq enzyme, a self-built blocking rate determination model was built:

[0081] Upstream primer (SEQ ID NO. 5) F: GGAGCCAAAAGGGTCATCATCTC;

[0082] Probe (SEQ ID NO.6) P: 5'-6-FAM-CTCTGCTGA / iBHQ1-dT / GCCCCCATGTTCGTC

[0083] Downstream primer (SEQ ID NO.7) R:GACGAACATGGGGGCATCAGCAGAGGGGGCAGAGATGATGACCCTTTTGGCTCC

[0084] The template (5'-3' template) for determining the enzyme blocking rate was prepared in advance through an annealing program (95°C for 2 min, 0.1°C / cooling to 4°C).

[0085] Template preparation system preparation:

[0086]

[0087] The blocking rate determination system was prepared as follows, wherein Taq DNA Polymerase was naked Taq, Taq+AP1 (Taq enzyme modified with AP1 aptamer) and Taq+AP2 (Taq enzyme modified with AP2 aptamer), and the blocking method was the same as in Example 1.

[0088]

[0089]

[0090] Closure rate determination procedure:

[0091] step temperature Standard Procedure Number of cycles annealing 37℃ / 50℃ 20sec 100

[0092] The curve of the probe being cleaved by Taq enzyme is obtained by fluorescence acquisition. Figure 3 The larger the slope of the curve, the lower the blocking rate of the enzyme. The results of the 37℃ assay showed that the slope of the curve of the naked Taq group was significantly higher than that of the Taq+AP1 and Taq+AP2 groups, while at 50℃, there was no significant difference in the slope of the curves among the three groups. The results showed that the enzyme blocked with AP1 and AP2 had a better hot start effect.

[0093] Example 3

[0094] In system B, three polymerases, naked Taq (naked 5U / μl), Taq+AP1 (AP1 blocked 5U / μl), and Taq+AP2 (AP2 blocked 5U / μl), were used for qPCR amplification, where:

[0095] Upstream primer F (SEQ ID NO. 8): TTAGGACCAGGACGCCCC;

[0096] Downstream primer R (SEQ ID NO.9): CGGTGCCAGGTAACAAAT;

[0097] Probe P (SEQ ID NO. 10): CAGGGCCATAGATTTCTCACATCAAGGACC;

[0098] qPCR reaction system:

[0099]

[0100] qPCR reaction procedure:

[0101]

[0102] The amplification curve of the test is as follows Figure 4 The results showed that the amplification effect of the Taq+AP2 (AP2 blocked 5U / μl) group was significantly worse than that of the Taq+AP1 (AP1 blocked 5U / μl) group, and worse than that of the naked Taq (naked 5U / μl) group, showing a phenomenon of sensitivity shift and platform reduction, which was different from the previous Figure 1 The closure effect displayed is inconsistent.

[0103] Example 4

[0104] Further analysis of the B system and AP2 sequences revealed that the upstream primer (F) in this system can complement AP2 at 6 bases, such as Figure 5a As shown in Figure 3, it is speculated that AP2 may be used as a template for amplification in this system. A further melting curve experiment was set up. Only AP2 was added as a template for amplification in system B, and a negative control group without Taq enzyme was set up. The other components and amplification procedures in the reaction system were the same as those in Example 3. The melting curve was detected as shown in Figure 3. Figure 5b The results showed that the melting curve peak Tm value of the negative control group was 55°C, while the experimental group containing AP2 and Taq enzyme had melting curve peaks with Tm values ​​of 65°C and 83°C, which showed that amplification would indeed occur when AP2 was added in this system.

[0105] Example 5

[0106] The 21st position of the nucleic acid aptamer AP2 (5'-ATACCAGCTTATTCAATTCCGTAACGTTGTTGCAGTGGATGGGTTTGCGGACTGAGCAAGATAGTAAGTGCAATCT-Spacer C3) was modified with 8-hydroxydeoxyguanosine (8-OXO-dGTP) to obtain AP2-8-OX-dGTP. AP2 and AP2-8-OXO-dGTP were used as templates, and primer F (SEQID NO.11): TATGGTCGAATAAGTTAAGG was added to detect the change in the Tm value of the melting curve. A negative control group (without Taq enzyme and AP2), a positive control group (with Taq enzyme and AP2), and an experimental group (with Taq enzyme and AP2-8-OXO-dGTP) were set up. If AP2-8-OXO-dGTP has a de-templated effect, the Tm value of the melting curve is the same as that of the negative control. If AP2-8-OXO-dGTP has no de-templated effect, the Tm value of the melting curve is the same as that of the negative control. The other components and amplification procedures in the reaction system are the same as those in Example 1. The melting curve obtained by detection is as follows: Figure 6a As shown, the results showed that the Tm value of the melting curve of the AP2-8-OXO-dGTP group was the same as that of the negative control group, indicating that 8-OXO-dGTP modification significantly inhibited the amplification reaction of the Taq enzyme and achieved a de-templated effect.

[0107] Similarly, the inhibitory effect of 8-OXO-dGTP-modified template on the amplification of four polymerases, Phanta (Vazyme#P502), KOD (TOYOBO#71085), Pfu (Thermo#F530L) and DNA polymerase I (Thermo#18162016), was tested in this system. The results are as follows: Figure 6b , Figure 6c , Figure 6d and Figure 6e As shown, the results showed that 8-OXO-dGTP modification also showed the same trend in Phanta, KOD, Pfu and DNA polymerase I, among which the Tm value of the melting curve of the AP2-8-OXO-dGTP group was the same as that of the negative control group, indicating that 8-OXO-dGTP modification had a significant amplification inhibitory effect on a variety of different polymerases.

[0108] In order to detect the effect of 8-OXO-dGTP modification on AP blocking function, a negative control group of naked Taq (naked enzyme 5U / μl), a positive control group of Taq+AP2 (AP2 blocking 5U / μl), and an experimental group of Taq+AP2-8-OXO-dGTP (AP2-8-OXO-dGTP blocking 5U / μl) were set up. qPCR amplification experiments were performed in system A, and the melting curves were detected. Figure 7The results showed that the negative control group had a primer dimer peak with a Tm of 75°C, while both the experimental group and the positive control group only had a main product peak with a Tm of 84°C, indicating that the 8-OXO-dGTP modification did not affect the blocking function of the nucleic acid aptamer on the Taq enzyme.

[0109] In order to further verify the role of the de-templated effect of 8-OXO-dGTP modification in practical applications, qPCR amplification detection was performed in system B (same as Example 3) in which AP2 amplification reaction occurred, wherein the negative control group 1 was naked Taq (naked enzyme 5 U / μl), the positive control group Taq+AP1 (AP1 blocked 5 U / μl), the negative control group 2 was Taq+AP2 (AP2 blocked 5 U / μl), and the experimental group Taq+AP2-8-OXO-dGTP (AP2-8-OXO-dGTP blocked 5 U / μl), and the amplification curve was obtained as shown in FIG. Figure 8 The results showed that the amplification sensitivity and platform of the Taq+AP2 group were lower than those of the naked Taq group, while the Taq+AP2-8-OXO-dGTP group significantly improved the amplification effect, indicating that 8-OXO-dGTP modification is beneficial to improve the template amplification of AP2 in the B system.

[0110] Example 6

[0111] In order to study the wide application of 8-OXO-dGTP modified aptamers in blocking extension reactions, the aptamer AP2 (ATACCAGCTTATTCAATTGAATTC G GTTGGAC G C G ACGATGTACAGTATCGCTCGCAAAGATAGTAAGTGCAATCT) was modified with 8-OXO-dGTP at sites 25 / 33 / 35 (underlined) and named AP-dG1, AP-dG2 and AP-dG3. Modified and unmodified aptamers AP2 were used as templates for amplification. The negative control group was set as no Taq enzyme + AP2, the positive control group was set as Taq enzyme + AP2, the experimental group was set as Taq enzyme + AP2 modified at different sites, the amplification primer was F (SEQ ID NO.12): TATGGTCGAATAAGTTAACT, the amplification conditions were the same as in Example 4, and the detection melting curves were as follows: Figure 9a , Figure 9b and Fig.9c The results show that for the same aptamer, 8-OXO-dGTP modification at different sites, the melting peak Tm value of the modified group and the no enzyme group (negative control group) is Figure 9a , Figure 9b and Fig.9cThe black vertical line in the middle is consistent with the melting peak Tm value of the unmodified group (positive control) ( Figure 9a , Figure 9b and Fig.9c The gray vertical line in the middle shows significant differences in the positions of the aptamers, indicating that 8-OXO-dGTP modification at different sites on the same aptamer can block the extension reaction.

[0112] Example 7

[0113] In order to study the effect of 8-OXO-dGTP modification on the blocking reaction in aptamers of different lengths, 8-OXO-dGTP modification was performed in three aptamers with lengths of 46 bp, 66 bp and 76 bp, respectively. The specific sequences and modification sites (underlined G) are:

[0114] 46bp (SEQ ID NO.13): TTTTAATACGACTCACTATAGG G AGACACTAATGAACTACTACTAC

[0115] 66bp (SEQ ID NO.14): ACCAGCTTATTCAATTCCGGATGCCCCGAA G CAAAACCGTAACCTCTGAGATAGTAAGTGCAATCT

[0116] 76bp (SEQ ID NO.15): ATACCAGCTTATTCAATTGTTGAGGAACT G CCTATTGCAATGTACAGTATTGCAACGGAGATAGAAGTGCAATCT

[0117] The negative control group was Taq enzyme-free + aptamers of different lengths (unmodified), the positive control group was Taq enzyme + aptamers of different lengths (unmodified), and the experimental group was Taq enzyme + aptamers of different lengths (modified), wherein 46 bp was added with primer F1 (SEQ ID NO.16): AAAATTATGCTGAGTGATATC, 66 bp was added with primer F2 (SEQ ID NO.17): TGGTCGAATAAGTTAAGGCCTA, and 76 bp was added with primer F3 (SEQ ID NO.18): TATGGTCGAATAAGTTAACAACTCC. The amplification conditions were the same as those in Example 4, and the melting curves were detected. The results were as follows: Fig.10a , Fig.10b and Fig.10c The results showed that the non-modified group (positive control) could produce a melting peak with an extended band, and the melting peak Tm value ( Fig.10a , Fig.10b and Fig.10c The black vertical line in the middle) was significantly higher than the melting peak Tm value of the no enzyme group (negative control) ( Fig.10a , Fig.10b and Fig.10c The Tm value of the melting peak of the modified group is consistent with that of the no enzyme group (negative control), which indicates that the modified group can block the extension reaction. This study obtained consistent results on aptamers of different lengths (46bp, 66bp and 76bp), which indicates that 8-OXO-dGTP modification also blocks the extension reaction on ligands of different lengths.

[0118] Example 9

[0119] The following two nucleic acid aptamers AP1 and AP1-8-OXO-dG were used as templates for single-strand library construction, sequencing and analysis. The library construction process was carried out with reference to the Vazyme#ND620 instruction manual, and then its role in improving the confidentiality of nucleic acid aptamer sequences was studied.

[0120] Aptamer-control (without 8-OXO-dG): 5'-TATCTAGTTTGTCCAATGTATCAATCTACATGCATTGCAACACTAATGCGGGATTGGTCTCGGGGCGTTGCAATCT-Spacer C3

[0121] Aptamer-modified (with 8-OXO-dG): 5'-TATCTAGTTTGTCCAATGTATCAATCTACATGCATTGCAACACTAATGC G GGATTGGTCTCGGGGCGTTGCAATCT-Spacer C3 (the underline indicates the 8-OXO-dGTP modification site)

[0122] The results are shown in Table 1 and Fig.11 As shown:

[0123] Table 1 Statistical analysis of nucleic acid aptamer single-strand library construction and sequencing

[0124]

[0125] The results in Table 1 show that 99% of the reads in the aptamer-modified (8-OXO-dG) group were less than 50bp, while the lengths of the sequences on both sides of the modified site were 50bp and 26bp, indicating that the 8-OXO-dG site significantly inhibited the DNA polymerase from amplifying across the site, and the presence of the site protected the integrity of the sequence. In addition, the ratio of the aptamer-modified sequence containing the correct sequence in 71-90bp in both sequencing groups (1.1%) was much lower than that in the control group (58.7%). Fig.11 Through the analysis of sequencing sequences, the results showed that there were a large number of G-T mismatches in the parsing site corresponding to the 8-OXO-dG site in the nucleic acid aptamer-modified (including 8-OXO-dG) group. The key feature of 8-deoxyguanine is that its positive conformation can pair with adenine base, while its reverse conformation can still pair with cytosine. This natural mismatch mechanism further enhances the confidentiality of the nucleic acid aptamer sequence.

Claims

1. A DNA polymerase nucleic acid aptamer, wherein the nucleic acid aptamer is a single-stranded DNA containing 10-200 nucleotides, and one or more guanine sites of the aptamer are modified with 8-hydroxydeoxyguanosine.

2. The nucleic acid aptamer of claim 1, wherein the 3' end of the nucleic acid aptamer contains a blocking modification; preferably, the blocking modification is, for example, a 3' phosphorylation modification or a spacer modification; more preferably, the spacer modification is a Spacer C3 modification, a Spacer C6 modification, a Spacer C9 modification, a dSpacer modification or a PC-linker modification.

3. The nucleic acid aptamer of claim 1, wherein the sequence of the aptamer is SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.13, SEQ ID NO.14 or SEQ ID NO.15, wherein one or more guanine sites on each aptamer nucleotide sequence are modified with 8-hydroxydeoxyguanosine. 4 . A DNA polymerase modified with a nucleic acid aptamer, wherein the nucleic acid aptamer is the nucleic acid aptamer according to any one of claims 1 to 3.

5. The DNA polymerase of claim 4, wherein the DNA polymerase is Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, Vent DNA polymerase, KOD DNA polymerase, DNA polymerase I, DNA polymerase II, DNA polymerase III, DNA polymerase IV, DNA polymerase V, T7 DNA polymerase, Bst DNA polymerase, Phi29 DNA polymerase, Klenow DNA polymerase or Bsu DNA polymerase. The DNA polymerase according to claim 4 , wherein the nucleic acid aptamer dissociates from the DNA polymerase at a temperature higher than 37° C.

7. A nucleic acid amplification composition, comprising the DNA polymerase according to any one of claims 4 to 6, a buffer substance, dNTPs, a metal salt and a primer.

8. The amplification composition of claim 7, further comprising a fluorescent dye and / or a probe; preferably, the amplification composition further comprises a reverse transcriptase.

9. A method for nucleic acid amplification, comprising the following steps: (1) Preparation containing dNTP, Mg 2+ , a template, a primer and an amplification system of the DNA polymerase according to any one of claims 4 to 6; (2) Amplify under appropriate conditions.

10. The method according to claim 9, wherein the amplification system further comprises a buffer substance; preferably, the amplification system further comprises a fluorescent dye and / or a probe; preferably, the amplification system further comprises K + Salt, Na + Salt, Mn 2+ Salt, Zn + Salt, Co + Salt and Ca 2+ One or more salts.

11. A nucleic acid amplification kit, comprising the DNA polymerase according to any one of claims 4 to 6.

12. Use of the DNA polymerase nucleic acid aptamer according to any one of claims 1 to 3 in reducing non-specific PCR amplification.

13. The use according to claim 12, wherein the non-specific amplification includes mismatch amplification between template and primer, mismatch amplification between primers, and amplification using nucleic acid aptamers as templates.

14. Use of the DNA polymerase nucleic acid aptamer according to any one of claims 1 to 3 in improving the confidentiality of aptamer sequences.

Images