Establishment and application of gene editing dual-fluorescent reporting system

Abstract

The invention provides establishment and application of a gene editing dual-fluorescent reporting system, and particularly provides a gene editing dual-fluorescent reporting system, which contains two different luciferase protein sequences, according to the present invention, one luciferase protein sequence is modified so as to be applied to nuclease, gene editor or PE (Prime Editor) editing efficiency detection, according to the signal values of the two different luciferase proteins, the base editing, PE editing or nuclease editing efficiency is obtained through calculation, and the system further has characteristics of simplicity and high sensitivity.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and specifically, the present invention relates to the establishment and application of a gene editing dual luciferase reporter system. Background Art

[0002] The dual fluorescence reporter system is to construct the target gene transcriptional regulatory element into an expression vector with luciferase (Luciferase), and construct a reporter gene plasmid so that this sequence regulates the transcriptional expression of luciferase. The reporter gene plasmid is then transfected into cells, and the cells are lysed after different treatments are given, and the substrate luciferin is added, and luciferase can catalyze the substrate luciferin to emit fluorescence (the strongest wavelength is about 560nm). The high and low fluorescence values ​​detected can judge the influence of different treatment groups on the transcriptional regulatory element. In order to avoid the error caused by the efficiency difference during plasmid transfection of cells, another luciferase is usually transferred as an internal reference. The present invention applies this system to gene editor efficiency detection, using firefly luciferase as an internal reference, and Nanoluc is transformed into an expression cassette containing the editor target sequence.

[0003] Currently, most gene editing detection methods involve PCR amplification of the target sequence and then sequencing to confirm the editing efficiency of the target sequence. The steps are cumbersome, the operation is complicated, and the editing efficiency cannot be confirmed intuitively.

[0004] Therefore, there is an urgent need in this field to develop a gene editing dual fluorescent reporter system that has high editing efficiency, simplicity, and high sensitivity. Summary of the invention

[0005] The purpose of the present invention is to provide a gene editing dual fluorescent reporter system which has high editing efficiency, simplicity and high sensitivity.

[0006] The first aspect of the present invention provides a nucleic acid construct having a structure of Formula I:

[0007] Z1-Z2(I);

[0008] in,

[0009] Z1 is the first expression cassette;

[0010] Z2 is the second expression cassette;

[0011] And Z1 has the structure of Formula Ia, and Z2 has the structure of Formula Ib:

[0012] X1-P2-P1(Ia)

[0013] P3-X2-X3(Ib)

[0014] Wherein P1, P2, X1, P3, X2, and X3 are respectively elements used to constitute the structure;

[0015] P1 is an optional enhancer element;

[0016] P2 is the first promoter;

[0017] X1 is the coding sequence of the first luciferase protein;

[0018] P3 is the second promoter;

[0019] X2 is a coding sequence of a second luciferase protein, wherein the coding sequence upstream or within the coding sequence contains a target sequence, and the target sequence contains a gene editing site;

[0020] X3 is an optional PolyA sequence;

[0021] Furthermore, each "-" is independently a bond or a nucleotide linking sequence.

[0022] In another preferred embodiment, the nucleotide sequence lengths of Z1 and Z2 are independently 120-24000 nt.

[0023] In another preferred embodiment, the amino acid sequence encoded by Z1 is 11-550aa in length.

[0024] In another preferred embodiment, the length of the amino acid sequence encoded by Z2 is 11-550 aa, preferably, 170-181 aa.

[0025] In another preferred embodiment, the length of the nucleotide linker sequence is 1-400 nt, preferably 1-100 nt.

[0026] In another preferred embodiment, the nucleotide linking sequence does not affect the normal transcription and translation of each element.

[0027] In another preferred embodiment, the enhancer element is selected from the following group: CMV, WPRE, αmic / bik enhancer, SV40 enhancer, or a combination thereof.

[0028] In another preferred embodiment, the first promoter and the second promoter are each independently selected from the following group: CMV, CAG, PGK, EF-1α, SFFV, CBh, U6 promoter, SV40 promoter, EFS promoter, MSCV promoter, SV40 promoter, mPGK promoter, hPGK promoter, UBC promoter, miniCMV promoter, or a combination thereof.

[0029] In another preferred example, the first promoter and the second promoter are different.

[0030] In another preferred embodiment, the first promoter is CMV.

[0031] In another preferred embodiment, the second promoter is EF-1α.

[0032] In another preferred embodiment, the first luciferase protein and the second luciferase protein are independently selected from the following group: firefly luciferase (Fluc), Renilla luciferase (Rluc), NanoLuc (Nluc), HiBiT, Gluc, or a combination thereof.

[0033] In another preferred example, the first luciferase protein and the second luciferase protein are different.

[0034] In another preferred embodiment, the first luciferase protein is firefly luciferase (Fluc).

[0035] In another preferred embodiment, the second luciferase protein is NanoLuc (Nluc).

[0036] In another preferred embodiment, a homologous sequence of 20-100 bp (preferably 40-80 bp, more preferably 50-70 bp) is inserted in the middle of the gene encoding the second luciferase protein, and the homologous sequence contains a target sequence in the middle.

[0037] In another preferred embodiment, a target sequence is added upstream of the gene encoding the second luciferase protein, and the target sequence contains a stop codon.

[0038] In another preferred embodiment, the homologous sequence contains one or more stop codons.

[0039] In another preferred embodiment, the stop codon includes a stop codon suitable for gene editing.

[0040] In another preferred embodiment, the stop codon includes: TAG, TAA, TGA.

[0041] In another preferred embodiment, the polyA sequence is selected from the group consisting of bGH polyA, SV40 polyA, hGH polyA, HSVTK poly (A), or a combination thereof.

[0042] In another preferred embodiment, both the first expression cassette and the second expression cassette have terminators.

[0043] In another preferred embodiment, the length of the nucleic acid construct is 2926-10000 bp, preferably 5000-8000 bp, more preferably 6000-8000 bp.

[0044] The second aspect of the present invention provides a vector product, characterized in that the vector product comprises a first vector, wherein the first vector contains the nucleic acid construct described in the first aspect of the present invention;

[0045] A second vector, comprising an expression cassette for expressing a gene editing protein or a base editor or a lead editor (PE); and

[0046] An optional third vector, the third vector contains an expression cassette for expressing a gRNA, wherein the gRNA targeting site enables the second vector to target a target sequence upstream of the gene encoding the second luciferase protein or in the gene encoding the second luciferase protein.

[0047] In another preferred example, the first carrier, the second carrier and the third carrier are different carriers.

[0048] In another preferred embodiment, any two or three of the first carrier, the second carrier, and the third carrier are the same carrier.

[0049] In another preferred example, the vector combination further contains a reference vector.

[0050] In another preferred embodiment, the gene editing protein is selected from the following group: type II CRISPR-Cas polypeptide, type V CRISPR-Cas polypeptide or a combination thereof.

[0051] In another preferred embodiment, the gene editing protein is selected from the following group: Cas9 (e.g., GeoCas9, CjCas9, Cas9-KKH, spCas9, xCas9, SpCas9-NG, SmacCas9, Spy-macCas9), CasX, CasY, Cpfl, C2cl, C2c2, C2c3, Casl2a, Casl2b, Casl2g, Casl2h, Casl2i, Casl3b, Casl3c, Casl3d, Casl4, Csn2, LbCasl2a, AsCasl2a, Argonaute (Ago), or a combination thereof.

[0052] In another preferred embodiment, the base editor is selected from the following group: ABE, CBE, GBE, ACBE, or a combination thereof.

[0053] In another preferred embodiment, the vector is selected from the following group: plasmid, viral vector, or a combination thereof.

[0054] In another preferred embodiment, the viral vector is selected from the following group: a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

[0055] In another preferred embodiment, the construct is integrated into the multiple cloning site of the vector.

[0056] In another preferred embodiment, the vector is circular.

[0057] The third aspect of the present invention provides a genetically engineered cell, wherein the cell is transformed or transfected with the vector product described in the second aspect of the present invention.

[0058] In another preferred embodiment, the genetically engineered cells are prokaryotic cells or eukaryotic cells.

[0059] In another preferred embodiment, the prokaryotic cell includes Escherichia coli.

[0060] In another preferred embodiment, the eukaryotic cells are selected from the group consisting of yeast cells, plant cells, mammalian cells (such as HEK293T cells), human cells, or a combination thereof.

[0061] A fourth aspect of the present invention provides a method for detecting base editing efficiency, comprising the steps of:

[0062] (i) introducing the first vector, the second vector, the third vector and optionally the reference vector; or the vector product described in the second aspect of the present invention into a cell;

[0063] Wherein, the first vector contains the nucleic acid construct described in the first aspect of the present invention; the second vector contains an expression cassette for expressing a gene editing protein or a base editor or a PE; and the third vector contains an expression cassette for expressing a gRNA, and the gRNA targeting site makes the position targeted by the second vector be upstream of the gene encoding the second luciferase protein or a target sequence in the gene encoding the second luciferase protein;

[0064] (ii) detecting the expression amount and / or signal of the first luciferase protein and the second luciferase protein expressed in the cell;

[0065] (iii) judging the base editing efficiency or the nuclease cleavage efficiency according to the expression level and / or signal of the first luciferase protein and the second luciferase protein.

[0066] In another preferred embodiment, the nucleic acid construct in the first vector has the structure of Formula I.

[0067] In another preferred embodiment, in step (iii), the base editing efficiency is calculated according to the following calculation formula:

[0068] Experimental group ratio = experimental group RLU n-luc / Experimental group RLU f-luc ;

[0069] Positive control group ratio = positive control group RLUn-luc / Positive control group RLU f-luc ;

[0070] Editing efficiency of experimental group = ratio of experimental group / ratio of positive control group;

[0071] Among them, the experimental group RLU n-luc Refers to the NLuc expression and / or signal in cells transfected with the experimental vector, RLU in the experimental group f-luc Refers to the FLuc expression and / or signal in cells transfected with the experimental vector, and RLU in the positive control group n-luc Refers to the NLuc expression and / or signal in cells transfected with the positive control vector, RLU of the positive control f-luc Refers to the FLuc expression and / or signal in cells transfected with the positive control vector. The background has been removed from each fluorescence value in each group in the formula;

[0072] The experimental group vectors include the first vector, the second vector and the third vector, and the positive control group vectors include the reference vector.

[0073] In another preferred embodiment, the detection is quantitative detection.

[0074] In another preferred embodiment, the method further comprises step (iv): comparing the expression level Q1 and / or the fluorescence signal S1 of the first luciferase protein and the second luciferase protein with the result of the positive control (group).

[0075] In another preferred embodiment, the cells are from the following species: humans, non-human mammals, poultry, and plants.

[0076] In another preferred embodiment, the non-human mammals include rodents (such as mice, rats, rabbits), cows, pigs, sheep, horses, dogs, cats, and non-human primates (such as monkeys).

[0077] In another preferred embodiment, the cells include: somatic cells, stem cells, germ cells, non-dividing cells, or a combination thereof.

[0078] In another preferred embodiment, the cells include: kidney cells, epithelial cells, endothelial cells, or a combination thereof.

[0079] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1A A map of the base editor's dual fluorescent reporter system vector is shown.

[0081] Figure 1B A map of the dual fluorescent reporter system vector for nucleases is shown.

[0082] Figure 2 The editing efficiency of the base editor in the present invention is shown.

[0083] Figure 3A A map of pACG-luc-sg2-pegRNA during PE editing is shown.

[0084] Figure 3B The editing efficiency of PE editing in the present invention is shown.

[0085] Figure 4 The editing efficiency of nuclease editing in the present invention is shown.

[0086] Figure 5A The results of PCR amplification of target DNA fragments and sequencing analysis of the remaining experimental group lysate replicate well 1 in the dual fluorescence reporter system in Example 2 are shown.

[0087] Figure 5B The results of PCR amplification of target DNA fragments and sequencing analysis of the remaining experimental group lysate replicate well 2 in the dual fluorescent reporter system in Example 2 are shown. DETAILED DESCRIPTION

[0088] After extensive and in-depth research, the inventors unexpectedly discovered a gene editing dual luciferase reporter system for the first time. The system of the present invention contains two different luciferase proteins, one of which is used as an internal reference, and the coding frame of the other luciferase gene sequence is added with a nucleic acid sequence:

[0089] (1) By adding a target sequence upstream of the coding sequence and introducing a stop codon on the target sequence, it can be used to detect the editing efficiency of base editors and lead editors;

[0090] (2) By inserting a homologous sequence into the coding sequence, and inserting the target sequence in the middle of the homologous sequence, it can be used to detect the efficiency of nuclease editing.

[0091] According to the signal values ​​of the above two different luciferase proteins, accurate editing efficiency is calculated, and the system of the present invention has the characteristics of simplicity and high sensitivity. On this basis, the inventors have completed the present invention.

[0092] Terminology

[0093] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0094] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0095] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0096] Constructs of the present invention

[0097] The present invention provides a nucleic acid construct, which contains two different luciferases, and one of the luciferase protein sequences is modified to be applied to CRISPR-Cas gene editing detection, for example, a target sequence and a stop codon are added upstream of a luciferase protein sequence, or a 20-100 bp homologous sequence is inserted in the middle of the coding sequence, preferably 40-80 bp, more preferably 50-70 bp (such as 60 bp), and the middle of the homologous sequence is the target sequence.

[0098] According to the signal values ​​of two different luciferases, the base editing efficiency or the nuclease cleavage efficiency is obtained by calculation. The construct of the present invention is as described in the first aspect of the present invention.

[0099] The various elements used in the construct of the present invention are all known in the art, so those skilled in the art can use conventional methods, such as PCR methods, all-artificial chemical synthesis methods, and enzyme cutting methods to obtain the corresponding elements, and then connect them together through well-known DNA ligation technology to form the construct of the present invention.

[0100] Inserting the construct of the present invention into an exogenous vector constitutes the vector of the present invention.

[0101] Methods for testing gene editing efficiency

[0102] The present invention provides a method for detecting gene editing efficiency, comprising:

[0103] (i) introducing the first vector, the second vector, the third vector and optionally the reference vector; or the vector product described in the second aspect of the present invention into a cell;

[0104] Wherein, the first vector contains the nucleic acid construct described in the first aspect of the present invention; the second vector contains an expression cassette for expressing a gene editing protein, a base editor or a PE; and the third vector contains a third expression cassette for expressing a gRNA, and the gRNA targeting site makes the Cas protein, base editor or PE expressed by the second vector target a target sequence upstream of the gene encoding the second luciferase or in the gene encoding the second luciferase;

[0105] (ii) detecting the expression amount and / or signal of the first luciferase protein and the second luciferase protein expressed in the cell;

[0106] (iii) judging the base editing efficiency according to the expression levels and / or signals of the first luciferase protein and the second luciferase protein.

[0107] The method of the present invention can efficiently detect the gene editing efficiency of multiple editors, and is also simple and highly sensitive.

[0108] The main advantages of the present invention include:

[0109] The present invention discovers for the first time a gene editing dual fluorescence reporter system. The system of the present invention contains two different luciferases. By modifying the luciferase sequence, efficient detection of the editing efficiency of multiple editing systems can be achieved.

[0110] (1) Modifying one of the luciferase protein sequences for use in a gene editor or PE, for example, adding a target sequence and a stop codon upstream of a luciferase protein sequence, and using another luciferase as an internal reference gene. The gene editing efficiency is calculated based on the signal values ​​of the two different luciferase proteins, thereby realizing the detection of the editing efficiency of the base editor or PE.

[0111] (2) A homologous sequence of 20-100 bp, preferably 40-80 bp, more preferably 50-70 bp (e.g., 60 bp) in length is inserted in the middle of a luciferase sequence, a target sequence is arranged in the middle of the homologous sequence, and another luciferase is used as an internal reference gene. The gene editing efficiency is calculated based on the signal values ​​of the two different luciferase proteins.

[0112] The system of the present invention is also simple (no need to lyse the experimental cells) and highly sensitive (can detect editing efficiencies with lower efficiencies).

[0113] The present invention will be further described below in conjunction with specific implementation. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0114] Unless otherwise specified, the reagents and materials used in the examples of the present invention are all commercially available products.

[0115] Example 1 Design and construction of gene editing dual fluorescent reporter system

[0116] Gene editing technology includes many methods, among which base editing technology and Prime editing (PE) technology will mutate the stop codon in the target sequence to a normal expression codon, for example, mutating TAG to CAG, thereby restoring the normal expression of the sequence; nucleases will cut the target sequence to cause double-strand breaks, and the homologous sequences at both ends will recombine to produce a normal nLuc sequence, restoring the expression of Nluc. The editing efficiency of base editors, PE or nucleases can be determined by luminescence readings.

[0117] Based on this, a dual fluorescence reporter system was designed, including the pBE-dual-luc-target reporter plasmid (SEQ ID No. 1) and pdual-luc reference plasmid (SEQ ID No. 2) for base editing technology and PE technology, and the pCas-dual-luc-TTR reporter plasmid (SEQ ID No. 3) for nuclease. When used for base editor efficiency or PE editing efficiency detection, the pBE-dual-luc-target reporter plasmid map information is as follows Figure 1A When used for nuclease cleavage efficiency detection, the pCas-dual-luc-TTR reporter plasmid map information is as shown in Figure 1B shown.

[0118] 1. The construction method of pBE-dual-luc-target reporter plasmid and reference plasmid is as follows:

[0119] (1) Enzymatic digestion to obtain backbone fragments

[0120] The pmEGFP-C1 plasmid (Addgene, Plasmid, #36412) was digested with restriction endonucleases AseI (Thermo, ER0911), NheI (Thermo, FD0974) and XmaI (NEB), including the first, second and third fragment digestion products with sizes of 582 bp, 795 bp and 3353 bp, respectively. The first fragment (582 bp) and the third fragment (3353 bp) digestion products were recovered by gel electrophoresis.

[0121] The specific operations are as follows:

[0122] The pmEGFP-C1 plasmid (Addgene, Plasmid, #36412) was digested with endonuclease Xma1 (NEB) and the digestion product was purified. The digestion reaction system was as follows: 10 μL (about 10 μg) of pmEGFP-C1 plasmid, 5 μL of XmaI (NEB), 5 μL of CutSmart buffer, and 30 μL of sterile water. The reaction was carried out in a 37°C water bath for 30 minutes. The complete digestion was confirmed by agarose gel electrophoresis. The digestion product was purified using a universal DNA purification and recovery kit (Tiangen, DP214) (for specific steps, see the kit manual) and eluted in 35 μL of sterile water to obtain the XmaI digestion product.

[0123] Take 30 μL of the above XmaI digestion product and perform double digestion with AseI (Thermo, ER0911) and NheI (Thermo, FD0974). The digestion reaction system is as follows: 30 μL (~6 μg) of Xma1 digestion product, 3 μL of AseI, 5 μL of FastDigest buffer, and 12 μL of sterile water. Reaction was carried out in a 37°C water bath for 30 min. The digestion products were separated by agarose gel electrophoresis to obtain the first, second, and third fragment digestion products with sizes of 582 bp, 795 bp, and 3353 bp, respectively. The first and third fragment digestion products were purified using a universal DNA purification and recovery kit (Tiangen, DP214) (for specific steps, refer to the kit manual), and frozen at -20°C after the concentration was determined.

[0124] (2) Amplify and obtain F-Luc (i.e., fluc), EF1a promoter, N-Luc (i.e., nluc), and BGH-polyA fragments.

[0125] The CP0003_luc-ZDT plasmid (SEQ ID No. 4) and the G2-EF1a-EGFP-BGH plasmid (SEQ ID No. 5) were constructed and synthesized (by Boshang Biotechnology (Shanghai) Co., Ltd.), and used as templates for PCR amplification. The CP0003_luc-ZDT plasmid contains F-luc and N-luc expression frame elements, and the G2-EF1a-EGFP-BGH plasmid contains EF1a promoter and BGH-polyA element.

[0126] The amplification method is as follows:

[0127]

[0128] The PCR reaction system is as follows: 33 μl sterile water, 5 μl 10×KOD Buffer, 5 μl dNTP, 3 μl MgSO4, 1 μl upstream and downstream primers, 1 μl PCR template (about 10 ng), 1 μl KOD enzyme, vortexed and mixed after preparation, short-speed centrifugation and placed in the PCR instrument. The PCR reaction procedure is as follows: pre-reaction at 98°C for 1 min; thermal denaturation at 98°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s / kb, and 72°C for 10 min after 30 cycles. The PCR product was stored at 12°C, and then the DNA fragments were recovered by gel electrophoresis and amplification of the EF1a promoter, N-Luc, N-Luc' and BGH-polyA fragments.

[0129] (3) PCR splicing the EF1a promoter, N-Luc and BGH-polyA fragments to obtain a first spliced ​​fragment, and PCR splicing the EF1a promoter, N-Luc' and BGH-polyA fragments to obtain a first spliced ​​fragment'; then, the first spliced ​​fragment and the first spliced ​​fragment' are spliced ​​with the first fragment obtained in step (1), the third fragment and the F-Luc sequence obtained in step (2), respectively, and the splicing is performed by Gibson Master Mix Kit (NEB, E2611L) was used according to the instructions of the kit.

[0130] The connection system is as follows:

[0131]

[0132]

[0133] The splicing product was transferred into competent cells DH5a (Weidi Biotechnology, DL1001) and cultured, and then spread on LB agar plates containing 100 μg / ml ampicillin and cultured inverted at 37°C overnight. After selecting a single colony, it was sequenced and verified by Boshang Biotechnology (Shanghai) Co., Ltd. to confirm that the reporter plasmid pBE-dual-luc-target and the reference plasmid pdual-luc (SEQ ID NO.2) had been obtained.

[0134] 2. Construction of the vector plasmid pU6-gRNA-target expressing gRNA

[0135] The pU6-gRNA-target vector plasmid uses pU6-pegRNA-GG-acceptor (Addgene, Plasmid #132777) as the vector backbone, and the gRNA sequence used for efficiency detection is determined according to the targeting sequence. Exemplarily, the targeting sequence can be:

[0136] sgRNA1: GGACTAGGATCCCATGGCTA (SEQ ID No. 16), wherein the sgRNA1 sequence contains a stop codon "TAG", and the stop codon is located within the editing window of the base editor ABE or PE. When the target sequence is edited, the stop codon is mutated into an expressible codon due to editing.

[0137] (1) The pU6-pegRNA-GG-acceptor plasmid was digested with restriction endonuclease Bsa I (NEB) to obtain the fourth fragment (2179 bp) and the fifth fragment (825 bp) digestion products, and then the fourth fragment was recovered by agarose gel electrophoresis.

[0138] The enzyme digestion reaction system is as follows: pU6-pegRNA-GG-acceptor 10μL (about 6μg), Bsa1 5μL, CutSmartbuffer 5μL, sterile water 30μL. Reaction at 37℃ water bath for 30min.

[0139] (2) Exemplarily, sgRNA1 was used as the targeting sequence, lentiCRISPR v2 plasmid (Addgene, Plasmid #52961) was used as the PCR template, luc-sg2-F (SEQ ID No. 17) was used as the upstream primer, and nsgR (SEQ ID No. 18) was used as the downstream primer for PCR amplification to obtain the luc-sg2 fragment (139 bp) with the gRNA sequence. The obtained PCR product was added with Dpn1 enzyme and incubated at 37°C for 30 minutes. The PCR product was then purified and recovered using a universal DNA purification and recovery kit (Tiangen, DP214).

[0140] The primers used are as follows, wherein the underlined sequence in primer luc-sg2-F is the gRNA targeting sequence.

[0141]

[0142] The fourth fragment (2179 bp) obtained in step (1) and the luc-sg2 fragment (139 bp) obtained in step (2) were spliced ​​to construct the pU6-gRNA-target vector plasmid. The splicing was performed using Gibson Master Mix kit (NEB, E2611L), according to the instructions of the kit. The connection system is as follows: 2×Gibson Assembly Mastermix 5μL, the fourth fragment (concentration of 18.2ng / μL) 2.7μL, luc-sg2 fragment 0.4μL, sterile water 1.9μL. After mixing and short-speed centrifugation, react at 50℃ for 30min and store at 4℃. The splicing product was amplified by competent cells DH5a (Weidi Biotechnology, DL1001), and the pU6-gRNA-target vector plasmid was obtained by sequencing.

[0143] (3) When other targeting sequences are used, for example, the targeting sequence is designed to be an Nmer sequence: NNNNNNNNNNNNNNNNNNNN, where N can be A, T, C or G, and the targeting sequence contains a stop codon TAA, TAG or TGA, and the stop codon is located within the editing window of the base editor ABE or CBE. When the target sequence is edited, the stop codon is mutated into an expressible codon due to editing. The luc-sg2-F and nsgR primer sequences for PCR amplification can be adaptively designed:

[0144]

[0145] Example 2 Base Editing Detection

[0146] A sequence TCTAGAGACTAGTATGTCCACCGCTGCGCCAAGGTGAGGGTGTAGG (SEQ ID No. 22) containing the T1 target sequence ccgctgcgccaaggtgAggg (SEQ ID No. 20) was inserted into the 5' end of NLUC to obtain the dual fluorescence reporter system pBE-dual-luc-T1 reporter plasmid (SEQ ID No. 21) for base editing efficiency detection. Before ABE editing, the downstream NLUC could not be translated due to the presence of the TGA stop codon. After ABE editing, the TGA codon was edited to CGA, and the edited sequence was

[0147] TCTAGAGACTAGTATGTCCACCGCTGCGCCAAGGCGAGGGTGTAGG (SEQ ID No. 24), the downstream NLUC can be translated normally.

[0148] The spacer (SEQ ID No. 23) ccctctccttggcgcagcgg was constructed into the pU6-gRNA vector plasmid and named as pU6-gRNA-T1 vector plasmid.

[0149] 1. Co-transfect cells with ABE8e expression plasmid (Addgene, Plasmid, #138489) and pU6-gRNA-T1 vector plasmid and pBE-dual-luc-T1 reporter plasmid or pdual-luc reference plasmid, respectively.

[0150] The negative control group selected gRNA targeting site1 (SEQ ID No. 25), and constructed the pU6-gRNA-site1 vector plasmid in the manner of Example 1, and co-transfected the cells with the ABE8e expression plasmid (Addgene, Plasmid, #138489) and the pBE-dual-luc-T1 reporter plasmid.

[0151] The co-transfection method is as follows:

[0152] (1) One day in advance, 293T cells (purchased from ATCC, CRL-3216) were seeded in a 96-well plate at a density of 45,000 cells / well and set up into three experimental groups, namely, experimental group, positive control group, and negative control group. When the cell density reached about 90%, transfection was performed.

[0153] (2) Prepare the transfection plasmid mixture using reduced serum medium (Opti-MEM) according to the following table. The transfection method is as follows:

[0154] Preparation of solution A: Add 0.6ul (concentration of 1ug / ul) of PEI (purchased from Polysciences, 23966-1) to 5ul The transfection-specific reduced serum medium (OptiMEM) (purchased from Shanghai Yuanpei Biotechnology Co., Ltd., L530KJ) was mixed to prepare solution A;

[0155] Preparation of Solution B: Divide into 4 groups and add 5ul of plasmid to each group Mix well in the reduced serum medium for transfection to prepare solution B.

[0156] The 3 groups are prepared as follows:

[0157]

[0158] (3) Mix the prepared solution A and solution B to obtain a mixed solution A and B, and let it stand at room temperature for 30 minutes. Then add the A and B mixed solution to the 96-well plate cells, adding 10 μl of A and B mixed solution to each well. Then, place the transfected cells in an incubator and culture them for 48 hours before testing.

[0159] 2. Fluorescence Detection

[0160] The supernatant of the culture wells was removed, and 200 μL of cell lysis solution (purchased from Beyotime, RG027) was added to each well. After mixing by pipetting, 100 μL was transferred to a 96-well cell culture plate. The firefly luciferase RLU (relative light unit) was then detected using a dual luciferase reporter gene assay kit (purchased from Beyotime, RG027). f-luc and Nanoluc RLU (relative light unit) n-luc .

[0161] The base editing efficiency was calculated, with the positive control group as the 100% editing efficiency group, and the calculation formula was as follows:

[0162] Experimental group ratio = experimental group RLU n-luc / Experimental group RLU f-luc ;

[0163] Positive control group ratio = positive control group RLU n-luc / Positive control group RLU f-luc , editing efficiency of experimental group = experimental group ratio / positive control group ratio, editing efficiency of negative control group = negative control group ratio / positive control group ratio, negative control group ratio = negative control group RLU n-luc / Negative control group RLU f-luc , the editing efficiency results are shown in Figure 2 As shown;

[0164] Among them, the experimental group RLU n-luc Refers to the NLuc expression and / or signal in cells transfected with the experimental vector, RLU in the experimental group f-luc Refers to the FLuc expression and / or signal in cells transfected with the experimental vector, and RLU in the positive control group n-luc Refers to the NLuc expression and / or signal in cells transfected with the positive control vector, RLU of the positive control f-luc Refers to the FLuc expression and / or signal in cells transfected with the positive control vector, and RLU in the negative control n-luc Refers to the NLuc expression and / or signal in cells transfected with the negative control vector, and the negative control RLU f-luc Refers to the FLuc expression level and / or signal in cells transfected with the positive control vector;

[0165] The background has been removed from each fluorescence value in each group in the above formula.

[0166] The results showed that, with the positive control group as 100% editing efficiency, the base editing efficiency test results in the negative control group and the experimental group achieved the expected results, and the editing efficiency of the base editor could be tested.

[0167] Example 3 PE (Prime Editor) editing efficiency detection

[0168] The target sequence of the pBE-dual-luc-target reporter plasmid used in Example 2 was replaced with the PE system target sequence CTAGCCATGGGATCCTAGTC (SEQ ID No. 26). The target sequence contains the target sequence that is targeted and edited by the PE (Prime Editor) system, which can replace the stop codon TAG in the target sequence with TAC, so that the target sequence (SEQ ID No. 26) becomes CTAGCCATGGGATCCTACTC (SEQ ID No. 27), thereby restoring the expression of the fluorescent protein in the reporter plasmid. This mechanism can be used to detect the editing efficiency of the PE system.

[0169] The gRNA sequence in the exemplary pU6-gRNA-target plasmid in Example 1 was replaced with the pegRNA sequence to obtain the pegRNA-expressing vector plasmid pU6-pegRNA-target (see the schematic diagram of the plasmid structure). Figure 3A ). The DNA sequence corresponding to pegRNA is as follows:

[0170] gaaacaccGCTAGCCATGGGATCCTAGTCGTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCgagtgtgaagacGCCGGAGTAGGATCCCATGTTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA (SEQ ID No. 28), wherein the spacer sequence in the pegRNA sequence is CTAGCCATGGGATCCTAGTC, which is the same as the target sequence,

[0171] The optimized scaffold sequence is

[0172] GTTTgAGAGCTAtgctgGAAAcagcaTAGCAAGTTcAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID No.30), the transcription template sequence (RT template, RTT) is gagtgtgaagacGCCGGAG (SEQ ID No.31), the primer binding sequence (Primer binding site, PBS) is TAGGATCCCATG (SEQ IDNo.32), the modified prequeosine1-1 riboswitch aptamer (Motif: evopreq1) sequence is TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA (SEQ IDNo.33), and a U6 terminator (U6 terminator) is also arranged behind the modified prequeosine1-1 riboswitch aptamer (Motif: evopreq1) sequence, and the sequence is TTTTTTT.

[0173] 1. The experimental group was pBE-dual--luc-target reporter plasmid, pU6-gRNA-target and pCMV-PE2 (addgene, #132775), and the positive group was pdual-luc reference plasmid, pU6-gRNA-target and pCMV-PE2 (addgene, #132775). The two groups of plasmids were co-transfected into cells.

[0174] The co-transfection method is as follows:

[0175] (1) One day in advance, 293T cells (ATCC, CRL-3216) were seeded in a 96-well plate at a density of 45,000 cells / well and set up into three experimental groups, namely, the experimental group and the positive group. When the cell density reached about 90%, transfection was performed.

[0176] (2) Prepare the transfection plasmid mixture using reduced serum medium (Opti-MEM) (purchased from Shanghai Yuanpei Biotechnology Co., Ltd., L530KJ) according to the following table. The transfection method is as follows:

[0177] Preparation of solution A: Add 0.8ul (concentration of 1ug / ul) of PEI (purchased from Polysciences, 23966-1) to 5ul The transfection-specific reduced serum medium (OptiMEM) (purchased from Shanghai Yuanpei Biotechnology Co., Ltd., L530KJ) was mixed to prepare solution A;

[0178] Preparation of Solution B: Divide into 4 groups and add 5ul of plasmid to each group Mix well in the reduced serum medium for transfection to prepare solution B.

[0179] The plasmids were prepared in different proportions as follows:

[0180]

[0181] (3) Mix the prepared A solution and B solution to obtain a mixed solution of A and B, and let it stand at room temperature for 30 minutes. Then add the A and B mixed solution after standing to the cells in the 96-well plate, add 10μl of A and B mixed solution to each well, and then place the transfected cells in an incubator for culture. After transfection for 4-6 hours, change to complete normal culture medium. After overnight culture, change to complete culture medium with 1 / 5000 puromycin, and then change to normal complete culture medium after 24 hours of culture. Detect after transfection culture for 48 hours.

[0182] 2. Fluorescence Detection

[0183] The supernatant of the culture wells was removed, and 200 μL of cell lysis solution (purchased from Beyotime, RG027) was added to each well. After mixing by pipetting, 100 μL was transferred to a 96-well cell culture plate. The firefly luciferase RLU (relative light unit) was then detected using a dual luciferase reporter gene assay kit (purchased from Beyotime, RG027). f-luc and Renilla luciferase RLU (relative light unit) n-luc .

[0184] The base editing efficiency was calculated using the following formula:

[0185] Experimental group ratio = experimental group RLU n-luc / Experimental group RLU f-luc ;

[0186] Positive control group ratio = positive control group RLU n-luc / Positive control group RLU f-luc , editing efficiency of experimental group = experimental group ratio / positive control group ratio, editing efficiency results are shown in Figure 3B shown.

[0187] Among them, the experimental group RLU n-luc Refers to the NLuc expression and / or signal in cells transfected with the experimental vector, RLU in the experimental group f-luc Refers to the FLuc expression and / or signal in cells transfected with the experimental vector, and RLU in the positive control group n-luc Refers to the NLuc expression and / or signal in cells transfected with the positive control vector, RLU of the positive controlf-luc Refers to the FLuc expression level and / or signal in cells transfected with the positive control vector.

[0188] And the background has been removed from each fluorescence value in each group in the above formula.

[0189] The results showed that, with the positive control group as 100% editing efficiency, the PE efficiency detection results in the experimental group achieved the expected effect, and the detection of PE editing efficiency could be realized.

[0190] Example 4 Nuclease Editing Detection

[0191] In order to apply the dual fluorescent reporter system in Example 1 to the research and development of nucleases, two homologous sequences (SEQ ID No. 35) with a length of 60 bp that can undergo homologous recombination are added to the middle sequence of the nluc sequence of the pBE-dual-luc-target plasmid in Example 1, and a nuclease targeting sequence to be detected is added between the two homologous sequences (SEQ ID No. 35). For example, the TTR targeting sequence (SEQ ID No. 36) is added in this example. The structure of the homologous sequence and the targeting sequence is: homologous sequence + targeting sequence + homologous sequence, wherein the homologous sequence is the coding sequence of Nluc, and the sequence is as follows:

[0192] cggctacaacctggaccaagtccttgaacagggaggtgtgtccagtttgtttcagaatct(SEQ ID

[0193] No.35), the TTR targeting sequence is cttggcatctccccattccatgagcGGgtga (SEQ ID No.36), and the 60bp repeat sequence + TTR target sequence + 60bp repeat sequence is unable to express functional Nluc. When the nuclease targets and cuts the TTR targeting sequence, the homologous sequence will undergo homologous recombination to produce a complete nluc sequence. The reporter plasmid with the above targeting sequence and two homologous sequences is named pCas-dual-luc-TTR reporter plasmid.

[0194] 1. The TTR-giving RNA spacer sequence used in this example is gcatctccccattccatgag (SEQ ID No. 37). pU6-gRNA-TTR is constructed according to the exemplary plasmid pU6-gRNA-target in Example 1. The nuclease used in this example is SiCas12i (its amino acid sequence SEQ ID NO. 1 and nucleotide sequence SEQ ID NO. 37 are recorded in CN114015674A, and its amino acid sequence is SEQ ID NO. 34 and nucleotide sequence is SEQ ID NO. 29 are recorded in the present invention). The Cas protein expression plasmid HED1129 (SEQ ID No. 38) and the pU6-gRNA-TTR vector plasmid are co-transfected with the pCas-dual-luc-TTR reporter plasmid or the pdual-luc reference plasmid in Example 1.

[0195] For the negative control group, pU6-sgRNA-T1 (SEQ ID No. 18) without a target site on the pCas-dual-luc-TTR target sequence was co-transfected with the pCas-dual-luc-TTR reporter plasmid.

[0196] The co-transfection method is as follows:

[0197] (1) One day in advance, 293T cells (purchased from ATCC, CRL-3216) were seeded in a 96-well plate at a density of 45,000 cells / well and set up into three experimental groups, namely, experimental group, site1 control group, and blank group. Transfection was performed when the cell density reached about 90%.

[0198] (2) Prepare the transfection plasmid mixture using reduced serum medium (Opti-MEM) (purchased from Shanghai Yuanpei Biotechnology Co., Ltd., L530KJ) according to the following table. The transfection method is as follows:

[0199] Preparation of solution A: Add 0.6ul (concentration of 1ug / ul) of PEI (purchased from Polysciences, 23966-1) to 5ul The transfection-specific reduced serum medium (OptiMEM) (purchased from Shanghai Yuanpei Biotechnology Co., Ltd., L530KJ) was mixed to prepare solution A;

[0200] Preparation of Solution B: Divide into 4 groups and add 5ul of plasmid to each group Mix well in the reduced serum medium for transfection to prepare solution B.

[0201] The plasmids were prepared in different proportions as follows:

[0202]

[0203] (3) Mix the prepared solution A and solution B to obtain a mixed solution A and B, and let it stand at room temperature for 30 minutes. Then add the A and B mixed solution to the 96-well plate cells, adding 10 μl of the A and B mixed solution to each well. Then, place the transfected cells in an incubator and culture them for 48 hours before testing.

[0204] 2. Fluorescence Detection

[0205] The supernatant of the culture wells was removed, and 200 μL of cell lysis solution (purchased from Beyotime, RG027) was added to each well. After mixing by pipetting, 100 μL was transferred to a 96-well cell culture plate. The firefly luciferase RLU (relative light unit) was then detected using a dual luciferase reporter gene assay kit (purchased from Beyotime, RG027). f-luc and Renilla luciferase RLU (relative light unit) n-luc .

[0206] The base editing efficiency was calculated, with the positive control group as the 100% editing efficiency group, and the calculation formula was as follows:

[0207] Experimental group ratio = experimental group RLU n-luc / Experimental group RLU f-luc ;

[0208] Positive control group ratio = positive control group RLU n-luc / Positive control group RLU f-luc , editing efficiency of experimental group = experimental group ratio / positive control group ratio, editing efficiency of negative control group = negative control group ratio / positive control group ratio, negative control group ratio = negative control group RLU n-luc / Negative control group RLU f-luc , the editing efficiency results are shown in Figure 4 shown.

[0209] Among them, the experimental group RLU n-luc Refers to the NLuc expression and / or signal in cells transfected with the experimental vector, RLU in the experimental group f-luc Refers to the FLuc expression and / or signal in cells transfected with the experimental vector, and RLU in the positive control group n-luc Refers to the NLuc expression and / or signal in cells transfected with the positive control vector, RLU of the positive control f-luc Refers to the FLuc expression and / or signal in cells transfected with the positive control vector, and RLU in the negative control n-luc Refers to the NLuc expression and / or signal in cells transfected with the negative control vector, and the negative control RLU f-luc Refers to the FLuc expression level and / or signal in cells transfected with the positive control vector.

[0210] And the background has been removed from each fluorescence value in each group in the above formula.

[0211] The results showed that, with the positive control group as 100% editing efficiency, the nuclease editing efficiency detection results in the negative control group and the experimental group achieved the expected results, and the detection of nuclease editing efficiency could be realized.

[0212] The target sequence cttggcatctccccattccatgagcGGgtga in the pCas-dual-luc-TTR vector can be replaced by other sequences to detect the editing efficiency of different targets.

[0213] Example 5 Comparison of the efficiency of base editing detection using the dual fluorescent reporter system and conventional sequencing

[0214] The conventional method for detecting base editing efficiency is to design primers upstream and downstream of the target site. The upstream primer F sequence is caagcctcagacagtggttca (SEQ ID No. 39), and the downstream primer R sequence is tcaggacaatcctttggatcggag (SEQ ID No. 15). After PCR amplification, the fragment is sequenced and then analyzed using the online website EditR.

[0215] In order to compare the dual fluorescence reporter system with the conventional method, the remaining experimental group lysate in the dual fluorescence reporter system of Example 2 was used to amplify the target DNA fragment by PCR, and the sequencing analysis results are shown in Figure 5A and Figure 5B The editing efficiencies were 55.43% and 51.58%, which were lower than the editing efficiencies of 68.04% and 66.52% obtained by the dual fluorescence reporter system of the present invention. However, if the actual detection editing efficiency is too low, the reporter system designed by the present invention is more sensitive.

[0216] Sequence information:

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A nucleic acid construct, characterized in that The nucleic acid construct has the structure of Formula I: Z1-Z2(I); in, Z1 is the first expression cassette; Z2 is the second expression cassette; And Z1 has the structure of Formula Ia, and Z2 has the structure of Formula Ib: X1-P2-P1(Ia) P3-X2-X3(Ib) Wherein P1, P2, X1, P3, X2, and X3 are respectively elements used to constitute the structure; P1 is an optional enhancer element; P2 is the first promoter; X1 is the coding sequence of the first luciferase protein; P3 is the second promoter; X2 is a coding sequence of a second luciferase protein, wherein the coding sequence upstream or within the coding sequence contains a target sequence, and the target sequence contains a gene editing site; X3 is an optional PolyA sequence; Furthermore, each "-" is independently a bond or a nucleotide linking sequence.

2. The nucleic acid construct according to claim 1, wherein The first promoter and the second promoter are each independently selected from the following group: CMV, CAG, PGK, EF-1α, SFFV, CBh, U6 promoter, SV40 promoter, EFS promoter, MSCV promoter, SV40 promoter, mPGK promoter, hPGK promoter, UBC promoter, miniCMV promoter, or a combination thereof.

3. The nucleic acid construct according to claim 1, wherein The first luciferase protein and the second luciferase protein are each independently selected from the following group: firefly luciferase (Firefly Luciferase, Fluc), Renilla Luciferase (Rluc), NanoLuc (Nluc), HiBiT, Gluc, or a combination thereof.

4. The nucleic acid construct according to claim 1, wherein The first luciferase protein and the second luciferase protein are different.

5. The nucleic acid construct according to claim 1, wherein The first luciferase protein is firefly luciferase (Fluc).

6. The nucleic acid construct according to claim 1, wherein The second luciferase protein is NanoLuc (Nluc).

7. The nucleic acid construct according to claim 1, wherein A homologous sequence of 20-100 bp (preferably 40-80 bp, more preferably 50-70 bp) is inserted in the middle of the gene encoding the second luciferase protein, wherein the homologous sequence contains a target sequence in the middle; or a target sequence is added upstream of the gene encoding the second luciferase protein, wherein the target sequence contains a stop codon.

8. A carrier product, characterized in that: The vector product comprises a first vector, wherein the first vector comprises the nucleic acid construct of claim 1; A second vector, comprising an expression cassette for expressing a gene editing protein or a base editor or a lead editor (PE); and An optional third vector, the third vector contains an expression cassette for expressing a gRNA, wherein the gRNA targeting site enables the second vector to target a target sequence upstream of the gene encoding the second luciferase protein or in the gene encoding the second luciferase protein.

9. A genetically engineered cell, characterized in that: The cells are transformed or transfected by the vector product of claim 2.

10. A method for detecting base editing efficiency, characterized in that: Includes steps: (i) introducing the first vector, the second vector, the third vector and optionally the reference vector; or the vector product of claim 8 into a cell; Wherein, the first vector contains the nucleic acid construct of claim 1; the second vector contains an expression cassette for expressing a gene editing protein or a base editor or a PE; and the third vector contains an expression cassette for expressing a gRNA, wherein the gRNA targeting site makes the second vector target a target sequence upstream of the gene encoding the second luciferase protein or in the gene encoding the second luciferase protein; (ii) detecting the expression amount and / or signal of the first luciferase protein and the second luciferase protein expressed in the cell; (iii) judging the base editing efficiency or the nuclease cleavage efficiency according to the expression level and / or signal of the first luciferase protein and the second luciferase protein.

Images