Use of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS-susceptible populations

Abstract

The present invention provides an application of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS susceptible populations, which relates to the technical field of biomedicine. Through genome-wide association studies, it has been found that the genotype GG of the SNP locus rs6802921 at 3p25.3 is the susceptible genotype for AMS. By detecting the SNP locus rs6802921, it is possible to effectively achieve the auxiliary screening of AMS susceptible populations and carry out scientific interventions to specifically reduce the risk of AMS occurrence in these susceptible populations.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS susceptible populations. Background Art

[0002] Acute mountain sickness (AMS) is the most common disease in high-altitude areas, usually occurring shortly after a rapid ascent to an oxygen-deficient environment. The incidence of AMS increases with the altitude. At an altitude of 2,850 meters, the incidence is 5.8%; at 3,050 meters, it is 2.1%; at 3,650 meters, it is 14.8%; and at 4,559 meters, it is 21.9%. The main symptoms of this disease include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. Although altitude sickness itself is not life-threatening, it may progress to more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which can be fatal if not treated promptly. With more and more people traveling, working, and exercising in high-altitude areas, altitude sickness has become an important public health issue. However, the exact pathophysiology of AMS is still poorly understood.

[0003] Studies have shown that genetic factors play an important role in the susceptibility to AMS, and certain genotypes are beneficial for rapid adaptation to high-altitude environments. Association studies based on candidate genes have identified several single nucleotide polymorphisms (SNPs) loci that are significantly associated with the risk of AMS. The genes associated with these SNPs are mainly divided into the following four categories: (a) hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNPs, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); (b) genes involved in angiogenesis, vascular permeability, and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983), and EDN1 (rs2070699); (c) heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581), and HSPA1L (rs2227956); (d) genes in the renin-angiotensin system, such as ACE (rs4340) and AGT (rs699). However, due to the limited understanding of the physiological mechanisms of AMS susceptibility, the selection of candidate genes is restricted. In addition, this method cannot fully explain the overall heritability of AMS.

[0004] There is currently no research report on the correlation between the polymorphism of genomic region 3p25.3 (TTLL3) and the susceptibility to AMS.

[0005] In view of this, the present invention is specifically proposed. Summary of the Invention

[0006] The first object of the present invention is to provide the application of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS-susceptible populations, so as to solve the above technical problems.

[0007] The second object of the present invention is to provide a reagent for screening AMS-susceptible populations.

[0008] The third object of the present invention is to provide a kit for screening AMS-susceptible populations.

[0009] The fourth object of the present invention is to provide a device for screening AMS-susceptible populations.

[0010] In order to achieve the above objects, the following technical solutions are specifically adopted:

[0011] In the first aspect, the present invention provides the application of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS-susceptible populations.

[0012] As a further technical solution, if the genotype of SNP locus rs6802921 is GG, it is an AMS-susceptible population.

[0013] As a further technical solution, the product includes a reagent or a kit.

[0014] In the second aspect, the present invention provides a reagent for screening AMS-susceptible populations, including primers and / or probes for detecting SNP locus rs6802921.

[0015] As a further technical solution, the nucleic acid sequences of the primers are as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0016] As a further technical solution, the nucleic acid sequences of the probes are as shown in SEQ ID NO.3 or SEQ ID NO.4.

[0017] As a further technical solution, the 5' end of the probe is connected with a fluorescent reporter group, and the 3' end is connected with a fluorescent quenching group;

[0018] The fluorescent reporter group includes FAM or HEX;

[0019] The fluorescent quenching group includes TAMRA, BHQ1 or BHQ2.

[0020] In a third aspect, the present invention provides a kit for screening AMS-susceptible populations, including the above-mentioned reagents.

[0021] As a further technical solution, it further includes nucleic acid extraction reagents.

[0022] In a fourth aspect, the present invention provides a device for screening AMS-susceptible populations, including a sequencing device, a comparison device, and an analysis device;

[0023] The sequencing device is used for sequencing the region including rs6802921 in the sample to be tested;

[0024] The comparison device is used to determine the genotype of rs6802921 according to the result of the sequencing device;

[0025] The analysis device is used to judge the AMS susceptibility risk according to the result of the comparison device.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] Through genome-wide association studies, it has been found that the genotype GG of the SNP locus rs6802921 at 3p25.3 is the susceptible genotype of AMS. By detecting the SNP locus rs6802921, it is possible to effectively assist in screening AMS-susceptible populations and carry out scientific interventions to specifically reduce the risk of AMS occurrence in these susceptible populations. Description of the Drawings

[0028] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 : Manhattan plot and quantile plot of genome-wide association study of population cohorts. Specific Embodiments

[0030] The following will describe the implementation of the present invention in detail in combination with embodiments and examples. However, those skilled in the art will understand that the following embodiments and examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present invention. Those not specified in specific conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not specified in the manufacturer are all conventional products that can be obtained through commercial purchase.

[0031] In a first aspect, the present invention provides the use of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for AMS susceptible populations.

[0032] Through genome-wide association studies, it has been found that the genotype GG of the SNP locus rs6802921 at 3p25.3 is a susceptible genotype for AMS. When the rs6802921 of an individual shows the genotype GG, it indicates that the individual has a higher likelihood of suffering from AMS. In addition, by analyzing expression Quantitative Trait Loci (eQTL), the protective allele A of rs6802921 is significantly associated with the low expression of the TTLL3 gene in the eye (P = 1.97×10 -4 ). It shows that TTLL3 is a major AMS susceptible candidate gene on chromosome 3p25.3.

[0033] Accordingly, by detecting the SNP locus rs6802921, the screening of AMS susceptible populations can be effectively achieved. For example, since the present invention has confirmed the association between the rs6802921 genotype GG and the susceptibility to AMS, in the prevention and control of AMS populations, it is necessary to detect the rs6802921 genotype of the consulted object to determine whether the object carries the AMS susceptible genotype rs6802921GG. For individuals with the genotype rs6802921GG, scientific interventions can be carried out, such as suggesting early therapeutic prevention, etc., so as to specifically reduce the risk of AMS occurrence in these susceptible populations.

[0034] In some alternative embodiments, the product includes a reagent or a kit.

[0035] In a second aspect, the present invention provides a reagent for screening AMS susceptible populations, including primers and / or probes for detecting the SNP locus rs6802921.

[0036] This reagent can assist in predicting AMS individuals in a short time, at low cost, and with high accuracy by detecting the SNP locus rs6802921, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.

[0037] In some alternative embodiments, the nucleic acid sequences of the primers are as shown in SEQ ID NO.1 and SEQ ID NO.2:

[0038] Forward primer: CCTGGCAGGGAGGGTTTTAG (SEQ ID NO.1);

[0039] Reverse primer: AAATGTGGACAAGGAGGGCC (SEQ ID NO.2).

[0040] In some alternative embodiments, the nucleic acid sequences of the probes are as shown in SEQ ID NO.3 or SEQ ID NO.4:

[0041] TGCCTACCCGGGACTGAGCC (SEQ ID NO.3);

[0042] TGCCTACCCAGGACTGAGCC (SEQ ID NO.4).

[0043] In some alternative embodiments, the 5'-end of the probe is linked with a fluorescent reporter group, and the 3'-end is linked with a fluorescent quenching group;

[0044] The fluorescent reporter group includes but is not limited to FAM or HEX;

[0045] The fluorescent quenching group includes but is not limited to TAMRA, BHQ1 or BHQ2.

[0046] In a third aspect, the present invention provides a kit for screening AMS-susceptible populations, including the above-mentioned reagent.

[0047] This kit can screen AMS-susceptible populations by detecting the SNP locus rs6802921.

[0048] In some alternative embodiments, it further includes a nucleic acid extraction reagent. The nucleic acid extraction reagent is used to obtain the DNA of the sample to be tested.

[0049] In a fourth aspect, the present invention provides a device for screening AMS-susceptible populations, including a sequencing device, a comparison device, and an analysis device;

[0050] The sequencing device is used for sequencing the region including rs6802921 of the sample to be tested;

[0051] The comparison device is used to determine the gene type of rs6802921 according to the results of the sequencing device;

[0052] The analysis device is used to judge the AMS susceptibility risk according to the results of the comparison device.

[0053] In some alternative embodiments, the sequencing device is used to sequence a predetermined region in the whole genome of an individual to obtain sequencing results; wherein, the predetermined region is 1Kb upstream and downstream of rs6802921. Thus, sequencing can be carried out more effectively.

[0054] The present invention will be further described below through specific embodiments. However, it should be understood that these embodiments are only for more detailed description and should not be construed as limiting the present invention in any form.

[0055] Example 1 Genome-wide association study of AMS susceptibility

[0056] 1. Materials and methods

[0057] 1.1 Research subjects

[0058] Population cohort 1: Population cohort 1 took a train from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2022, with a total of 226 participants. After all participants received a comprehensive introduction to the research details, they all gave written informed consent. The sociodemographic information of all participants was collected, and about 2 ml of fasting venous blood was drawn from each participant before they ascended to the plateau and stored in an environment of minus 80 degrees Celsius. On the night of arrival, each participant filled out the Lake Louise questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group.

[0059] 1.2 Genotyping, quality control and imputation analysis

[0060] According to the manufacturer's instructions, peripheral whole blood samples of all participants were collected, and genomic DNA was extracted from 1 mL of blood using the QIAamp DNA BloodKit (Qiagen, Crawley, UK). The DNA quality was evaluated by two methods: (1) evaluating DNA degradation and contamination on a 1% agarose gel; (2) measuring the DNA concentration using the Qubit DNA detection kit and the Qubit 2.0 fluorometer. The samples were genotyped using the Illumina Infinium Global Screening Array-24v1.0 BeadChip.

[0061] Subsequently, strict quality control was performed on the samples and SNPs to ensure the robustness of the association tests. Samples with low call rates (<90%), undetermined sex, close relatives (PI_HAT value greater than 0.2 in PLINK v.1.9), high heterozygosity rates (greater than 3 standard deviations from the mean), or identified as outliers using principal component analysis were excluded. For SNPs, this study excluded SNPs with genotype call rates below 90%, deviation from Hardy-Weinberg equilibrium (control HWE deviation P < 1e-6, case HWE deviation P < 1e-10), minor allele frequencies below 5%, and SNPs located on the XY chromosomes.

[0062] To improve the genomic region coverage, the human genome hg19 was used, and the 1000Genomes Project data was used as a reference. SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) were used to impute the genotyping data. Finally, SNPs with information scores below 0.6 or minor allele frequencies below 0.01 were excluded.

[0063] 1.3 Association studies

[0064] Genome-wide association analysis was performed using the logistic regression model in PLINK v.1.9, with sex, age, and the top 10 principal components as covariates. Quantile-quantile plots (Q-Q plots) were generated in R (4.3.1) to evaluate the distribution of P-values, and the lambda (λ) inflation factor (genomic inflation factor) was evaluated to detect the presence of systematic biases. In this study, SNPs with P < 0.05 in population cohort 1 were considered significantly different AMS-susceptible SNPs.

[0065] Subsequently, fine-mapping analysis was performed using CAVIAR (v.2.2) and FINEMAP (v.1.3.1). A set of credible SNPs was determined for each locus, defined as the smallest set of variants that includes all causal variants and has a certainty greater than 0.95. Subsequently, we used RegulomeDB (V2) and Haploreg to identify potential functional SNPs.

[0066] 2. Results

[0067] 2.1 Results of genome-wide SNP data quality control

[0068] To explore the AMS-susceptible regions in the Chinese population, the inventors genotyped the SNPs in population cohort 1. After strict quality control (Table 1), 74 cases and 145 controls, as well as 7,010,527 SNPs, were retained in population cohort 1.

[0069] Table 1 Quality control process of the population (a) Quality control of the population sample:

[0070]

[0071] (b) SNP quality control process:

[0072]

[0073] 2.2 Association analysis results

[0074] The inventors performed an association analysis on population cohort 1, thereby identifying a locus 3p25.3 that was significantly associated with AMS (P < 0.05). On chromosome 3p25.3 in population cohort 1 (index SNP rs6802921; odds ratio OR of the A allele = 0.5851; 95% confidence interval CI = 0.3633 - 0.9423; P = 2.75×10 -2 ). There were significant differences in the allele frequencies of the above - mentioned locus between the case group and the control group ( Figure 1 , where (a) a Manhattan plot was drawn based on the association results of population cohort 1 of the embodiments of the present invention, which described the genome - wide association statistics of population cohort 1, and these statistics were from a logistic regression model considering gender, age, and the top 10 principal components; (b) a quantile - quantile plot was drawn based on the association results of population cohort 1 of the present invention; the inflation factor λ was 1.053; the slanted line represented the null hypothesis of no true association).

[0075] Example 2 Susceptibility gene mapping analysis

[0076] To identify potential susceptibility genes on SNPs, this study performed eQTL analysis using 5 publicly available datasets: (1) QTLbase collected genome-wide QTL statistical summaries of many human molecular traits under over 95 tissue / cell types and various biological conditions. This database includes tens of millions of important genotype-molecular trait associations under different conditions. (2) Genotype-Tissue Expression database (GTEx, version 8), covering 48 tissues (including blood and lung), detecting SNPs by whole-genome sequencing and measuring mRNA expression levels by RNA sequencing. (3) ImmuNexUT, covering 9852 immune cell samples from 416 donors, including 10 different immune-mediated diseases and 28 immune cell types from healthy donors. (4) FIVEx, including eQTL and sQTL data from 16 different studies in the EBI eQTL catalogue. (5) scQTLbase is a comprehensive portal for human single-cell eQTLs, which includes 304 datasets of 57 cell types and 95 cell states. It includes approximately 16 million SNPs related to gene expression in specific cells, and approximately 690,000 disease-related sc-eQTLs from 3333 traits / diseases. This study only focused on protein-coding genes within 1 Mb upstream and downstream of the SNP, and considered P<0.001 as statistically significant. The gene TTLL3 is included within 1 Mb upstream and downstream of the index SNP rs6802921 locus. According to the results of QTLbase2, the protective allele A of rs6802921 was significantly associated with low expression of the TTLL3 gene in the eye (P = 1.97×10 -4 ). These results indicate that TTLL3 is a major candidate gene on chromosome 3p25.3.

[0077] TTLL3 can catalyze the binding of tyrosine to the C-terminus of α-tubulin in an ATP-dependent manner to form microtubules. Studies have shown that the proportion of membrane tubulin in red blood cells of hypertensive patients is higher, suggesting that increased TTLL3 expression may be associated with elevated blood pressure. Surprisingly, our results also showed that the protective A allele decreased the expression of TTLL3 in the eye (P = 1.97×10 -4)。Combined with previous studies, we speculate that under acute hypoxia conditions, the GG genotype at the rs6802921 locus may promote the formation of microtubules, increase blood pressure, and thus cause common problems in the plateau such as retinal hemorrhage. In summary, both the association study and the functional study of the inventors suggest that the AMS susceptibility genes in the region where rs6802921 is located (3p25.3) include the TTLL3 gene. The present invention confirms the association between the GG genotype of rs6802921 and AMS susceptibility. In the prevention and control of AMS in the population, the genotype of rs6802921 should be detected for counseling subjects to carry out scientific intervention and specifically reduce the risk of AMS in these susceptible populations.

[0078] Example 3

[0079] To verify the accuracy of predicting AMS susceptible populations based on the GG genotype of rs6802921, the inventors verified it in population cohort 2.

[0080] Population cohort 2: Population cohort 2 took a bus from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2023, and a total of 367 participants were recruited. After all participants received a comprehensive introduction to the research details, they all gave written informed consent. The sociodemographic information of all participants was collected, and about 2 ml of fasting venous blood was drawn for each participant before they ascended to the plateau and stored in an environment of minus 80 degrees Celsius. On the night of arrival, each participant filled out the Lake Louise questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 points were classified into the case group, while participants without obvious symptoms were classified into the control group. After strict quality control (the quality control method refers to 1.2 in Example 1), 84 cases and 176 controls were retained in population cohort 2.

[0081] According to the manufacturer's instructions, peripheral whole blood samples of all participants were collected, and the genotypes of the rs6802921 locus of the subjects were detected. The results are statistically shown in Table 2:

[0082] Table 2

[0083]

[0084] According to the results in Table 2, the sensitivity, specificity, and accuracy of predicting AMS susceptible populations based on the GG genotype of rs6802921 were calculated, and the results are as follows:

[0085] Sensitivity: 0.64, Specificity: 0.625, Accuracy: 0.63.

[0086] It is proved that the present invention has good diagnostic value and can be used for the auxiliary diagnosis of AMS susceptible populations.

[0087] Example 4

[0088] Primers and probes were designed for the rs6802921 locus:

[0089] Forward primer: CCTGGCAGGGAGGGTTTTAG (SEQ ID NO.1);

[0090] Reverse primer: AAATGTGGACAAGGAGGGCC (SEQ ID NO.2);

[0091] Probe 1: (FAM)TGCCTACCCGGGACTGAGCC(BHQ1) (SEQ ID NO.3);

[0092] Probe 2: (HEX)TGCCTACCCAGGACTGAGCC(BHQ1) (SEQ ID NO.4).

[0093] DNA was separately extracted from subjects with genotypes GG and AA at the SNP locus rs6802921. Then, using this DNA as a template, a fluorescence quantitative PCR detection was performed with an amplification system containing the above primers and probes (forward primer, reverse primer, Probe 1, and Probe 2). The results showed that only a single fluorescence was detected after the amplification of the two nucleic acids, indicating that the primers and probes of the present invention can be used for the detection of the rs6802921 locus.

[0094] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting SNP locus rs6802921 in the preparation of a screening product for acute mountain sickness susceptible populations.

2. The application according to claim 1, characterized in that If the genotype of SNP locus rs6802921 is GG, it is an acute mountain sickness susceptible population.

3. The application according to claim 1, wherein The product includes a reagent or a kit.

4. A device for screening susceptible populations to acute mountain sickness, characterized in that, It includes a sequencing device, an alignment device, and an analysis device; The sequencing device is used for sequencing the region including rs6802921 of the sample to be tested; The alignment device is used for determining the gene type of rs6802921 according to the result of the sequencing device; The analysis device is used for judging the acute mountain sickness susceptibility risk according to the result of the alignment device.

Images