Specific primer group for identifying bacillus bacteria, detection method and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to a specific primer group for identifying bacillus bacteria, a detection method and application. The specific primer group provided by the invention is composed of a primer F3, a primer B3, a primer FIP, a primer BIP and a primer LB, the specific primer group is a primer group used for a loop-mediated isothermal amplification technology, can identify or assist in identifying bacillus bacteria or detecting whether a to-be-detected sample contains the bacillus bacteria, has high specificity and high sensitivity, and can be used for detecting whether the to-be-detected sample contains the bacillus bacteria or not. The detection is convenient and rapid, the detection cost is low, and the method can be applied to food production enterprise grassroots and on-site rapid detection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a specific primer set for identifying Bacillus bacteria, a detection method and an application thereof. Background Art

[0002] Bacillus ( Bacillus ) are Gram-positive bacteria that are widely found in nature and cause serious food contamination worldwide. The main species causing this problem are Bacillus cereus, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis and Bacillus megaterium, among which Bacillus cereus and Bacillus subtilis are important pathogens that contaminate daily foods including dairy products, meat, etc. Rapid and accurate identification of these Bacillus is the basis for effective prevention of food contamination.

[0003] Traditionally, Bacillus is mainly identified through culture medium, microscopic observation of colony morphology and physiological and biochemical experiments. These methods are time-consuming and laborious, and sometimes cannot distinguish qualitatively at the species level. Molecular biological methods that rely on nucleic acids to amplify and detect target objects can quickly and specifically detect a large number of bacterial species. Various nucleic acid-based detection methods that have been developed and proven to be valuable include bioluminescence, antigen-antibody method, molecular hybridization technology, polymerase chain reaction (PCR) technology, etc. These methods have the advantages of being fast, accurate and sensitive, but often require sophisticated experimental instruments and specialized laboratory environments, are expensive to detect, and require high professional quality of the testers. These shortcomings limit its practicality in rapid detection at the grassroots level and on-site of food production enterprises. Summary of the invention

[0004] In view of the above technical problems, the present invention provides a specific primer set, detection method and application for identifying Bacillus bacteria. The specific primer set provided in the present application utilizes loop-mediated isothermal amplification technology to amplify specific gene fragments of Bacillus bacteria, and has the advantages of strong specificity, simple operation, rapidity and convenience, and can be used for on-site rapid detection in food production enterprises.

[0005] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: The first aspect of the present invention provides a specific primer set for identifying Bacillus bacteria, which consists of primer F3, primer B3, primer FIP, primer BIP and primer LB; The primer F3 is a single-stranded DNA molecule as shown in SEQ ID NO.2, or a DNA molecule obtained by replacing and / or deleting and / or adding one or more nucleotides of the single-stranded DNA molecule as shown in SEQ ID NO.2 and having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.2; The primer B3 is a single-stranded DNA molecule as shown in SEQ ID NO.3, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.3 after one or more nucleotides are replaced and / or deleted and / or added; The primer FIP is a single-stranded DNA molecule as shown in SEQ ID NO.4, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.4 after one or more nucleotides are replaced and / or deleted and / or added; The primer BIP is a single-stranded DNA molecule as shown in SEQ ID NO.5, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.5 after one or more nucleotides are replaced and / or deleted and / or added; The primer LB is a single-stranded DNA molecule as shown in SEQ ID NO.6, or a DNA molecule obtained by replacing and / or deleting and / or adding one or more nucleotides of the single-stranded DNA molecule as shown in SEQ ID NO.6 and having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.6.

[0006] The sequence of SEQ ID NO.2 is: 5´-TGGGATAACTCCGGGAAACC-3´; The sequence of SEQ ID NO.3 is: 5´-CGTGTCTCAGTCCCAGTGT-3´; The sequence of SEQ ID NO.4 is: 5´-TGGTAGCCGAAGCCACCTTTT-GGGGCTAATACCGGATGGT-3´; The sequence of SEQ ID NO.5 is: 5'-CGGCGCATTAGCTAGTTGGTGA-TCAGGTCGGCTACGCATC-3'; The sequence of SEQ ID NO.6 is: 5´-TAACGGCTCACCAAGGCAA-3´.

[0007] The specific primer set is a primer set used for loop-mediated isothermal amplification (LAMP) technology, which can identify or assist in identifying Bacillus bacteria, or detect whether a sample to be tested contains Bacillus bacteria.

[0008] So far, there are no LAMP-specific primers and kits for detecting Bacillus bacteria on the market. The specific primer set provided by the present invention can use LAMP to amplify the specific gene fragment of Bacillus bacteria, filling the gap in the LAMP detection method of Bacillus bacteria in food. It has been verified by experiments that the above-mentioned specific primer set has high specificity and high sensitivity for Bacillus detection through LAMP detection method, and has low requirements for equipment and detection personnel, and the detection is convenient and fast, with low detection cost, which is convenient for rapid detection at the grassroots level and on-site of food production enterprises.

[0009] Preferably, the primer F3 is a single-stranded DNA molecule as shown in SEQ ID NO.2.

[0010] Preferably, the primer B3 is a single-stranded DNA molecule as shown in SEQ ID NO.3.

[0011] Preferably, the primer FIP is a single-stranded DNA molecule as shown in SEQ ID NO.4.

[0012] Preferably, the primer BIP is a single-stranded DNA molecule as shown in SEQ ID NO.5.

[0013] Preferably, the primer LB is a single-stranded DNA molecule as shown in SEQ ID NO.6.

[0014] Preferably, the Bacillus bacteria include Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus megaterium, and Bacillus licheniformis.

[0015] Preferably, in the specific primer set, the molar ratios of primer F3, primer B3, primer FIP, primer BIP and primer LB are 1:1:8:8:4, respectively.

[0016] The second aspect of the present invention provides the use of the above-mentioned specific primer set in the preparation of a specific reagent or a kit for identifying Bacillus bacteria.

[0017] The third aspect of the present invention provides a specific reagent for identifying Bacillus bacteria, wherein the specific reagent is in liquid form and comprises the following components: the above-mentioned specific primer set, DNA polymerase, dNTPs (deoxynucleotide triphosphates), buffer, magnesium ions, fluorescent dye and water; the molar ratios of the primer F3, primer B3, primer FIP, primer BIP and primer LB are 1:1:8:8:4 respectively.

[0018] Exemplarily, the specific reagent includes the above-mentioned specific primer set, Isothermal Master Mix and water. Isothermal Master Mix contains DNA polymerase required for loop-mediated isothermal amplification, dNTPs (deoxynucleotide triphosphates), buffer, magnesium ions and fluorescent dyes. Preferably, each 11 μL of specific reagent contains 7.5 μL of Isothermal Master Mix, and the content of each primer is: primer F3 2.5 pmol, primer B3 2.5 pmol, primer FIP 20 pmol, primer BIP 20 pmol, primer LB 10 pmol, and the balance is water.

[0019] The fourth aspect of the present invention provides a kit for identifying Bacillus bacteria, the kit comprising the following reagents: a primer solution of the above-mentioned specific primer set, a DNA polymerase, dNTPs, a buffer, magnesium ions, and a fluorescent dye. Each primer exists in the form of a primer mixture or in the form of a single primer solution.

[0020] Illustratively, the kit includes the following reagents: a primer solution of the specific primer set and Isothermal Master Mix.

[0021] Illustratively, the kit comprises the above-mentioned specific reagents.

[0022] The above-mentioned specific reagent or kit can be used to identify or assist in identifying Bacillus bacteria, or to detect whether a sample to be tested contains Bacillus bacteria.

[0023] The fifth aspect of the present invention provides the use of the above-mentioned specific primer set or specific reagent or kit, including: Application in identifying or assisting in identifying Bacillus bacteria; Application in detecting whether a sample to be tested contains Bacillus bacteria.

[0024] A sixth aspect of the present invention provides a method for identifying or assisting in identifying Bacillus bacteria, the specific steps comprising: S1. Extracting genomic DNA of the microorganism to be tested; S2. Using the genomic DNA extracted in S1 as a template, the above-mentioned specific primer set or specific reagent or kit is used to perform loop-mediated isothermal amplification; judging whether the microorganism to be tested is a Bacillus bacterium according to the amplification result.

[0025] The present invention uses the above-mentioned specific primer set to amplify 20 bacterial strains, and only the Bacillus strain shows positive amplification, while the other strains are negative. However, there may be other strains containing the gene fragment shown in SEQ ID NO.1 in nature, or the microorganism to be tested is a mutant strain containing the gene fragment. In this case, the microorganism to be tested will also show positive, so using only the specific primer set may not necessarily obtain an absolutely accurate result. Therefore, if the specific primer set can achieve specific amplification using the genomic DNA as a template, the microorganism to be tested is or is a candidate for Bacillus bacteria; if the specific primer set cannot achieve specific amplification using the genomic DNA as a template, the microorganism to be tested is or is a candidate for non-Bacillus bacteria.

[0026] When the microorganism to be detected is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus megaterium, Bacillus licheniformis, Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus casei, Bifidobacterium longum, Lactobacillus acidophilus, Pediococcus pentosaceus, Streptococcus thermophilus, Lactococcus lactis, Pantoea thermophila, Acinetobacter pitei, Pseudomonas aeruginosa, Escherichia coli, Salmonella typhimurium, Shigella sonnei or Staphylococcus aureus, then if the specific primer set can achieve specific amplification with the genomic DNA as a template, the microorganism to be detected is a bacterium of the genus Bacillus, otherwise it is a non-Bacillus bacterium.

[0027] Preferably, the reaction system of the loop-mediated isothermal amplification is:

[0028] The reaction conditions of the loop-mediated isothermal amplification are: 62-67° C., at least 20 min.

[0029] Preferably, the reaction temperature of the loop-mediated isothermal amplification is 64-66°C.

[0030] Further preferably, the reaction temperature of the loop-mediated isothermal amplification is 65°C.

[0031] Preferably, the reaction time is 30 min.

[0032] A seventh aspect of the present invention provides a method for detecting whether a sample to be tested contains Bacillus bacteria, the specific steps comprising: SI, extract the total DNA of the sample to be tested; SII, using the total DNA extracted from SI as a template, and using the above-mentioned specific primer set or specific reagent or kit to perform loop-mediated isothermal amplification; judging whether the sample to be tested contains Bacillus bacteria according to the amplification result.

[0033] If the sample to be tested contains other strains having a gene fragment as shown in SEQ ID NO.1, or a mutant strain containing the gene fragment, or there is a gene fragment containing the gene fragment, then the test result will be positive. Therefore, when only using the specific primer set to detect whether the sample to be tested contains Bacillus bacteria, it is not necessarily possible to obtain an absolutely accurate result. If the specific primer set can achieve specific amplification using the total DNA as a template, the sample to be tested contains or is suspected of containing Bacillus bacteria; if the specific primer set cannot achieve specific amplification using the total DNA as a template, the sample to be tested does not contain or is suspected of not containing Bacillus bacteria.

[0034] If the microorganism contained in the sample to be tested is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus megaterium, Bacillus licheniformis, Lactobacillus brevis, Lactobacillus plantarum, Lactobacillus casei, Bifidobacterium longum, Lactobacillus acidophilus, Pediococcus pentosaceus, Streptococcus thermophilus, Lactococcus lactis, Pantoea thermophila, Acinetobacter pitei, Pseudomonas aeruginosa, Escherichia coli, Salmonella typhimurium, Shigella sonnei, Staphylococcus aureus, then if the specific primer set can achieve specific amplification with the total DNA as a template, the microorganism in the sample to be tested is a Bacillus bacterium, otherwise it is a non-Bacillus bacterium.

[0035] Preferably, the reaction system of the loop-mediated isothermal amplification is:

[0036] The reaction conditions of the loop-mediated isothermal amplification are: 62-67° C., at least 20 min.

[0037] Preferably, the reaction temperature of the loop-mediated isothermal amplification is 64-66°C.

[0038] Further preferably, the reaction temperature of the loop-mediated isothermal amplification is 65°C.

[0039] Preferably, the reaction time is 30 min.

[0040] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention targets 7 regions of the Bacillus target gene and uses 2 inner primers, 2 outer primers and 1 loop primer for detection, which has higher specificity; (2) The specific primer set provided by the present invention has a higher sensitivity for detecting Bacillus by loop-mediated isothermal amplification, which is at least one order of magnitude higher than the sensitivity of polymerase chain reaction; (3) The present invention can directly determine the amplification product by simply observing the fluorescence amplification curve and the melting curve, avoiding the subsequent detection steps such as gel electrophoresis required by other molecular biological methods such as polymerase chain reaction. It is simple to operate, easy to identify the results, low in cost, and more suitable for on-site field detection; (4) The detection cycle using the specific primer set of the present invention is shorter and the detection speed is faster; (5) The amplification instrument used in the LAMP method only requires a lithium battery supply. The equipment is portable and does not require a professional laboratory or equipment. It can meet the needs of sample processing, testing and other operations on-site in a conventional environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is the fluorescence amplification curve of the LAMP reaction in Example 2 of the present invention; Figure 2 is the fluorescence amplification curve of the LAMP reaction in Example 3 of the present invention; Figure 3 is the fluorescence amplification curve of the LAMP reaction in Example 4 of the present invention; Figure 4 is the dissolution curve of the LAMP reaction in Example 4 of the present invention; Figure 5 is the fluorescence amplification curve of the LAMP reaction in Example 5 of the present invention; Figure 6 This is the fluorescence amplification curve of the real-time fluorescence PCR in Example 5 of the present invention. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0043] Bacillus bacteria can cause serious food contamination, so it is necessary to identify them in order to prevent food contamination. However, traditional methods for identifying Bacillus are time-consuming and labor-intensive, and have low accuracy. Molecular biology methods have high requirements for the testing environment, equipment, and personnel, and are expensive, which limits their application in rapid testing at the grassroots level and on-site in food production enterprises.

[0044] The present invention screened out specific nucleic acid fragments of multiple Bacillus bacteria through a large number of sequence comparisons, and finally obtained a specific primer set for LAMP with the best effect after LAMP primer design and preliminary experimental effect verification. The specific primer set consists of primer F3, primer B3, primer FIP, primer BIP and primer LB, and its target sequence is shown in SEQ ID NO.1.

[0045] SEQ ID NO. 1: TGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACG.

[0046] The embodiment of the present invention also provides the use of the specific primer set in preparing a specific reagent or a kit for identifying Bacillus bacteria.

[0047] The embodiments of the present invention also provide applications of the above-mentioned specific primer set or specific reagent or kit, including applications in identifying or assisting in identifying Bacillus bacteria, and applications in detecting whether a sample to be tested contains Bacillus bacteria.

[0048] The following is further described with reference to specific embodiments.

[0049] The experimental methods in the following examples, unless otherwise specified, are conventional methods in the art, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0050] Example 1 An embodiment of the present invention provides a specific primer set for identifying Bacillus bacteria, which consists of primer F3, primer B3, primer FIP, primer BIP and primer LB, the sequence of primer F3 is shown in SEQ ID NO.2, the sequence of primer B3 is shown in SEQ ID NO.3, the sequence of primer FIP is shown in SEQ ID NO.4, the sequence of primer BIP is shown in SEQ ID NO.5, and the sequence of primer LB is shown in SEQ ID NO.6.

[0051] Example 2 The examples of the present invention verify the amplification effect of the specific primer set of Example 1.

[0052] The test bacteria was Bacillus amyloliquefaciens CICC10160.

[0053] 1. Take the test bacterial solution (bacterial concentration is 10 5 CFU / mL), treated at 99℃ for 5min, terminated the reaction at 4℃, collected the supernatant, and obtained the template solution containing genomic DNA.

[0054] 2. Perform LAMP Reaction system (12.5 μL): Template solution 1.5 μL, Isothermal Master Mix 7.5 μL, Primer F3 2.5 pmol, Primer B3 2.5 pmol, Primer FIP 20 pmol, Primer BIP 20 pmol, Primer LB 10 pmol, and the balance is water.

[0055] Reaction conditions: 65°C, 30 min. The reaction was carried out in a GenieⅡ real-time fluorescence detector.

[0056] The fluorescence amplification curve of LAMP reaction is shown in Figure 1 As shown, the test bacteria has an amplification curve, while double distilled water has no amplification curve.

[0057] Example 3 The examples of the present invention investigated the amplification effect of the specific primer set of Example 1 at different reaction temperatures.

[0058] The test bacteria was Bacillus amyloliquefaciens CICC10160.

[0059] 1. Take the test bacterial solution (bacterial concentration is 10 5 CFU / mL), treated at 99℃ for 5min, terminated the reaction at 4℃, collected the supernatant, and obtained the template solution containing genomic DNA.

[0060] 2. Perform LAMP The reaction system is the same as in Example 2.

[0061] Reaction conditions: reaction temperature is 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C or 67°C, reaction time is 30 min. The reaction is carried out in GenieⅡ real-time fluorescence detector.

[0062] Fluorescence amplification curves are shown in Figure 2 The ideal amplification effect can be achieved at 62~67℃, among which the amplification effect at 64~66℃ is better, and the amplification effect at 65℃ is the best.

[0063] Example 4 The examples of the present invention investigated the specificity of the specific primer set of Example 1.

[0064] The tested bacteria were: Bacillus subtilis CICC24713 ( Bacillus subtilis )、Bacillus amyloliquefaciens CICC10160( Bacillus amyloliquefaciens )、Bacillus cereus CICC10451( Bacillus cereus )、Bacillus megaterium CICC10329( Bacillus megaterium )、Bacillus licheniformis CICC21963( Bacillus licheniformis )、Lactobacillus brevis CICC24450( Lactobacillus brevis )、Lactobacillus plantarum CICC20261( Lactobacillus plantarum )、Lactobacillus casei CICC6117( Lactobacillus casei )、Bifidobacterium longum CICC6069( Bifidobacterium longum )、Lactobacillus acidophilus CICC6074( Lactobacillus acidophilus )、Pediococcus pentosaceus CICC21862( Pediococcus pentosaceus )、Streptococcus thermophilus CICC6038( Streptococcus thermophilus ), Lactococcus lactis CICC6242 ( Lactococcus lactis )、Pantoea thermophila CICC24217( Pantoea calida )、Acinetobacter pitei CICC22934( Acinetobacter pittii )、Pseudomonas aeruginosa ATCC27853( Pseudomonas aeruginosa )、Escherichia coli CMCC44828( Escherichia coli ), Salmonella typhimurium ATCC14028 ( Salmonella typhimurium ), Shigella sonnei CMCC51592 ( Shigella sonnei )、Staphylococcus aureus ATCC13565( Staphylococcus aureus ).

[0065] 1. Prepare template solution Take the test bacterial solution (bacterial concentration is 10 5 CFU / mL), treated at 99℃ for 5min, terminated the reaction at 4℃, collected the supernatant, and obtained the template solution containing genomic DNA.

[0066] 2. Perform LAMP.

[0067] The reaction system is the same as in Example 2.

[0068] Reaction conditions: 65°C, 30 min. The reaction was carried out in a GenieⅡ real-time fluorescence detector.

[0069] Fluorescence amplification curves are shown in Figure 3 , the melting curve is shown in Figure 4Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus megaterium and Bacillus licheniformis were all positive. Other tested bacteria were all negative. The results showed that the specific primer set provided by the present invention has high specificity.

[0070] Example 5 The examples of the present invention investigated the sensitivity of the specific primer set of Example 1.

[0071] The test bacteria was Bacillus amyloliquefaciens CICC10160.

[0072] 1. Prepare template solution Take an appropriate amount of the test bacterial suspension, extract the genomic DNA of the bacterial suspension using a bacterial genomic DNA extraction kit, measure the DNA purity and concentration, and obtain an original DNA concentration of 10 1 ng / μL of template solution.

[0073] The original DNA was diluted 10-fold to obtain a DNA concentration of 10 1 ng / μL, 10 0 ng / μL, 10 2 pg / μL, 10 1 pg / μL, 10 0 pg / μL, 10 2 fg / μL template DNA solution.

[0074] 2. Perform LAMP The reaction system is the same as in Example 2.

[0075] Reaction conditions: 65°C, 30 min. The reaction was carried out in a GenieⅡ real-time fluorescence detector.

[0076] Fluorescence amplification curves are shown in Figure 5 . 10 2 pg / μL-10 1 ng / μL template DNA solution can generate a fluorescence amplification curve. The results show that after nucleic acid extraction, the detection sensitivity of the specific primer set provided by the present invention for Bacillus amyloliquefaciens is 10 2 pg / μL.

[0077] 3. Perform real-time fluorescence PCR Reaction system (20 μL): Template solution 2 μL, TB Green Fast qPCR Mix (2×) 10 μL, ROX Reference Dye (50×) 0.4 μL, Primer F3 and Primer B3, the balance is water. In the reaction system, the content of each primer is: Primer F3 8 pmol, Primer B3 8 pmol.

[0078] Reaction conditions: 50°C for 2 min; 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, 40 cycles. The reaction was performed in an ABI7900 real-time fluorescence detector, and amplification results with a Ct value of ≤40 were considered positive.

[0079] Fluorescence amplification curves are shown in Figure 6 . 10 0 ng / μL and 10 1 ng / μL template DNA solution can produce a fluorescence amplification curve with a detection sensitivity of 10 0 ng / μL.

[0080] The results show that, with the same nucleic acid extraction steps, the LAMP detection method of the present invention is 10 times more sensitive than real-time fluorescent PCR.

[0081] Example 6 The embodiment of the present invention provides a LAMP detection reagent for detecting Bacillus bacteria and a use method thereof.

[0082] Detection reagent: Isothermal Master Mix 7.5 μL, each primer of the specific primer set of Example 1, and the balance is water. In each 11 μL detection reagent, the content of each primer is: primer F3 2.5 pmol, primer B3 2.5 pmol, primer FIP 20 pmol, primer BIP 20 pmol, primer LB 10 pmol.

[0083] How to use the detection reagent: Take 11μL of the detection reagent, add 1.5μL of the genomic DNA or total DNA of the sample to be tested, and then perform the LAMP reaction. Reaction conditions: 65℃, 30min. Observe the fluorescence amplification curve.

[0084] Example 7 This embodiment provides a method for identifying or assisting in the identification of Bacillus bacteria.

[0085] 1. Extract the genomic DNA of the microorganism to be tested; 2. Using the genomic DNA extracted in step 1 as a template, add the detection reagent of Example 6 to perform loop-mediated isothermal amplification, and the template concentration in the reaction system is ≥10 2pg / μL. The reaction system of loop-mediated isothermal amplification is the same as that of Example 2, and the reaction conditions are: 65°C, 30 min. The reaction is carried out in a real-time fluorescence detector. According to the amplification result, it is judged whether the microorganism to be tested is a bacterium of the genus Bacillus: if specific amplification with the genomic DNA as a template can be achieved, that is, the fluorescence intensity increases significantly, then the microorganism to be tested is or is a candidate for a bacterium of the genus Bacillus; if specific amplification with the genomic DNA as a template cannot be achieved, that is, there is no obvious change in the fluorescence intensity, then the microorganism to be tested is or is a candidate for a non-Bacillus bacterium.

[0086] Example 8 This embodiment provides a method for detecting whether a sample to be tested contains Bacillus bacteria.

[0087] 1. Extract the total DNA of the sample to be tested; 2. Using the total DNA extracted in step 1 as a template, loop-mediated isothermal amplification was performed using the detection reagent of Example 6, and the template concentration in the reaction system was ≥10 2 pg / μL. The reaction system of loop-mediated isothermal amplification is the same as that of Example 2, and the reaction conditions are: 65°C, 30 min. The reaction is carried out in a real-time fluorescence detector. According to the amplification results, it is judged whether the sample to be tested contains Bacillus bacteria: if specific amplification with the total DNA as a template can be achieved, the sample to be tested contains or is suspected of containing Bacillus bacteria; if specific amplification with the total DNA as a template cannot be achieved, the sample to be tested does not contain or is suspected of not containing Bacillus bacteria.

[0088] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A specific primer set for identifying Bacillus bacteria, characterized in that: It consists of primer F3, primer B3, primer FIP, primer BIP and primer LB; The primer F3 is a single-stranded DNA molecule as shown in SEQ ID NO.2, or a DNA molecule obtained by replacing and / or deleting and / or adding one or more nucleotides of the single-stranded DNA molecule as shown in SEQ ID NO.2 and having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.2; The primer B3 is a single-stranded DNA molecule as shown in SEQ ID NO.3, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.3 after one or more nucleotides are replaced and / or deleted and / or added; The primer FIP is a single-stranded DNA molecule as shown in SEQ ID NO.4, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.4 after one or more nucleotides are replaced and / or deleted and / or added; The primer BIP is a single-stranded DNA molecule as shown in SEQ ID NO.5, or a DNA molecule having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.5 after one or more nucleotides are replaced and / or deleted and / or added; The primer LB is a single-stranded DNA molecule as shown in SEQ ID NO.6, or a DNA molecule obtained by replacing and / or deleting and / or adding one or more nucleotides of the single-stranded DNA molecule as shown in SEQ ID NO.6 and having the same function as the single-stranded DNA molecule as shown in SEQ ID NO.

6.

2. The specific primer set according to claim 1, characterized in that: The primer F3 is a single-stranded DNA molecule as shown in SEQ ID NO.2; and / or The primer B3 is a single-stranded DNA molecule as shown in SEQ ID NO.3; and / or The primer FIP is a single-stranded DNA molecule as shown in SEQ ID NO.4; and / or The primer BIP is a single-stranded DNA molecule as shown in SEQ ID NO.5; and / or The primer LB is a single-stranded DNA molecule as shown in SEQ ID NO.6; and / or The Bacillus bacteria include Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus megaterium, and Bacillus licheniformis.

3. The specific primer set according to claim 1 or 2, characterized in that: The molar ratios of the primer F3, primer B3, primer FIP, primer BIP and primer LB are 1:1:8:8:4, respectively.

4. Use of the specific primer set according to any one of claims 1 to 3 in the preparation of a specific reagent or a kit for identifying Bacillus bacteria.

5. A specific reagent for identifying Bacillus bacteria, characterized in that: The specific reagent is in liquid form and includes the following components: the specific primer set according to any one of claims 1 to 3, DNA polymerase, dNTPs, buffer, magnesium ions, fluorescent dye and water; the molar ratios of the primer F3, primer B3, primer FIP, primer BIP and primer LB are 1:1:8:8:4 respectively.

6. The specific reagent according to claim 5, characterized in that: The specific reagents include the above-mentioned specific primer set, Isothermal Master Mix and water.

7. A kit for identifying Bacillus bacteria, characterized in that: The kit comprises the following reagents: a primer solution of the specific primer set according to any one of claims 1 to 3, DNA polymerase, dNTPs, a buffer, magnesium ions and a fluorescent dye; or the kit comprises the specific reagent according to claim 5 or 6.

8. Use of the specific primer set according to any one of claims 1 to 3, the specific reagent according to claim 5 or 6, or the kit according to claim 7, comprising: Application in identifying or assisting in identifying Bacillus bacteria; Application in detecting whether a sample to be tested contains Bacillus bacteria.

9. A method for identifying or assisting in the identification of Bacillus bacteria, characterized in that: The specific steps include: S1. Extracting genomic DNA of the microorganism to be tested; S2. Using the genomic DNA extracted from S1 as a template, performing loop-mediated isothermal amplification using the specific primer set described in any one of claims 1 to 3, the specific reagent described in claim 5 or 6, or the kit described in claim 7; judging whether the microorganism to be tested is a Bacillus bacterium based on the amplification result.

10. A method for detecting whether a sample to be tested contains Bacillus bacteria, characterized in that: The specific steps include: SI, extract the total DNA of the sample to be tested; SII, using the total DNA extracted from SI as a template, performing loop-mediated isothermal amplification using the specific primer set described in any one of claims 1 to 3 or the specific reagent described in claim 5 or 6 or the kit described in claim 7; judging whether the sample to be tested contains Bacillus bacteria based on the amplification result.

Images