Application of palmitoyl transferase ZDHHC11 in preparation of medicine for treating osteoarthritis

Abstract

The invention discloses an application of palmitoyl transferase ZDHHC11 in preparation of a medicine for treating osteoarthritis. The ZDHHC11 is specifically combined with a substrate APOD to catalyze S-palmitoylation of the substrate APOD, so that an aging-related GATA4-P65 signal channel is inhibited, and the protection effect on aging cartilage cells is achieved. The improvement of the expression level of Zdhhc11 in vivo is beneficial to the regulation of extracellular matrix metabolism, the inhibition of cartilage cell senescence and the delay of osteoarthritis progress. According to the application, the ZDHHC11 is identified as a key palmitoyl transferase for the first time, the influence of the expression level of the ZDHHC11 on cartilage cell senescence and osteoarthritis phenotype is identified, a downstream molecular mechanism of delaying osteoarthritis progress by ZDHHC11-mediated S-palmitoyl acidification is clarified, and meanwhile, it is verified that the phenotype of osteoarthritis can be remarkably reversed by improving the expression level of Zdhhc11 in vivo.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of palmitoyltransferase ZDHHC11 in preparing a drug for treating osteoarthritis. Background Art

[0002] Typical pathological changes of osteoarthritis (OA) include cartilage degeneration, synovial inflammation, subchondral bone lesions, and secondary bone hyperplasia. It is a common and frequently occurring disease that causes joint pain and dysfunction, especially in the middle-aged and elderly population. The disease not only significantly reduces the patient's quality of life and labor capacity, but also constitutes a widespread social health problem, causing a huge socioeconomic burden and becoming one of the major diseases affecting public health. Given the global trend of population aging and the increasing obesity rate, the prevalence of osteoarthritis is expected to continue to rise. Although modern medicine has made some progress in the diagnosis and treatment of osteoarthritis, most of the current traditional treatments (including nonsteroidal anti-inflammatory drugs, intra-articular injection of steroids or hyaluronic acid, physical therapy, etc.) can only relieve symptoms and cannot effectively inhibit the progression of the disease. Some treatments may even be accompanied by some inevitable side effects, causing many patients with advanced osteoarthritis to choose artificial joint replacement surgery. However, joint replacement surgery is expensive, and may also be accompanied by surgical complications and anesthesia risks, and the postoperative recovery period is also long. In addition, the life span of joint replacement is limited, generally around 15-20 years, and some young patients may need a second or even multiple surgeries. Therefore, if we can intervene in the early stages of osteoarthritis or inhibit the degenerative progression of articular cartilage, it will significantly reduce the pain of osteoarthritis patients and improve their quality of life, which has great medical and social value. Therefore, in-depth research on the molecular mechanisms of the occurrence and development of osteoarthritis is crucial for the development of new osteoarthritis treatment and prognosis programs.

[0003] Recent studies have found that protein post-translational modifications (PTMs) affect inflammatory responses and cell metabolism in articular cartilage tissue, and thus participate in cartilage aging and osteoarthritis. Among them, lipid modification, as an important form of PTMs, has an important influence on the intracellular localization, transport, and stability of proteins, and also participates in protein-protein interactions. The most common and important protein lipid modification is S-palmitoylation, also known as protein palmitoylation, which refers to the reversible process in which palmitoyl groups are connected to cysteine ​​inside proteins through thioester bonds. S-palmitoylation modification is not only involved in a variety of cell functions and signal transduction including cell adhesion, growth, and division, but its abnormality is also closely related to cell aging and the progression of a variety of diseases. However, there are few reports on the pathogenesis of S-palmitoylation modification in osteoarthritis.

[0004] The palmitoyltransferase DHHC (Asp-His-His-Cys) family catalyzes the S-palmitoylation modification of protein substrates in cells. Its notable feature is that it has a cysteine-rich domain that contains a DHHC motif. Because this domain usually binds two Zn 2+ The DHHC family is also known as ZDHHC palmitoyltransferase. The human ZDHHC family has 23 members, including ZDHHC1 to ZDHHC9 and ZDHHC11 to ZDHHC24. Studies have shown that the ZDHHC11 protein is anchored to the endoplasmic reticulum (ER) of cells and has the functions of activating the NF-kB signaling pathway and participating in the immune response after infection, but its mechanism of regulating cartilage aging has not been reported. Therefore, future research work is expected to reveal the regulatory role and molecular mechanism of S-palmitoylation modification on the aging process of chondrocytes, as well as whether palmitoyltransferases including ZDHHC11 can become possible intervention targets for the treatment of osteoarthritis, thereby providing experimental basis and theoretical reference for the development of new early diagnostic markers and therapeutic targets for osteoarthritis.

[0005] At the same time, because viral vector-based gene therapy faces limitations including immunogenicity, nonspecific delivery, and packaging and manufacturing, the use of non-viral carrier lipid nanoparticles (LNPs) to deliver mRNA of key genes in disease development to articular cartilage has become an attractive treatment option for osteoarthritis. Currently, LNPs have been approved by the FDA for the delivery of RNA in drugs and clinical trials, and have broad application prospects in the medical field. However, targeted delivery of LNP-mRNA complexes to chondrocytes has not yet been achieved. Therefore, the development of a new LNPs technology for the treatment of osteoarthritis will not only help to break through the limitations of traditional gene therapy, but also is expected to bring revolutionary changes to gene therapy for osteoarthritis. Summary of the invention

[0006] The first object of the present invention is to provide the use of palmitoyltransferase ZDHHC11 in the preparation of drugs for treating osteoarthritis in view of the deficiencies in the prior art.

[0007] Preferably, the drug regulates the overexpression of palmitoyltransferase ZDHHC11 in chondrocytes.

[0008] Preferably, palmitoyltransferase ZDHHC11 plays a protective role on senescent chondrocytes by mediating S-palmitoylation of apolipoprotein D (APOD).

[0009] Preferably, S-palmitoylated APOD participates in the metabolism of extracellular matrix and the aging process of chondrocytes by inhibiting the GATA4-P65 signaling pathway, thereby delaying the progression of osteoarthritis.

[0010] Preferably, the active ingredient of the drug includes a gene (Gene1D: 79844) or mRNA (NM_001393492.1) encoding palmitoyltransferase ZDHHC11, which is introduced into chondrocytes via an adenovirus vector or lipid nanoparticles. The use of the drug in relevant animal models helps to increase the expression of Zdhhc11 in the animal model, thereby achieving the effect of delaying chondrocyte aging and improving the pathological phenotype of osteoarthritis.

[0011] Furthermore, the drug is injected in situ at the bone joint.

[0012] The adenovirus vector is an adeno-associated virus, and the lipid nanoparticles are obtained by fusion of chondrocyte affinity peptide and liposome.

[0013] The second purpose of the present application is to provide a drug for treating osteoarthritis, the active ingredients of which include the coding gene or mRNA of ZDHHC11, and a vector for introducing the drug into chondrocytes, wherein the vector is an adenovirus vector or lipid nanoparticles, and the drug is introduced into chondrocytes via the adenovirus vector or lipid nanoparticles.

[0014] Preferably, the adenovirus vector is an adeno-associated virus, and the lipid nanoparticles are obtained by fusion of chondrocyte affinity peptide and liposome.

[0015] Preferably, the active ingredient of the drug is injected in situ at the joint to achieve overexpression of ZDHHC11 in chondrocytes.

[0016] The third object of the present application is to provide a method for screening candidate compounds for treating osteoarthritis, the method comprising:

[0017] a) contacting a candidate compound with chondrocytes; b) using palmitoyltransferase ZDHHC11 as a marker to detect the expression level of palmitoyltransferase ZDHHC11 in chondrocytes after contact; c) selecting a candidate compound that can increase the expression level of palmitoyltransferase ZDHHC11 as a candidate compound for treating osteoarthritis.

[0018] Compared with the prior art, the present invention has at least the following advantages or beneficial effects:

[0019] The present invention identifies ZDHHC11 as a key palmitoyltransferase for the first time, and increasing its expression level helps to improve chondrocyte aging and osteoarthritis phenotypes, and clarifies the role of ZDHHC11-mediated substrate S-palmitoylation in the pathogenesis of osteoarthritis, specifically including regulating the synthesis and catabolism of chondrocyte extracellular matrix, inhibiting the process of cell aging, etc. The embodiments of the present invention provide experimental basis and theoretical reference for the development of new early diagnostic markers and therapeutic targets for osteoarthritis. At the same time, the present invention proposes to prepare selective cell-targeted LNPs by fusing CAPs with liposomes, and treat osteoarthritis by targeting chondrocytes in rat models. This not only helps to achieve the targeted delivery of LNP-mRNA complexes to chondrocytes for the first time, but also is expected to break through the limitations of viral vector-based gene therapy and provide new ideas for the targeted treatment of osteoarthritis.

[0020] At the mechanistic level, this paper first discovered that ZDHHC11 specifically binds to the substrate APOD, catalyzing its S-palmitoylation, thereby inhibiting the aging-related GATA4-P65 signaling pathway and exerting a protective effect on aging chondrocytes. Increasing the expression level of Zdhhc11 in vivo helps regulate extracellular matrix metabolism, inhibit chondrocyte aging, and delay the progression of osteoarthritis, suggesting that future research on targeted therapy for ZDHHC11 is expected to provide a potential new strategy for delaying the occurrence and development of early clinical osteoarthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 To study the dysregulation of palmitoylation modification in chondrocytes, the screening and identification of palmitoyltransferase ZDHHC11 were involved. A is the ABE palmitoylation assay to detect the level of total palmitoylation of substrate proteins in human chondrocytes treated with or without 200 μM H2O2 for 48 hours to simulate excessive oxidative stress; B is the real-time fluorescence quantitative PCR (RT-qPCR) to detect the heat map visualization of the expression levels of ZDHHC1-9 and ZDHHC11-25 in mouse chondrocytes treated with or without 200 μM H2O2 for 48 hours to simulate excessive oxidative stress (n=3 in each group), "ns" indicates P>0.05, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001; C is Southern blotting. Blot method was used to identify the expression of various types of palmitoyltransferase ZDHHC family in human and mouse chondrocytes; D is Western blot protein expression detection of ZDHHC11 and aging marker gene P53 in young and old human chondrocytes.

[0022] Figure 2 The results of immunohistochemical staining of the medial and lateral knee meniscus cartilage tissue in patients with osteoarthritis (scale bar, 100 μm).

[0023] Figure 3 Pearson correlation analysis between the fluorescence intensity of ZDHHC111 in articular cartilage tissue of patients with osteoarthritis and their KellgrenLawrence (KL) grade (n=5), P<0.05.

[0024] Figure 4The results are functional validation of ZDHHC11 knockdown in vitro, where A is RT-qPCR detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4)-related genes, senescence-related secretory phenotype (MMP3, IL-6), and senescence-related genes (P21, P53) in chondrocytes after ZDHHC11 knockdown (n=9); B is Western blot detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4)-related genes, senescence-related secretory phenotype (MMP3), senescence-related genes (P21, P53) and ZDHHC11 in chondrocytes after ZDHHC11 knockdown; C is Alcian blue staining detection of glycosaminoglycan deposition in chondrocytes after ZDHHC11 knockdown; D is β-galactosidase activity staining (SA-β-gal) detection of chondrocyte senescence after ZDHHC11 knockdown (scale bar, 50 μm).

[0025] Figure 5 Functional verification of in vitro overexpression of ZDHHC11, where A is RT-qPCR detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4)-related genes, senescence-related secretory phenotype (MMP3, IL-6), and senescence-related genes (P21, P53) in chondrocytes after ZDHHC11 overexpression (n=9); B is Western blot detection of the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4)-related genes, senescence-related secretory phenotype (MMP3), senescence-related genes (P21, P53) and ZDHHC11 in chondrocytes after ZDHHC11 overexpression; C is Alcian blue staining detection of glycosaminoglycan deposition in chondrocytes after ZDHHC11 overexpression; D is SA-β-gal staining detection of senescence of chondrocytes treated with H2O2 after ZDHHC11 overexpression (scale bar, 50 μm).

[0026] Figure 6 Micro-CT analysis of osteophyte formation in mice, where A is the Micro-CT images of wild-type sham group (n=6), Zdhhc11 knockout (Zdhhc11 cKO) sham group (n=6), Zdhhc11 cKO medial meniscus destabilization surgery (DMM) model group (n=6) and Zdhhc11 AAV-treated Zdhhcl1 cKO group (n=6) (scale bar, 2.5 mm); B is the quantitative analysis result of the number of osteophytes in each group of mice, "***" indicates P<0.001.

[0027] Figure 7This is the in vivo functional verification of ZDHHC11, where A is the results of safranin fast green staining and immunohistochemical staining of articular cartilage tissue of mice in the wild-type sham group, Zdhhc11 cKO-sham group, Zdhhc11 cKO-DMM group and Zdhhc11 AAV-treated Zdhhcl1 cKO group (scale bar, 50 μm); B is the quantitative cartilage damage score of articular cartilage pathological sections of each group based on the OARSI standard, and "***" indicates P < 0.001.

[0028] Figure 8 Figure 3 is the identification of ZDHHC11 as a substrate of palmitoyltransferase, where A is a schematic diagram of the intersection of immunoprecipitation mass spectrometry analysis results and osteoarthritis-related public databases GSE57218 and GSE185064, and candidate proteins (APOD, TF) interacting with ZDHHC11 were identified; B is the palmitoylation site prediction result of APOD and TF by CSS-palm 4.0 software, among which APOD (C185) had the highest score; C is the interaction result of ZDHHC11 and APOD C185 site predicted by computer simulation molecular docking analysis.

[0029] Fig. 9 To identify the exact site where ZDHHC11 catalyzes S-palmitoylation of the substrate, A is a schematic diagram of the conservation of the C185 palmitoylation modification site on APOD in different species; B is an ABE palmitoylation experiment to detect the palmitoylation level of APOD protein in wild-type (APOD-WT) and APOD C185 mutant (APOD-C185A) human chondrocytes.

[0030] Fig.10 To verify the effect of ZDHHC11 on S-palmitoylation of APOD, A is the ABE palmitoylation experiment to detect the effect of knocking down ZDHHC11 on the palmitoylation modification level of APOD in human chondrocytes; B is the ABE palmitoylation experiment to detect the effect of overexpression of ZDHHC11 on the palmitoylation modification level of APOD in human chondrocytes; C is the in vitro test result of palmitoyl acyl transferase (PAT) activity, reflecting whether ZDHHC11 can catalyze S-palmitoylation of APOD protein with C185 site mutation.

[0031] Fig.11Functional verification of APOD overexpression in vitro, where A is RT-qPCR detection of anabolism (SOX9, COL2A1), catabolism (ADAMTS4) related genes, aging-related secretory phenotype (MMP3, IL-6), aging-related genes (P21, P53) and APOD mRNA levels in human chondrocytes after overexpression of wild-type APOD (OE-APOD) and C185 site mutant APOD (OE-APOD-C185A) (n=3 in each group), "ns" indicates P>0.05, "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001, "*" indicates statistical significance between control and OE-APOD, and "#" indicates statistical significance between control and OE-APOD-C185A; B is Western Blot analysis was used to detect the expression of anabolism (SOX9, COL2A1), catabolism (ADAMTS4), aging-related secretory phenotype (MMP3), aging-related genes (P21, P53) and APOD in human chondrocytes of control, OE-APOD and OE-APOD-C185A; C was SA-β-gal staining to detect cell senescence of human chondrocytes of control, OE-APOD and OE-APOD-C185A after treatment with 200 μM H2O2 for 48 hours to simulate excessive oxidative stress conditions (scale bar, 50 μm); D was Alcian blue staining to detect glycosaminoglycan deposition in human chondrocytes of control, OE-APOD and OE-APOD-C185A.

[0032] Fig.12 To preliminarily explore the downstream molecules of S-palmitoylation of substrates catalyzed by ZDHHC11, A is a schematic diagram of the intersection of differentially expressed genes (|log2FC|>2.5) in transcriptome sequencing (RNA-seq) of human chondrocytes after knockdown of ZDHHC11 or APOD, from which three candidate downstream molecules were identified: GATA4, AFF2 and NANOS1; B is the mRNA levels of GATA4, AFF2 and NANOS1 in human chondrocytes detected by RT-qPCR control and after ZDHHC11 knockdown (n=3); C is the mRNA levels of GATA4, AFF2 and NANOS1 in human chondrocytes detected by RT-qPCR control and after APOD knockdown (n=3); D is a visualization result of the differences in osteoarthritis-related signaling pathways after ZDHHC11 or APOD knockdown determined by bioinformatics analysis, including the NF-κB signaling pathway.

[0033] Fig.13To preliminarily verify the downstream signaling pathway of ZDHHC11-mediated palmitoylation, A shows the GATA4 level in human chondrocytes with ZDHHC11 knockdown and RT-qPCR detection (n=9), "***" indicates P<0.001; B shows the GATA4 level in human chondrocytes with ZDHHC11 overexpression and RT-qPCR detection (n=9), "***" indicates P<0.001; C shows the protein expression levels of GATA4, p-P65, P65 and ZDHHC11 in human chondrocytes with ZDHHC11 knockdown and Western blot detection; D shows the protein expression levels of GATA4, p-P65, P65 and ZDHHC11 in human chondrocytes with ZDHHC11 overexpression and Western blot detection.

[0034] Fig.14 To further verify the GATA4-P65 signaling pathway downstream of ZDHHC111, A is a Western blot test to detect the effect of knocking down ZDHHC11 on P65 phosphorylation in human chondrocytes, and whether this effect can be reversed by silencing GATA4; B is a statistical graph of the results of immunofluorescence image re-quantification analysis of p-P65 after transfection of APOD siRNA, ZDHHC11 siRNA or (and) GATA4 siRNA in human chondrocytes (n=9), "***" indicates P<0.001.

[0035] Fig.15 To verify the relationship between the ZDHHC11-APOD-GATA4-P65 axis and the pathological phenotype of chondrocyte senescence and osteoarthritis, A was Western blot analysis to detect the protein expression levels of GATA4, P65 and p-P65 in young and aged human chondrocytes; B was Western blot analysis to detect whether in vitro supplementation of APOD could reverse the effects of ZDHHC11 knockdown on chondrocyte senescence and extracellular matrix (ECM) metabolism, specifically detecting the protein expression levels of GATA4, COL2A1, SOX9, ADAMTS4, MMP3, P53, P21 and ZDHHC11.

[0036] Fig.16The preparation, injection and characterization of selective chondrocyte-targeted LNPs, where A is a schematic diagram of the assembly of chondrocyte-targeted LNPs and Zdhhc11mRNA and intra-articular injection; B is a schematic diagram of the transmission electron microscopy (TEM) evaluation of the particle morphology of Zdhhc11mRNA@LNP and Zdhhc11 mRNA@LNP-CAP (scale bar, 100nm); C is the statistical results of the hydrodynamic diameters of various types of LNPs; D is the statistical results of the changes in the Zeta potential of various types of LNPs; E is the quantitative detection of the encapsulation efficiency (EE%) of mRNA@LNPs by the fluorescent RiboGreen method.

[0037] Fig.17 Western blot confirmed that the prepared LNPs could effectively enter human chondrocytes and be converted into functional proteins. The effects of treating human chondrocytes with various types of LNPs on the expression of COL2A1, ADAMTS4 and ZDHHC11 proteins were investigated.

[0038] Fig.18 Micro-CT analysis of osteophyte formation in rats, where A is the Micro-CT images of rats in the sham negative control group (n=6), DMM model group (n=6), LNP-treated DMM model (DMM+LNP) group (n=6), Zdhhc11 mRNA@LNP-treated DMM model (DMM+mRNA@LNP) group (n=6), and CAP-fused Zdhhc11 mRNA@LNP-treated DMM model (DMM+mRNA@LNP-CAP) group (n=6) (scale bar, 5 mm); B is the quantitative analysis result of the number of osteophytes in rats in each group, and "***" indicates P<0.001.

[0039] Fig.19 To verify the in vivo therapeutic effect of LNPs delivering ZDHHC11 mRNA, A shows the results of safranin fast green staining and immunohistochemical staining of Col2a1, Mmp3, and P21 of articular cartilage tissue in rats in sham group, DMM model group, DMM+LNP group, DMM+mRNA@LNP group, and DMM+mRNA@LNP-CAP group (scale bar, 50 μm); B shows the quantitative cartilage damage of articular cartilage pathological sections scored based on OARSI standards in each group, and "***" indicates P<0.001

[0040] Fig. 20This is the in vivo verification of the GATA4-P65 signaling pathway downstream of ZDHHC11, where A is the immunofluorescence images of Gata4 and p-P65 in the articular cartilage tissue of rats in the sham group, DMM model group, DMM+LNP group, DMM+mRNA@LNP group and DMM+mRNA@LNP-CAP group (scale bar, 50 μm); B is the quantitative statistical results of Gata4-positive cells in each group (n=6), "***" indicates P<0.001; C is the quantitative statistical results of p-P65-positive cells in each group (n=6), "***" indicates P<0.001. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the embodiments of the present invention will be described clearly and completely in conjunction with the specific embodiments below. If the specific conditions are not specified in the embodiments, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0042] An embodiment of the present invention provides an application of palmitoyltransferase ZDHHC11 in preparing a drug for treating osteoarthritis.

[0043] In some embodiments of the present invention, the above-mentioned ZDHHC11, as a key palmitoyltransferase, further inhibits the activation of the GATA4-P65 signaling pathway by specifically binding to the substrate APOD protein and catalyzing its S-palmitoylation, thereby regulating the metabolism of the extracellular matrix of chondrocytes and delaying the aging of chondrocytes.

[0044] In some embodiments of the present invention, the coding gene or mRNA of the above-mentioned Zdhhc11 is introduced into chondrocytes via adeno-associated virus (AAV) or lipid nanoparticles (LNP) as a vector to achieve overexpression in relevant animal models, thereby delaying chondrocyte aging and improving the pathological phenotype of osteoarthritis in vivo.

[0045] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0046] Example 1

[0047] This example is the research method and experimental means in the present invention

[0048] 1. Acquisition and processing of human articular cartilage tissue specimens

[0049] Knee cartilage samples were collected from patients with primary osteoarthritis after total knee replacement. Patients were divided into young group (≤65 years old) and elderly group (>65 years old) according to age, and some samples were divided into medial and lateral menisci. All samples were subsequently used to collect human chondrocytes and related histological experiments. The acquisition and processing of samples had obtained informed consent from patients and approval from the ethics committee.

[0050] 1. Immunohistochemistry

[0051] Articular cartilage tissue samples were fixed and decalcified. Antigen retrieval was performed after dewaxing of paraffin sections. The sections were treated with 3% H2O2, then blocked with 5% goat serum and incubated with primary antibodies overnight. The sections were incubated with the corresponding secondary antibody the next day, incubated with DAB color development solution for 1 minute, and finally stained with hematoxylin solution for 2 minutes. Images of articular cartilage tissue were taken under an optical microscope. For detailed operation steps, please refer to this reference: Shen S et al.circPDE4B prevents articular cartilagedegeneration and promotes repair by acting as a scaffold for RIC8A andMID1.Ann Rheum Dis.2021 Sep;80(9):1209-1219.

[0052] 2. Kellgren Lawrence (KL) classification

[0053] According to the clinical imaging findings (X-ray / CT / MRI) of the knee joints of patients with osteoarthritis, the severity of knee joint degeneration is assessed. From mild to severe, it is divided into: Grade 0 (normal knee joint), Grade I, Grade II, Grade III, and Grade IV. Grade 0 means: the knee joint X-ray is completely normal, with no signs of osteoarthritis. Grade I means: suspected osteophyte formation or suspected joint space narrowing. Grade II means: confirmed osteophyte formation with possible joint space narrowing and possible cyst formation. Grade III means: confirmed osteophyte formation with moderate joint space narrowing and bone cyst formation. Grade IV means: confirmed large osteophyte formation with severe joint space narrowing, subchondral sclerosis, and deformity.

[0054] 2. Construction and processing of animal models

[0055] 1. Animal acquisition and breeding

[0056] Male C57BL / 6 mice or SD rats were used in the experiment. All animals were kept in pathogen-free conditions, with the temperature maintained at around 25°C and the environment maintained with a 12-hour light / dark cycle. fl / flMice were purchased from Suzhou Saiye Biotechnology and were incubated with Aggrecan CreERT2 To induce the expression of Cre recombinase to achieve inducible knockout of Zdhhc11, 2-month-old male Zdhhc11 fl / fl 、Aggrecan CreERT2 The mice were intraperitoneally injected once a day for 5 consecutive days with tamoxifen (TAM, Sigma, USA) dissolved in corn oil at a dose of 100 μg / g (body weight).

[0057] 2. Destabilization of the medial meniscus (DMM) surgery

[0058] Male C57BL / 6 mice or SD rats were randomly divided into different groups (n=6). The animals were weighed on the day of surgery and anesthetized by intraperitoneal injection of 1% pentobarbital 50 mg / kg before surgery. After fixing the knee joint and disinfecting it, the medial side of the patellar ligament was incised with a scalpel blade to expose the joint cavity, and the fat pad between the femoral condyles was bluntly separated to expose the intercondylar area. The medial meniscus tibial ligament was cut with microsurgical scissors, then rinsed with sterile saline, and the skin incision was sutured. In the sham group, only the skin was incised and sutured directly, and the medial meniscus tibial ligament was not removed. After surgery, the animals were placed under an infrared warming lamp until they were fully awakened from anesthesia and returned to the cage, and ampicillin was subcutaneously injected at 20 mg / kg according to body weight to prevent infection, and buprenorphine was subcutaneously injected at 0.05 mg / kg according to body weight for analgesia at 0 and 4 hours after surgery.

[0059] 3. Treatment methods for animal treatment experiments

[0060] Zdhhc11 AAV was constructed by Shanghai Hanheng Biotechnology. In the mouse adeno-associated virus (AAV) treatment experiment, mice in the Zdhhc11AAV treatment group (cKO-DMM+Zdhhc11 AAV) received intra-articular injections of 10 μL two weeks after DMM modeling. In the lipid nanoparticle (LNPs) treatment experiment, 10-week-old rats were selected for intra-articular injections, once a week for 6 weeks, with an injection volume of 25 μL.

[0061] 4. Micro-CT and quantitative analysis

[0062] The knee joint samples of the animals were fixed in 4% paraformaldehyde for 48 hours, washed and stored in 70% ethanol. The samples were then scanned in a 17 mm scanning tube using high-resolution μCT (Skyscan 1072, Belgium) (scanning volume was 11 mm3, scanning conditions were current 180 mA, voltage 50000 V, and acquisition time was 5 minutes). After acquiring CT images, three-dimensional imaging reconstruction was performed by Skyscan software to observe the formation of osteophytes. The quantitative analysis of the number of osteophytes in each group of animals was performed using one-way analysis of variance, and GraphPad Prism was used to evaluate the significance of the data.

[0063] 5. Safranin Fast Green Dyeing

[0064] After the animal's knee joint was scanned by Micro-CT, it was decalcified with 12.5% ​​EDTA for one week, and then the tissue was dehydrated in ethanol and embedded in molten paraffin. All knee joint tissues were cut into 5μm thick sections under a microscope. The paraffin sections were dewaxed with xylene, rehydrated in gradient ethanol, and washed with PBS. The sections were then stained with 1% fast green for 5 minutes, immersed in 1% acetic acid for 5 seconds, and then stained with 1% safranin O solution for 10 minutes. After gradient ethanol dehydration, the sections were sealed with neutral resin, and images of articular cartilage tissue were taken under a microscope.

[0065] 6. Histological scoring

[0066] Articular cartilage sections were scored based on the Osteoarthritis Research Society International (OARSI) scoring criteria. The quantitative scores for cartilage damage were recorded as 0, 0.5, and 1 to 6 points. 0 points were completely normal articular cartilage; 0.5 points were a small part of the cartilage tissue staining was lost, but there was no structural change; 1 point was a small part of the joint surface wear and fibrosis under the cartilage surface, without chondrocytes or cartilage matrix loss; 2 points were vertical cracks extending downward to the bottom of the cartilage surface, and there was partial loss of cartilage surface matrix; 3 points were vertical cracks / lesions involving the calcified cartilage layer downward, and <25% of the articular surface was damaged; 4 points were vertical cracks / lesions involving the calcified cartilage downward, and 25% to 50% of the articular surface was damaged; 5 points were vertical cracks / lesions involving the calcified cartilage downward, and 50% to 75% of the articular surface was damaged; 6 points were vertical cracks / lesions involving the calcified cartilage downward, and >75% of the articular surface was damaged. Each sample was evaluated by three independent researchers who were blinded to the experimental design, and GraphPadPrism (version 8.0.1) was used to assess the significance of the data.

[0067] 3. Cell and Molecular Experiments

[0068] 1. Primary chondrocyte culture

[0069] Under sterile conditions, the obtained human knee articular cartilage samples were cut into small pieces and washed 3 times with PBS. Then digested in 0.2% type II collagenase (Sigma, USA) at 37°C overnight. Then take the supernatant, filter it with a 100-micron cell filter (Biosharp, China), and centrifuge it at 1000rpm for 5 minutes. Wash it with PBS 3 times, and finally culture it in a DMEM high-glucose medium supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2 incubator. When collecting mouse chondrocytes, 5-day-old C57BL / 6 mice were selected to obtain the articular cartilage of the mouse femoral head and femoral condyle. Other steps were like collecting human chondrocytes.

[0070] 2. Acyl-biotin exchange (ABE) palmitoylation experiment

[0071] The chondrocytes were mixed with lysis buffer for 30 minutes. The lysate was then sonicated and centrifuged. The supernatant was then blocked, cut, and biotin was added, and finally incubated with streptavidin magnetic beads. After incubation, the palmitoylation level of the protein was detected by Western blot. For detailed operation steps, please refer to this reference: Yao H et al. Inhibiting PD-L1palmitoylation enhances T-cell immune responses against tumours. Nat Biomed Eng. 2019Apr; 3(4): 306-317.

[0072] 3. Western blot

[0073] The cultured chondrocytes were placed on ice, gently scraped with a cell scraper, lysed with RIPA lysis buffer at 4°C for 1 hour, and denatured by boiling at 100°C for 5 minutes. The total protein samples of the cells were separated by polyacrylamide gel electrophoresis (SDS-PAGE), transferred to PVDF membranes, blocked with 5% skim milk at room temperature, and then incubated with the corresponding primary antibody at 4°C overnight. The next day, the cells were washed three times with TBST, and then incubated with HRP-conjugated secondary antibodies at room temperature for 1 hour. Finally, the binding of the antibodies was detected using chemiluminescent substrates (ECL) and chemiluminescent gel imaging systems (Bio-Rad, USA), and the bands were exposed for color development.

[0074] 4. RNA extraction and real-time quantitative PCR (RT-qPCR)

[0075] Total RNA was extracted from cells using the AG RNAex Pro kit (Aicore Biotech), and 500 ng of total RNA was reverse transcribed into cDNA using the PrimeScript RT kit (Aicore Biotech). qRT-PCR was performed using the SYBR Green PCR kit (Yisheng Biotech) on an ABI 7500 sequencing system (Applied Biosystems, USA). -△△CT Methods: β-Actin gene was used as an internal reference to calculate the mRNA expression level, and GraphPad Prism (version 8.0.1) was used to evaluate the significance of the data.

[0076] 5. Southern blot

[0077] Total cellular RNA was extracted from chondrocytes and cDNA was synthesized according to the above method. The expression of mRNA was analyzed by PCR using specific PCR primers of Blast-verified genes. The PCR amplification procedure was as follows: pre-denaturation at 95°C for 3 minutes, followed by 35 cycles (each cycle included denaturation at 95°C for 15 seconds), annealing at 60°C for 15 seconds, extension at 72°C for 5 seconds, and final extension at 72°C for 5 minutes. The PCR amplification products were separated by gel electrophoresis at 150V for 30 minutes in 1% to 1.5% TAE (Tris acetate EDTA buffer), stained with YeaRed nucleic acid dye (Yisheng Bio), and visualized on a chemiluminescence system (Bio-Rad, USA).

[0078] 6. Alcian blue staining

[0079] The chondrocytes were fixed with 4% paraformaldehyde solution for 30 minutes at room temperature and then washed three times with PBS. The chondrocytes were then incubated in 1% alcian blue solution (Sigma, USA) at room temperature for 1 hour, and images were randomly taken using a microscope (Olympus, Japan). Image J (version 1.5.3) was used to perform shift operations and quantitative analysis on the alcian blue original images under the same parameters.

[0080] 7. β-galactosidase activity staining method (SA-β-gal)

[0081] The SA-β-gal staining kit (Biyuntian Biotechnology) was selected and operated according to the instructions provided by the manufacturer to evaluate the level of senescence-related β-galactosidase in cells. The treated chondrocytes were fixed at room temperature for 30 minutes and then washed three times with PBS. The PBS was then discarded, and SA-β-gal staining solution (pH 6.0) was added and incubated at 37°C overnight. The images were observed and photographed using an ordinary optical microscope.

[0082] 8. Immunofluorescence staining

[0083] Use 4% paraformaldehyde to fix the chondrocytes for 15 minutes and wash 3 times with PBS. Then use 0.1% TritonX-100 to permeabilize the cells for 15 minutes and wash 3 times with PBS. Then put the chondrocytes in 5% goat serum for blocking at room temperature for 1 hour, and then add the corresponding primary antibody and incubate overnight at 4°C. Wash 3 times with PBS the next day, and then incubate with fluorescence-conjugated goat anti-rabbit IgG secondary antibody (Fude Bio) at room temperature for 1 hour. The cell nucleus was counterstained with DAPI for 5 minutes and then sealed. All images were imaged and taken under a fluorescence inverted microscope.

[0084] 9. Co-immunoprecipitation (Co-IP)

[0085] rProteinA / G MagBeads (Yisheng Bio) were selected and the manufacturer's instructions were followed. The treated cells were collected and mixed with RIPA buffer, and the supernatant was collected by centrifugation. Antibody adsorption was performed on the magnetic beads, and then the sample containing the antigen was added and placed in a flip mixer at 4°C overnight. The next day, the magnetic bead-antibody-antigen complex was magnetically separated and the supernatant was collected. The IP protein in the complex was released by protein thermal denaturation and detected by Western blot or mass spectrometry.

[0086] 10. In vitro detection of palmitoyltransferase (PAT) activity

[0087] Recombinant ZDHHC11 (Hangzhou Huaan Bio) and recombinant APOD (Hangzhou Huaan Bio) were mixed in 25 μL of reaction buffer for 1 hour at 25°C, and then biotin pyridinyl (concentration of 50 μM) was added to the mixture. The mixture was then loaded into a 30 kDa centrifugal filter column (Biyuntian Bio) to remove free biotin pyridinyl azide. Finally, the biotin-labeled protein was enriched by incubation with streptavidin magnetic beads (Biyuntian Bio). After incubation, the palmitoylated protein was released by protein thermal denaturation and detected by Western blot.

[0088] 11. Chondrocyte siRNA transfection

[0089] Customized APOD siRNA, ZDHHC11 siRNA, and GATA4 siRNA were synthesized by Shanghai Genetics to knock down specific mRNAs. Lipofectamine RNAi MAX transfection reagent (Invitrogen, USA) was used at 1 μl / 10 5Cells were transfected into chondrocytes, the medium was changed 8 hours after transfection, and cell RNA and protein were extracted 48 hours later. Table 1 lists all the siRNA sequences required for the experiment. The 2 bases at the 3' end of the sequence were replaced with protruding TT to enhance the stability of the siRNA double-stranded complex, thereby increasing the knockdown efficiency of siRNA.

[0090] Table 1

[0091] si-APOD#1(Human) GUACCUGCAUCAUCCAACU si-APOD#2(Human) GGAAAGAUCAAAGUGUUAA si-ZDHHC11#1(Human) CCAGAAGCCAUACUCAAUAA si-ZDHHC11#2(Human) CCAGAAGCCAUACUCAAUA si-GATA4(Human) CAGAGAGUGUGUCAACUGU

[0092] 12. Gene overexpression and adeno-associated virus infection

[0093] APOD and APOD-C185A overexpression plasmids were provided by Beijing Qingke Biotechnology, and ZDHHC11 overexpression plasmids were provided by Wuhan Miaoling Biotechnology. One day before transfection, HEK293 cells were inoculated in a 10 cm culture dish with a surface pretreatment at a density of 70%-80%, and the culture medium was discarded and replaced 1 hour in advance. After extracting the plasmids, the auxiliary plasmids (pMD2.G and psPAX2) were co-transfected into HEK293 cells with Opti-MEM culture medium containing Lipofectamine 3000 (Invitrogen, USA). After incubation for 6 hours, the culture medium was discarded and the medium was replaced. 24 hours after the medium change, the virus was collected and the culture medium was replaced. After 48 hours, the virus was collected again and stored at 4°C, centrifuged at 4°C and 3000rpm for 15 minutes, and the supernatant was taken to a 0.45μm filter (Millipore, Billerica, MA, USA) to purify the culture medium. Human primary chondrocytes in good growth state were infected with a virus containing polybrene, and the final concentration of polybrene was 10 μg / mL. After mixing, they were placed in an incubator and cultured for 24 hours, and then the medium was changed. The overexpression efficiency was verified by RT-qPCR.

[0094] 4. Computer simulation of molecular docking analysis

[0095] The molecular docking program HADDOCK (version 2.4) was used, which is an information-driven flexible molecular docking method for modeling biomolecular complexes. HADDOCK combines a variety of experimental and / or bioinformatics data to drive modeling, can flexibly handle complex molecular conformations, and focus the search on the spatial part of intermolecular interactions. Finally, PyMOL (version 3.0.3) was used for data analysis and drawing operations.

[0096] 5. Preparation and Characterization of mRNA-LNPs

[0097] Lipid nanoparticles (LNPs) were formulated using ionizable lipids, including SM-102, DSPE-PEG-MAL, DSPC, and cholesterol, with a molar ratio of 50:1.5:10:38.5. 25 μL of mRNA (1000 ng / μL) was dissolved in 50 μL of Tris buffer (20 mM) at pH 4.0 and then mixed with lipids dissolved in ethanol in a microfluidic device for 1 minute, maintaining a volume ratio of mRNA to lipid of 3:1. The mixture was then incubated at room temperature for 15 minutes, and 1.5 volumes of 1× PBS solution were added to further reduce the ethanol concentration.

[0098] Nanoparticles were obtained by filtering with a 0.22 μm filter and stored at 4 °C for subsequent use. Images were taken using transmission electron microscopy (TEM). The hydrodynamic diameter and zeta potential of LNPs were measured using a Zetasizer Nano ZS90 (Malvern Instruments, Malvern, UK). TM RiboGreen RNA assay(Invitrogen TM , USA) to determine the mRNA encapsulation efficiency.

[0099] 6. Results

[0100] 1. Screening and identification of palmitoyltransferase ZDHHC11

[0101] Figure 1 A shows that under the condition of excessive oxidative stress in chondrocytes, the palmitoylation level of total intracellular substrate protein is significantly reduced, proving that palmitoylation modification is dysregulated in chondrocytes. Figure 1 B shows that under this condition, the mRNA expression level of palmitoyltransferase ZDHHC11 was significantly downregulated. The expression of various palmitoyltransferase ZDHHC families known to humans and mice was identified by Southern blot. Among them, the five common palmitoyltransferases ZDHHC5, ZDHHC11, ZDHHC13, ZDHHC20, and ZDHHC21 all showed relatively consistent high abundance changes ( Figure 1 C). Western blot analysis revealed that the protein expression of ZDHHCl1 was lower in aged human chondrocytes (P4 generation) compared with that in young human chondrocytes (P0 generation), while the expression of the aging marker gene P53 was higher.

[0102] 2. Exploring the clinical relevance of palmitoyltransferase ZDHHC11

[0103] Immunohistochemical staining of the medial and lateral knee meniscus cartilage tissues of young (≤65 years old) and elderly (>65 years old) osteoarthritis patients was performed. Figure 2 As shown, the level of ZDHHC11-positive cells in the lateral meniscus of young osteoarthritis patients was higher.

[0104] Pearson correlation analysis between the fluorescence intensity of ZDHHC11 and its Kellgren Lawrence (KL) grade is shown in Figure 3 As shown, there was a negative correlation between the fluorescence intensity of ZDHHC11 and the KL grade, indicating that ZDHHC11 may be an indicator of disease severity in patients with osteoarthritis, and P < 0.05 between the two groups was statistically significant.

[0105] 3. Exploring the functional verification of palmitoyltransferase ZDHHC11 in vitro

[0106] To explore the effect of ZDHHC11 on the progression of age-related osteoarthritis, ZDHHC11 siRNA was transfected into primary human chondrocytes to verify the function of ZDHHC11 knockdown in vitro. The results of RT-qPCR showed that compared with the control group, after ZDHHC11 knockdown, the expression of ECM anabolism-related genes (COL2A1, SOX9) decreased, the expression of ECM catabolism-related genes (ADAMTS4) increased, the expression of SASPs markers (MMP3, IL-6) increased, and the expression of cell senescence-related genes (P53, P21) increased ( Figure 4 A). Western blot experiments also showed similar results ( Figure 4 B) Figure 4 As shown in C, knockdown of the ZDHHC11 gene leads to a decrease in the deposition of ECM in chondrocytes. In addition, the positive area of ​​SA-β-gal staining in human chondrocytes increased after ZDHHC11 knockdown, indicating that knockdown of the ZDHHC11 gene can significantly induce cell senescence ( Figure 4 D).

[0107] To verify the above results, the function of ZDHHC11 overexpression in vitro was verified, as shown in Figure 5 Compared with the control group, after ZDHHC11 overexpression, the expression of ECM anabolism-related genes (COL2A1, SOX9) increased, the expression of ECM catabolism-related genes (ADAMTS4) decreased, the expression of SASPs markers (MMP3, IL-6) decreased, and the expression of cell senescence-related genes (P53, P21) decreased ( Figure 5 A). Western blot experiments also showed similar results ( Figure 5 B) Figure 5As shown in C, overexpression of the ZDHHC11 gene led to increased ECM deposition in chondrocytes. In addition, after H2O2 treatment, the positive area of ​​SA-β-gal staining in human chondrocytes overexpressing ZDHHC11 decreased, indicating that overexpression of the ZDHHC11 gene inhibited chondrocyte senescence ( Figure 5 D).

[0108] 4. Verify that Zdhhc11 can improve the pathological phenotype of osteoarthritis in mice

[0109] To further investigate the effects of ZDHHC11 on osteoarthritis and aging phenotypes in vivo, 2-month-old Zdhhc11 cKO male C57BL / 6J mice underwent DMM surgery, and Zdhhc11 AAV was injected intra-articularly 2 weeks after surgery. The mice were killed 8 weeks after surgery and articular cartilage samples were collected. Micro-CT analysis of osteophyte formation in mice Figure 6 As shown, compared with the Zdhhc11 cKO-sham group, the number of osteophytes in mice after DMM surgery increased significantly, while supplementation of Zdhhc11 effectively delayed the degradation of cartilage and significantly reduced the number of osteophytes, indicating that increasing the expression level of Zdhhc11 in mice can help reverse the severity of osteoarthritis.

[0110] like Figure 7 As shown in A, the articular cartilage tissues of the above four groups of mice were stained with safranin fast green. The results showed that the cartilage of the joint sections of the Zdhhc11 cKO group mice after DMM surgery was significantly damaged. After the injection of Zdhhc11 AAV, the degree of damage to the articular cartilage tissue of the Zdhhc11 cKO group mice was significantly reduced. The molecular indicators of osteoarthritis were evaluated by immunohistochemical staining. The results showed that after DMM surgery, the expression of Col2a1 related to ECM anabolism decreased, the expression of SASPs markers (Mmp3, Il-6) increased, and the expression of cell senescence-related gene P21 increased. After supplementation with Zdhhc11, cell senescence and osteoarthritis-related phenotypes were significantly reduced. The results of the articular cartilage pathological section scoring of each group of mice based on the OARSI standard showed that Zdhhc11 could significantly reduce the manifestations of osteoarthritis in mice ( Figure 7 B).

[0111] 5. Explore the substrates and action sites of palmitoyltransferase ZDHHC11

[0112] Immunoprecipitation mass spectrometry (IP-MS) was performed in human chondrocytes overexpressing Zdhhc11. Figure 8As shown in A, the IP-MS analysis results were intersected with the public databases GSE57218 and GSE185064 (|log2FC|>1.5), and two candidate proteins that may interact with ZDHHC11 were identified: APOD and TF. Given that ZDHHC11 is a known palmitoyltransferase, it is speculated that the proteins interacting with it may have undergone palmitoylation. Therefore, CSS-palm 4.0 software was used to predict the palmitoylation sites of the candidate substrate proteins APOD and TF. The results are shown in Figure 8 As shown in Figure B, APOD (C185) scored the highest. The computer-simulated molecular docking analysis further proved that there was an interaction between ZDHHC11 and the C185 site of APOD ( Figure 8 C).

[0113] In order to identify the exact site of S-palmitoylation of substrates catalyzed by ZDHHC11, Fig. 9 As shown in A, the C185 palmitoylation modification site of APOD proteins in different species is highly conserved. ABE palmitoylation experiments further verified that, compared with APOD-WT, APOD proteins with mutations at the C185 site could not be palmitoylated ( Fig. 9 B).

[0114] In order to verify the effect of ZDHHC11 on the palmitoylation of APOD, the palmitoylation level of APOD before and after ZDHHC11 knockdown was compared by ABE palmitoylation assay. Fig.10 As shown in A, ZDHHC11 knockdown significantly reduced the palmitoylation status of APOD. However, overexpression of ZDHHC11 was able to reverse this effect ( Fig.10 B). The results of in vitro PAT assay showed that ZDHHC11 could catalyze the palmitoylation of APOD-WT, but could not catalyze the palmitoylation of APOD protein with C185 mutation ( Fig.10 C).

[0115] 6. Verify the function of APOD protein, a substrate of ZDHHC11

[0116] Functional verification was performed by overexpressing APOD in vitro. RT-qPCR results showed that after APOD overexpression, the expression of ECM anabolism-related genes (COL2A1, SOX9) increased, the expression of ECM catabolism-related genes (ADAMTS4) decreased, the expression of SASPs markers (MMP3, IL-6) decreased, and the expression of cell senescence-related genes (P53, P21) decreased. On the contrary, overexpression of APOD mutant (APOD-C185A) exacerbated cell senescence and osteoarthritis phenotypes ( Fig.11 A). Western blot experiments also showed similar results ( Fig.11B). In addition, SA-β-Gal staining ( Fig.11 C) and Alcian blue staining ( Fig.11 D) It was confirmed that overexpression of APOD can promote ECM deposition and inhibit chondrocyte senescence, while overexpression of APOD-C185A has the opposite effect.

[0117] 7. Verify that ZDHHC11 mediates the palmitoylation process by inhibiting the aging-related GATA4-P65 signaling pathway.

[0118] To further explore the downstream molecules of S-palmitoylation of substrates catalyzed by ZDHHC11, ZDHHC11 or APOD were selectively knocked down in human chondrocytes, and RNA-seq was performed to evaluate the changes in downstream genes. The intersection diagram of the differentially expressed genes (|log2FC|>2.5) is shown in Figure 2. Fig.12 As shown in A, three candidate downstream molecules were identified: GATA4, AFF2 and NANOS1. RT-qPCR further validation showed that in ZDHHC11 ( Fig.12 B) or APOD( Fig.12 C) After knockdown, only the expression of GATA4 showed sustained changes. Previous studies have shown that GATA4 plays an important role in the process of cell aging. In aged cells, GATA4 expression increases, thereby activating the NF-κB signaling pathway to regulate inflammatory responses. In this process, GATA4 may interact with other transcription factors or signaling molecules to jointly regulate the activity of NF-κB. Fig.12 As shown in Figure D, several pathways related to osteoarthritis were identified by bioinformatics methods, including the NF-κB signaling pathway.

[0119] The downstream signaling pathway of ZDHHC11-mediated palmitoylation was preliminarily verified. RT-qPCR results showed that knocking down ZDHHC11 in human chondrocytes significantly increased the expression of GATA4 ( Fig.13 A), while overexpression of ZDHHC11 significantly decreased GATA4 expression in chondrocytes ( Fig.13 B). Western blot results showed that knockdown of ZDHHC11 in human chondrocytes significantly increased the expression of GATA4 and the phosphorylation level of P65 ( Fig.13 C), while overexpression of ZDHHC11 produced the opposite result ( Fig.13 D).

[0120] Further verification of the GATA4-P65 signaling pathway downstream of ZDHHC11. Fig.14As shown in A, Western blot analysis found that knockdown of ZDHHC11 promoted the phosphorylation of P65, but this effect was eliminated by GATA4 silencing. The same conclusion was also reached by quantitative analysis of p-P65 ( Fig.14 B).

[0121] Verify the relationship between the ZDHHC11-APOD-GATA4-P65 axis and chondrocyte aging and osteoarthritis pathological phenotype. Western blot results showed that the expression levels of GATA4 and p-P65 increased significantly with age ( Fig.15 A) At the same time Fig.15 As shown in B, in vitro supplementation of APOD can reverse the effects of ZDHHC11 knockdown on chondrocyte senescence and ECM metabolism.

[0122] 8. Effects of Zdhhc11 mRNA@LNP on articular cartilage degeneration and osteoarthritis pathological phenotype

[0123] Studies have shown that chondrocyte affinity peptides (CAPs) are peptides that have been studied and designed for chondrocyte targeting. This peptide sequence can achieve targeted delivery of drugs, genes or nanomaterials to chondrocytes by binding to specific molecules or receptors in cartilage tissue, and is used to treat cartilage degeneration, arthritis or cartilage damage and other related diseases. Therefore, selective chondrocyte-targeted LNPs were prepared by fusing CAPs and liposomes to improve the osteoarthritis phenotype in rats.

[0124] like Fig.16 As shown in the figure, the particle morphology of Zdhhc11 mRNA@LNP and Zdhhc11 mRNA@LNP-CAP was evaluated by TEM. Both showed a nearly spherical morphology, but compared with mRNA@LNPs, the diameter of LNPs fused with CAPs was larger and the Zeta potential was closer to 0mV. The encapsulation efficiency (EE%) of mRNA@LNPs was quantitatively detected by the fluorescent RiboGreen method. The average encapsulation efficiency was 95.7%, while the average encapsulation efficiency of mRNA@LNP-CAP was about 50%. Fig.17 As shown, Western blot results further confirmed that the prepared LNPs could effectively enter primary chondrocytes and be converted into the functional protein ZDHHC11.

[0125] Micro-CT images were collected to evaluate the osteophyte formation in rats, such as Fig.18As shown, the number of osteophytes generated in rats injected intra-articularly with Zdhhc11mRNA@LNP or Zdhhc11 mRNA@LNP-CAP was significantly lower than that in other groups, and the effect of the DMM+mRNA@LNP-CAP group was particularly obvious, indicating that Zdhhc11 mRNA@LNP or Zdhhc11mRNA@LNP-CAP can significantly alleviate the pathological phenotype of osteoarthritis induced by DMM surgery.

[0126] Furthermore, the in vivo therapeutic effects of Zdhhc11mRNA@LNP and Zdhhc11 mRNA@LNP-CAP were verified by safranin fast green staining of rat articular cartilage tissue and immunohistochemical staining of Col2a1, Mmp3, and P21. Fig.19 As shown in A, the cartilage degeneration of rats was significantly alleviated after treatment, while the expression of Col2a1 was upregulated and the expression level of Mmp3 was reduced, indicating that the ECM decomposition process of chondrocytes was inhibited, while the anabolism process was enhanced. After treatment, the expression of cell senescence marker P21 was reduced, further supporting the anti-cell senescence effect of mRNA@LNP. Fig.19 As shown in B, after intra-articular injection of Zdhhc11mRNA@LNP or Zdhhc11 mRNA@LNP-CAP, the OARSI score of articular cartilage pathological sections was significantly reduced.

[0127] The GATA4-P65 signaling pathway downstream of ZDHHC11 was verified in vivo. Fig. 20 As shown, the number of Gata4-positive cells and p-P65-positive cells in rats with DMM-induced osteoarthritis was significantly decreased after treatment with Zdhhc11 mRNA@LNP, indicating that Zdhhc11 can significantly inhibit the GATA4-P65 signaling pathway in vivo.

Claims

1. Application of palmitoyltransferase ZDHHC11 in the preparation of drugs for the treatment of osteoarthritis.

2. The use according to claim 1, characterized in that: The drug regulates the overexpression of palmitoyltransferase ZDHHC11 in chondrocytes.

3. The use according to claim 1, characterized in that: The active ingredient of the drug includes a gene or mRNA encoding palmitoyl transferase ZDHHC 11, which is introduced into chondrocytes via an adenovirus vector or lipid nanoparticles.

4. The use according to claim 3, characterized in that: The drug is injected in situ at the bone joint.

5. The use according to claim 3, characterized in that: The adenovirus vector is an adeno-associated virus, and the lipid nanoparticles are obtained by fusion of chondrocyte affinity peptide and liposome.

6. A drug for treating osteoarthritis, characterized in that: The effective component of the pharmaceutical composition includes a gene or mRNA encoding palmitoyltransferase ZDHHC11.

7. The drug for treating osteoarthritis according to claim 6, characterized in that: The invention also comprises a carrier for introducing the drug into chondrocytes, wherein the carrier is an adenovirus vector or a lipid nanoparticle.

8. The drug for treating osteoarthritis according to claim 7, characterized in that: The adenovirus vector is an adeno-associated virus, and the lipid nanoparticles are obtained by fusion of chondrocyte affinity peptide and liposome.

9. A method for screening candidate compounds for treating osteoarthritis, characterized in that: The method comprises: a) contacting a candidate compound with chondrocytes; b) Using palmitoyltransferase ZDHHC11 as a marker, the expression level of palmitoyltransferase ZDHHC11 in chondrocytes after contact was detected; c) selecting candidate compounds that can increase the expression level of palmitoyltransferase ZDHHC11 as candidate compounds for treating osteoarthritis.

Images