Preparation method of virus-like particles for displaying scFv antibody as well as product and application of virus-like particles

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a preparation method of viroid particles displaying scFv antibodies, a product of the viroid particles and application of the viroid particles. The preparation method provided by the invention comprises the following steps: constructing a specific targeting recombinant plasmid, wherein the specific targeting recombinant plasmid is obtained by connecting a vector for expressing virus capsid protein and a coding gene for expressing an scFv antibody display structure through homologous recombination. The vector for expressing the virus capsid protein comprises a coding gene of VSV-G signal peptide, a transmembrane region and an intracellular region, and is as shown in SEQ ID NO. 2. And the coding gene for expressing the scFv antibody display structure is shown as SEQ ID NO. 3-5. According to the preparation method disclosed by the invention, the virus-like particles of which the capsid is a modular component of a specific targeting immune cell are constructed based on a lentivirus system, and 50-90% of infection efficiency can be realized in the immune cell.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a method for preparing virus-like particles displaying scFv antibodies, and a product and application thereof. Background Art

[0002] Single chain antibody (scFv) is an antibody composed of the variable region of the heavy chain (VH) and the variable region of the light chain (VL) of the antibody connected by a short peptide (linker) of 15-20 amino acids. The molecular weight of scFv is relatively small, which enables scFv to penetrate tissue and cell barriers more effectively and approach immune cells more easily, thereby increasing the chance of binding to antigens on the surface of immune cells. In tumor tissue, the smaller size of scFv helps it pass through the tumor blood vessel wall and extracellular matrix to reach tumor-infiltrating immune cells to exert its effect. In addition, scFv retains the antigen binding site of the complete antibody, can accurately identify specific antigens on the surface of immune cells, and has a high degree of specificity. This specificity can reduce nonspecific binding to other normal cells and reduce side effects. For example, in the treatment of autoimmune diseases, overactivated immune cell subsets can be specifically targeted without affecting other normal immune function cells.

[0003] However, scFv is composed only of heavy chain and light chain variable regions, lacking the auxiliary and synergistic effects of other parts of the complete antibody on binding. The affinity of single-chain antibodies for antigens is usually lower than that of complete antibodies. This may lead to low binding efficiency of single-chain antibodies when the expression of antigens on the surface of immune cells is low or the antigen-antibody interaction is weak, affecting the infection effect on immune cells. On the other hand, scFv has a short half-life in the body and will be cleared quickly. This means that more frequent administration or higher doses are required to maintain an effective concentration, increasing treatment costs and possible risks of adverse reactions.

[0004] Virus-like particles do not contain viral genetic material, which is their key advantage. Using VLP as an antigen carrier in vaccine development allows the human immune system to come into contact with virus-like antigen structures, while avoiding the risk of infection that may be caused by live virus vaccines, greatly improving the safety of vaccines. Virus-like particles can utilize the natural mechanism of viral infection of cells and specifically bind to receptors on the cell surface to accurately deliver the drugs or other bioactive molecules they carry to immune cells, thereby achieving targeted treatment or immunomodulation of immune cells. It can be seen that virus-like particles have potential targeted delivery functions. Providing a virus-like particle with efficient infection ability that can effectively display scFv antibodies is of great significance in the field of tumor immunotherapy. Summary of the invention

[0005] In view of the above-mentioned deficiencies, the present invention provides a method for preparing virus-like particles displaying scFv antibodies, and its products and applications. The preparation method provided by the present invention includes constructing a specific targeting recombinant plasmid, and the specific targeting recombinant plasmid is obtained by connecting a vector expressing a viral capsid protein and a coding gene expressing a scFv antibody display structure through homologous recombination. The vector expressing the viral capsid protein contains a coding gene for a VSV-G signal peptide-transmembrane region-intracellular region, as shown in SEQ ID NO.2. The coding gene for expressing the scFv antibody display structure is shown in SEQ ID NO.3-5. The preparation method of the present invention constructs virus-like particles with modular components whose capsids are specifically targeted to immune cells based on a lentiviral system, and can achieve an infection efficiency of 50%-90% in immune cells.

[0006] The technical solution of the present invention includes:

[0007] In a first aspect, the present invention provides a method for preparing virus-like particles displaying scFv antibodies, the preparation method comprising constructing a recombinant plasmid, wherein the recombinant plasmid is obtained by connecting a vector expressing a viral capsid protein and a coding gene expressing a scFv antibody display structure through homologous recombination.

[0008] Specifically, the vector expressing the viral capsid protein comprises a gene encoding a VSV-G signal peptide-transmembrane region-intracellular region.

[0009] Preferably, the gene encoding the VSV-G signal peptide-transmembrane region-intracellular region is as shown in SEQ ID NO.2.

[0010] Specifically, the scFv antibodies include: one or more of anti-CD3, anti-CD19, anti-CD56, anti-CD4, anti-CD5, anti-CD7, anti-CD8, anti-CD11a, anti-CD11b, anti-CD13, anti-CD14, anti-CD16, anti-CD20, anti-CD21, anti-CD22, anti-CD23, anti-CD25, anti-CD26, anti-CD28, anti-CD31, anti-CD33, anti-CD34, anti-CD38, anti-CD40, anti-CD44, and anti-CD45 scFv antibodies.

[0011] Preferably, the scFv antibody is selected from one or more of anti-CD3, anti-CD19, and anti-CD56 scFv antibodies.

[0012] Preferably, the coding gene for expressing the scFv antibody display structure has a nucleotide sequence as shown in SEQ ID NO.3-5.

[0013] Specifically, the method for constructing the specific targeting recombinant plasmid comprises the following steps:

[0014] S1, digesting the vector with a restriction endonuclease to obtain a linearized vector 1, and connecting the linearized vector with the sequence shown in SEQ ID NO: 2 by homologous recombination to obtain plasmid 1;

[0015] S2. Use restriction endonuclease to digest plasmid 1 to obtain linearized vector 2, and connect the linearized vector 2 to the sequence shown in any one of SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5 through homologous recombination to obtain specifically targeted recombinant plasmid 2, recombinant plasmid 3 or recombinant plasmid 4.

[0016] Specifically, the vector 1 described in step S1 includes pcDNA3.1+, psPAX2, pET-28a, pEZZ18, pTA1529, pINIII-ompA, pUB110, pE194, pUCX05-bgaB, pHT304, pMK3, pPIC9 or pPIC9K.

[0017] Preferably, the vector 1 in step S1 is pcDNA3.1+.

[0018] Specifically, the restriction endonuclease described in step S1 and / or S2 includes one or more of NcoⅠ restriction endonuclease, BamHI restriction endonuclease, EcoRI restriction endonuclease, PacI restriction endonuclease, ClaI restriction endonuclease, HindⅢ restriction endonuclease, and KpnⅠ restriction endonuclease.

[0019] Preferably, the restriction endonuclease in step S1 is BamHI restriction endonuclease and EcoRI restriction endonuclease.

[0020] Preferably, the restriction endonuclease described in step S2 is PacI restriction endonuclease and ClaI restriction endonuclease.

[0021] Specifically, the preparation method further comprises:

[0022] (1) ligating the linearized vector with the coding sequence shown in SEQ ID NO.1 to obtain plasmid 5;

[0023] (2) recombinant plasmid 2, recombinant plasmid 3 or recombinant plasmid 4 are mixed with plasmid 5, respectively, and 1×PEI is added to obtain a transfection mixture, the transfection mixture is transfected into cells, and the supernatant of the cell culture medium is collected and purified to obtain virus-like particles 1, virus-like particles 2 or virus-like particles 3.

[0024] More specifically, the vector described in step (1) includes pcDNA3.1+, psPAX2, pET-28a, pEZZ18, pTA1529, pINIII-ompA, pUB110, pE194, pUCX05-bgaB, pHT304, pMK3, pPIC9 or pPIC9K.

[0025] Preferably, the vector described in step (1) is psPAX2.

[0026] Preferably, the linearized vector described in step (1) is obtained by PCR.

[0027] Preferably, the mass ratio of the recombinant plasmid described in step (2) to plasmid 2 is 2:4.5.

[0028] Preferably, the cell described in step (2) is HEK293T.

[0029] In a second aspect, the present invention provides virus-like particles prepared by the above-mentioned preparation method.

[0030] In a third aspect, the present invention provides a cell comprising the above virus-like particle.

[0031] Preferably, the cells comprise immune cells.

[0032] Further preferably, the cells include one or more of T cells, B cells, and NK cells.

[0033] In a fourth aspect, the present invention provides the use of the above-mentioned virus particles or cells in the preparation of anti-tumor drugs.

[0034] In a fifth aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned virus particles or cells.

[0035] In a sixth aspect, the present invention provides a vaccine comprising the above-mentioned virus particles or cells.

[0036] The beneficial effects of the present invention are:

[0037] The preparation method provided by the present invention includes constructing a specific targeting recombinant plasmid, wherein the specific targeting recombinant plasmid is obtained by connecting a vector expressing a viral capsid protein and a coding gene expressing a scFv antibody display structure through homologous recombination. The vector expressing the viral capsid protein comprises a coding gene for a VSV-G signal peptide-transmembrane region-intracellular region, as shown in SEQ ID NO.2. The coding gene for expressing the scFv antibody display structure is shown in SEQ ID NO.3-5. The preparation method of the present invention is based on a lentiviral system to construct virus-like particles whose capsid is a modular component that specifically targets immune cells, and can achieve an infection efficiency of 50%-90% in immune cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the HIV-1-gag-zsGreen-pol plasmid map.

[0039] Figure 2 This is the plasmid map of pcDNA3.1-MCS-VSV-G-TM.

[0040] Figure 3 This is the plasmid map of pcDNA3.1-scFv-CD19-VSV-G-TM.

[0041] Figure 4 This is the plasmid map of pcDNA3.1-scFv-CD3-VSV-G-TM.

[0042] Figure 5 This is the plasmid map of pcDNA3.1-scFv-CD56-VSV-G-TM.

[0043] Figure 6 This is the plasmid map of pCMV-VSV-G mut-TM.

[0044] Figure 7 This is a 24-hour fluorescence image of Raji cells infected with a pseudovirus specifically targeting B cells; A in the figure is blank control cells; B is LV-Target-control virus; C is LV-Target-CD19 virus.

[0045] Figure 8 This is a flow cytometric analysis of Raji cells infected with a pseudovirus specifically targeting B cells for 24 hours; A in the figure is blank control cells; B is LV-Target-control virus; and C is LV-Target-CD19 virus.

[0046] Fig. 9The 24-hour fluorescence images of Jurkat and Raji cells infected with pseudoviruses specifically targeting T cells; A in the figure is blank control cells; B is LV-Target-control virus; C is LV-Target-CD3 virus.

[0047] Fig.10 The figure shows the flow cytometric analysis of Jurkat and Raji cells infected with a specific T-cell pseudovirus for 24 hours; A in the figure shows blank control cells; B shows LV-Target-control virus; and C shows LV-Target-CD3virus.

[0048] Fig.11 The fluorescence images of NK92 and Jurkat cells infected with pseudovirus specifically targeting NK cells for 24 hours are shown in Figure 1. A is the blank control cell; B is the LV-Target-control virus; and C is the LV-Target-CD56 virus.

[0049] Fig.12 This is a flow cytometric analysis of NK92 and Jurkat cells infected with pseudovirus specifically targeting NK cells for 24 hours; A in the figure is blank control cells; B is LV-Target-control virus; C is LV-Target-CD56virus. DETAILED DESCRIPTION

[0050] In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further explained in conjunction with specific embodiments below, but the following embodiments are only preferred embodiments of the present invention, not all. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without creative work all belong to the protection scope of the present invention. In the following embodiments, unless otherwise specified, the operating methods used are conventional operating methods, the equipment used are conventional equipment, and the equipment materials used in each embodiment are the same.

[0051] Example 1 Construction of specific immune cell-targeting pseudovirus-related plasmids based on lentiviral system

[0052] 1. The sequences of zsGreen protein, VSV-G signal peptide-MCS-VSV-G transmembrane region, scFv-CD19, scFv-CD3, and scFv-CD56 were obtained by full gene synthesis, as shown in Table 1.

[0053] Table 1 Synthetic sequences

[0054]

[0055] SEQ ID NO.1:

[0056] atggcccagtccaagcacggcctgaccaaggagatgaccatgaagtaccgcatggagggctgcgtggacggccacaagttcgtgatcaccggcgagggcatcggctaccccttcaagggcaagcaggccatcaacctgtgcgtggtggagggcggccccttgcccttcgccgaggacatcttgtccgccgccttcatgtacggcaaccgcgtgttcaccgagtacccccaggacatcgtcgactacttcaagaactcctgccccgccggctacacctgggaccgctccttcctgttcgaggacggcgccgtgtgcatctgcaacgccgacatcaccgtgagcgtggaggagaactgcatgtaccacgagtccaagttctacggcgtgaacttccccgccgacggccccgtgatgaagaagatgaccgacaactgggagccctcctgcgagaagatcatccccgtgcccaagcagggcatcttgaagggcgacgtgagcatgtacctgctgctgaaggacggtggccgcttgcgctgccagttcgacaccgtgtacaaggccaagtccgtgccccgcaagatgcccgactggcacttcatccagcacaagctgacccgcgaggaccgcagcgacgccaagaaccagaagtggcacctgaccgagcacgccatcgcctccggctccgccttgccctga。

[0057] SEQ ID NO.2:

[0058] atgaagtgccttttgtacttagcctttttattcattggggtgaattgcttaattaaatcgatGGAGGAGGAGGAAGCGGAGGAGGCGGAAGCGGAGGCGGAGGAAGCaatccaatcgagcttgtagaaggttggttcagtagttggaaaagctctattgcctcttttttctttatcatagggttaatcattggactattcttggttctccgagttggtatccatctttgcattaaattaaagcacaccaagaaaagacagatttatacagacatagagatgaaccgacttggaaag。

[0059] SEQ ID NO.3:

[0060] Atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccggacatccagatgacacagactacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagggcaagtcaggacattagtaaatatttaaattggtatcagcagaaaccagatggaactgttaaactcctgatctaccatacatcaagattacactcaggagtcccatcaaggttcagtggcagtgggtctggaacagattattctctcaccattagcaacctggagcaagaagatattgccacttacttttgccaacagggtaatacgcttccgtacacgttcggaggggggaccaagctggagatcacaggtggcggtggctcgggcggtggtgggtcgggtggcggcggatctgaggtgaaactgcaggagtcaggacctggcctggtggcgccctcacagagcctgtccgtcacatgcactgtctcaggggtctcattacccgactatggtgtaagctggattcgccagcctccacgaaagggtctggagtggctgggagtaatatggggtagtgaaaccacatactataattcagctctcaaatccagactgaccatcatcaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatttactactgtgccaaacattattactacggtggtagctatgctatggactactggggccaaggaacctcagtcaccgtctcctca。

[0061] SEQ ID NO.4:

[0062] CAAATTGTTCTGACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGAACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCACTTCAGGGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCGGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTAGTAACCCATTCACGTTCGGCTCGGGGACAAAGTTGGAAATAAACggtggcggtggctcgggcggtggtgggtcgggtggcggcggatctCAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGGTACACGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCCGTGGTTATACTAATTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATATTATGATGATCATTACTGCCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA。

[0063] SEQ ID NO.5:

[0064] .

[0065] 2. Plasmid psPAX2 (purchased from Addgene, catalog number 12260) was used as a vector. The linearized psPAX2 vector was obtained by PCR. The linearized psPAX2 vector was connected with the synthesized SEQ ID NO.1 by homologous recombination to obtain HIV-1-gag-zsGreen-pol plasmid. The map is shown in Figure 1 shown.

[0066] 3. Plasmid pcDNA3.1 (purchased from Invitrogen, catalog number V790-20) was used as a vector. The linearized vector was obtained by restriction endonuclease BamHI and EcoRI. The linearized pcDNA3.1 vector was connected with the synthesized SEQ ID NO.2 by homologous recombination to obtain pcDNA3.1-MCS-VSV-G-TM plasmid. The map is shown in Figure 2 shown.

[0067] 4. Plasmid pcDNA3.1-MCS-VSV-G-TM was used as a vector. The linearized vector was obtained by digestion with restriction endonucleases PacI and ClaI. The linearized pcDNA3.1-MCS-VSV-G-TM vector was ligated with the synthesized SEQ ID NO.3 by homologous recombination to obtain pcDNA3.1-scFv-CD19-VSV-G-TM plasmid. The map is shown in Figure 3 shown.

[0068] 5. Plasmid pcDNA3.1-MCS-VSV-G-TM was used as a vector. The linearized vector was obtained by restriction endonuclease PacI and ClaI. The linearized pcDNA3.1-MCS-VSV-G-TM vector was ligated with the synthesized SEQ ID NO.4 by homologous recombination to obtain pcDNA3.1-scFv-CD3-VSV-G-TM plasmid. The map is shown in Figure 4 shown.

[0069] 6. Plasmid pcDNA3.1-MCS-VSV-G-TM was used as a vector. The linearized vector was obtained by digestion with restriction endonucleases PacI and ClaI. The linearized pcDNA3.1-MCS-VSV-G-TM vector was ligated with the synthesized SEQ ID NO.5 by homologous recombination to obtain pcDNA3.1-scFv-CD56-VSV-G-TM plasmid. The map is shown in Figure 5 shown.

[0070] 7. Plasmid pCMV-VSV-G (purchased from Addgene, catalog number 8454) was used as a vector, and the amino acids K47 and R354 of VSV-G were mutated into glutamine Q (K47Q and R354Q) to obtain the pCMV-VSV-Gmut-TM plasmid with VSV-G protein mutation inactivation, as shown in the map. Figure 6 shown.

[0071] The constructed plasmids were sent for first generation genome sequencing and the sequencing was completed by Tianlin Company.

[0072] Example 2 Specific B cell targeting pseudovirus packaging based on lentiviral system

[0073] 1. Observe the state of 293T cells under a microscope before transfection. Cell transfection can be performed if the density is around 80%, there is no mycoplasma and the growth state is good;

[0074] 2. Before transfection, replace the medium of each 10cm dish with 10mL of DMEM medium containing 2% FBS serum to reduce the effect of serum on plasmid transfection;

[0075] 3. Experimental groups and plasmid dosage are shown in Table 2.

[0076] Table 2 Virus packaging system

[0077]

[0078] 4. Add the required amount of plasmid and 1×PEI in Table 2 into the corresponding 1.5mL EP tube containing 1mL 1×PBS / dish, add the plasmid first and mix well, then add 1×PEI (purchased from HARVEYBIO, product number 49553-93-7) and mix well, let stand for 15 minutes to obtain the transfection mixture;

[0079] 5. Add the transfection mixture dropwise into a 10 cm dish and transfect HEK283T cells. Replace the medium with 10 mL of DMEM medium containing 2% serum 8 hours after transfection.

[0080] 6. Collect the supernatant of the cell culture medium 24h and 48h after transfection, replace the medium with 10mL of DMEM culture medium containing 2% serum, centrifuge at 50000xg for 2h, and add 100μL 1×PBS (purchased from Gibco, catalog number 70011044) to each dish for resuspending; then add 25μL of universal nuclease (purchased from zrbiorise, catalog number ZRXX12688) to each 10cm dish and treat at 37°C for 1h to eliminate free DNA and RNA; then centrifuge at 12000rpm for 3min, aspirate the supernatant with a syringe, and filter with a 0.22μm filter to obtain purified specific B cell-targeting pseudoviruses, which were named LV-Target-CD19virus, LV-Target-CD3virus, LV-Target-CD56 virus, and LV-Target-control virus.

[0081] Example 3 Specific targeting of B cells based on lentiviral system pseudovirus infection test

[0082] 1. Infection sample addition: Centrifuge the Raji cells and Jurkat cells in the logarithmic growth phase and resuspend them in a small volume of complete culture medium;

[0083] Take 1.0×10^6 Raji cells and add 30μL virus solution (LV-Target-CD19 virus or LV-Target-control virus) into the same 1.5mL EP tube and mix well;

[0084] Take 1.0×10^6 Jurkat cells and 60μL virus solution (LV-Target-CD19 virus or LV-Target-control virus) and add them to the same 1.5mL EP tube and mix well.

[0085] 2. Infection treatment: The 1.5 mL EP tube containing the mixture of cells and virus solution was placed in a centrifuge at 800 rpm for 1 hour; the centrifuged mixture was added to a 24-well plate and supplemented with complete culture medium to 1 mL. The cells were shaken by the "cross method" and placed in a CO2 cell culture incubator at 37°C for culture.

[0086] 3. Change medium after infection: 8 hours after infection, centrifuge at 800 rpm for 5 minutes to discard the waste liquid and add 1 mL of new complete medium for cultivation.

[0087] 4. Fluorescence intensity photography and flow analysis: After 24 hours of virus infection, use a fluorescence microscope to take bright field images and GFP fluorescence channel images. The results are as follows: Figure 7 shown.

[0088] The results showed that in Raji cells containing CD19 targets, the EGFP fluorescence ratio of the LV-Target-CD19 virus group exceeded 90%, while the LV-Target-control virus group had almost no fluorescence. In Jurkat cells without CD19 targets, both the LV-Target-CD19 virus group and the LV-Target-control virus group had almost no fluorescence.

[0089] After the shooting, centrifuge at 800 rpm for 3 min and discard the waste liquid, wash twice with 1×PBS at 800 rpm for 3 min and discard the PBS; add 0.5 mg / mL proteinase K and treat at 37°C for 15 min, centrifuge and discard the waste liquid, resuspend in 500 μL 1×PBS, select the GFP channel for flow analysis, and the specific data are as follows: Figure 8As shown, the results showed that in Raji cells containing CD19 targets, the EGFP fluorescence ratio of the LV-Target-CD19virus group was 97.24% while that of the LV-Target-control virus group was 0.4%. In Jurkat cells without CD19 targets, the EGFP fluorescence ratios of the LV-Target-CD19virus group and the LV-Target-control virus group were both less than 2%; Figure 7 and Figure 8 The data show that the pseudovirus specifically targeting B cells has good targeting and specificity in B cells.

[0090] Example 4 Specific Targeted T Cell Pseudovirus Infection Test Based on Lentivirus System

[0091] 1. Infection sample addition: Centrifuge the Raji cells and Jurkat cells in the logarithmic growth phase and resuspend them in a small volume of complete culture medium;

[0092] Take 1.0×10^6 Raji cells and add 30μL virus solution (LV-Target-CD3 virus or LV-Target-control virus) into the same 1.5mL EP tube and mix well;

[0093] Take 1.0×10^6 Jurkat cells and 60μL virus solution (LV-Target-CD3 virus or LV-Target-control virus) and add them to the same 1.5mL EP tube and mix well.

[0094] 2. Infection treatment: The 1.5 mL EP tube containing the mixture of cells and virus solution was placed in a centrifuge at 800 rpm for 1 hour; the centrifuged mixture was added to a 24-well plate and supplemented with complete culture medium to 1 mL. The cells were shaken by the "cross method" and placed in a CO2 cell culture incubator at 37°C for culture.

[0095] 3. Change medium after infection: 8 hours after infection, centrifuge at 800 rpm for 5 minutes to discard the waste liquid and add 1 mL of new complete medium for cultivation.

[0096] 4. Fluorescence intensity photography and flow analysis: After 24 hours of virus infection, use a fluorescence microscope to take bright field images and GFP fluorescence channel images. The results are as follows: Fig. 9 shown.

[0097] The results showed that in Jurkat cells containing CD3 targets, the EGFP fluorescence ratio of the LV-Target-CD3 virus group was much higher than that of the LV-Target-control virus group. In Raji cells without CD3 targets, the EGFP fluorescence ratios of the LV-Target-CD3virus group and the LV-Target-control virus group were both very low.

[0098] After the shooting, centrifuge at 800 rpm for 3 min and discard the waste liquid, wash twice with 1×PBS at 800 rpm for 3 min and discard the PBS; add 0.5 mg / mL proteinase K and treat at 37°C for 15 min, centrifuge and discard the waste liquid, resuspend in 500 μL 1×PBS, select the GFP channel for flow analysis, and the specific data are as follows: Fig.10 shown.

[0099] The results showed that in Jurkat cells containing CD3 targets, the EGFP fluorescence ratio in the LV-Target-CD3 virus group was 99.49% while that in the LV-Target-control virus group was 0.25%. In Raji cells without CD3 targets, the EGFP fluorescence ratios in both the LV-Target-CD3 virus group and the LV-Target-control virus group were less than 1%. Fig. 9 and Fig.10 The data show that the pseudovirus specifically targeting T cells has good targeting and specificity in T cells.

[0100] Example 5 Specific NK cell pseudovirus infection test based on lentiviral system

[0101] 1. Infection sampling: Centrifuge NK cells and Jurkat cells in the logarithmic growth phase and resuspend them in a small volume of complete culture medium;

[0102] Take 1.0×10^6 cells of NK92 cells and add 100μL virus solution (LV-Target-CD56 virus or LV-Target-control virus) into the same 1.5mL EP tube and mix well;

[0103] Take 1.0×10^6 Jurkat cells and 60μL virus solution (LV-Target-CD56 virus or LV-Target-control virus) and add them to the same 1.5mL EP tube and mix well.

[0104] 2. Infection treatment: The 1.5 mL EP tube containing the mixture of cells and virus solution was placed in a centrifuge at 800 rpm for 1 hour; the centrifuged mixture was added to a 24-well plate and supplemented with complete culture medium to 1 mL. The cells were shaken by the "cross method" and placed in a CO2 cell culture incubator at 37°C for culture.

[0105] 3. Change medium after infection: 8 hours after infection, centrifuge at 800 rpm for 5 minutes to discard the waste liquid and add 1 mL of new complete medium for cultivation.

[0106] 4. Fluorescence intensity photography and flow analysis: After 24 hours of virus infection, use a fluorescence microscope to take bright field images and GFP fluorescence channel images. The results are as follows: Fig.11 shown.

[0107] The results showed that in NK92 cells containing CD56 targets, the EGFP fluorescence ratio of the LV-Target-CD56 virus group was higher than that of the LV-Target-control virus group. In Jurkat cells without CD56 targets, the EGFP fluorescence ratios of both the LV-Target-CD56 virus group and the LV-Target-control virus group were lower.

[0108] After the shooting, centrifuge at 800 rpm for 3 min and discard the waste liquid, wash twice with 1×PBS at 800 rpm for 3 min and discard the PBS; add 0.5 mg / mL proteinase K and treat at 37°C for 15 min, centrifuge and discard the waste liquid, resuspend in 500 μL 1×PBS, select the GFP channel for flow analysis, and the specific data are as follows: Fig.12 shown.

[0109] The results showed that in NK92 cells containing CD56 targets, the EGFP fluorescence ratio in the LV-Target-CD56 virus group was 50.9% and that in the LV-Target-control virus group was 5.8%. In Jurkat cells without CD56 targets, the EGFP fluorescence ratios in both the LV-Target-CD56 virus group and the LV-Target-control virus group were less than 1%. Fig.11 and Fig.12 The data show that the pseudovirus specifically targeting T cells has good targeting and specificity in T cells.

[0110] Combined with the data analysis of pseudoviruses targeting B / T and NK cells, virus-like particles displaying scFv antibodies on the virus surface achieved higher efficiency targeting and better specificity in immune cells.

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing a virus-like particle displaying an scFv antibody, characterized in that: The preparation method comprises constructing a specific targeting recombinant plasmid, wherein the specific targeting recombinant plasmid is obtained by connecting a vector expressing a viral capsid protein and a coding gene expressing a scFv antibody display structure through homologous recombination; The vector expressing viral capsid protein comprises a gene encoding a VSV-G signal peptide-transmembrane region-intracellular region, and the gene encoding a VSV-G signal peptide-transmembrane region-intracellular region is shown in SEQ ID NO.

2.

2. The preparation method according to claim 1, characterized in that: The scFv antibodies include: one or more of anti-CD3, anti-CD19, anti-CD56, anti-CD4, anti-CD5, anti-CD7, anti-CD8, anti-CD11a, anti-CD11b, anti-CD13, anti-CD14, anti-CD16, anti-CD20, anti-CD21, anti-CD22, anti-CD23, anti-CD25, anti-CD26, anti-CD28, anti-CD31, anti-CD33, anti-CD34, anti-CD38, anti-CD40, anti-CD44, and anti-CD45 scFv antibodies.

3. The preparation method according to claim 2, characterized in that: The scFv antibody is selected from one or more of anti-CD3, anti-CD19, and anti-CD56 scFv antibodies.

4. The preparation method according to claim 1, characterized in that: The coding gene for expressing the scFv antibody display structure has a nucleotide sequence as shown in SEQ ID NO.3-5.

5. The preparation method according to claim 1, characterized in that: The specific targeting recombinant plasmid construction method comprises the following steps: S1, digesting the vector with a restriction endonuclease to obtain a linearized vector 1, and connecting the linearized vector with the sequence shown in SEQ ID NO: 2 by homologous recombination to obtain plasmid 1; S2. Use restriction endonuclease to digest plasmid 1 to obtain linearized vector 2, and connect the linearized vector 2 to the sequence shown in any one of SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5 through homologous recombination to obtain specifically targeted recombinant plasmid 2, recombinant plasmid 3 or recombinant plasmid 4.

6. The preparation method according to claim 1, characterized in that: The preparation method further comprises: (1) ligating the linearized vector with the coding sequence shown in SEQ ID NO.1 to obtain plasmid 5; (2) recombinant plasmid 2, recombinant plasmid 3 or recombinant plasmid 4 are mixed with plasmid 5, respectively, and 1×PEI is added to obtain a transfection mixture, the transfection mixture is transfected into cells, and the supernatant of the cell culture medium is collected and purified to obtain virus-like particles 1, virus-like particles 2 or virus-like particles 3.

7. The virus-like particles prepared by the preparation method according to any one of claims 1 to 6.

8. Use of the virus-like particles according to claim 7 in the preparation of anti-tumor drugs or vaccines.

9. An anti-tumor drug, characterized in that: The anti-tumor drug comprises the virus-like particle according to claim 7.

10. A vaccine, characterized in that The vaccine comprises the virus-like particle according to claim 7.

Images