A gold ball-sensitized heterogeneous microchannel array bioreaction chip and its application

Abstract

The present invention discloses a gold ball-sensitized heterogeneous pore microfluidic channel array bioreaction chip and its application. The bioreaction chip includes a substrate, a microfluidic reaction layer and an interface layer. A plurality of heterogeneous pore microfluidic channels arranged in an array are provided on the bottom surface of the microfluidic reaction layer. A reaction chamber is formed by enclosing the heterogeneous pore microfluidic channels and the gold film surface of the substrate. After injecting a sample-second probe mixed solution, a gold ball solution and a washing solution into the reaction chamber in sequence, a detection signal is obtained using an optical detection device, and the detection signal is input into a standard curve to obtain the concentration of the target single-stranded DNA. On the one hand, the present invention solves part of the non-specific adsorption signal problem by reducing the possibility of gold ball aggregation and sedimentation. On the other hand, by enhancing the binding effect between the target and the gold ball, the adsorption efficiency of the target is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and particularly relates to a method for fabricating a universal gold ball bioreaction chip with increased sensitivity based on a label-free optical biosensor. This chip can be used to detect nucleic acid molecules and perform related detection applications. Background Art

[0002] Label-free optical biosensing technology is a type of detection technology that does not require staining and labeling, which utilizes changes in optical signals such as light absorption, scattering, interference, and diffraction by biomolecules to analyze the interactions between biomolecules. Due to its many advantages such as strong specificity, high sensitivity, non-destructive detection, and fast analysis speed, label-free optical biosensing technology has been widely applied in fields such as biochemical detection, medical diagnosis, environmental monitoring, and drug research and development. Common label-free optical biosensing technologies mainly include surface plasmon resonance (SPR) sensors, ellipsometric optical sensors, optical waveguide spectroscopy sensors, and reflection interference sensors.

[0003] Single-stranded DNA (ssDNA) is a DNA molecule composed of a single nucleotide chain. Different from double-stranded DNA (dsDNA), ssDNA lacks the other complementary strand. Usually, ssDNA exists in organisms in a relatively unstable state and tends to form complementary pairs with DNA and RNA. However, in fact, ssDNA not only plays an important role in organisms but is also one of the important tools in molecular biology. Existing research has confirmed that due to its highly negative charge, ssDNA can quickly enter cells without being degraded and acts as a transport carrier in gene delivery and gene regulation; in terms of immune regulation, ssDNA can activate the immune system and generate a strong immune response; ssDNA can also be used as a gene silencing tool to regulate gene expression by binding to specific miRNAs.

[0004] In the past five years, label-free optical biosensing technology has achieved many applications. Compared with the commonly used immunochemiluminescence method and immunoprecipitation method (polymerase chain reaction, enzyme-linked immunosorbent assay), label-free optical biosensing technology has stronger anti-interference ability, simpler pre-detection processing, and shorter readout time. However, when reading short sequence ssDNA (20 - 100 nt) fragments, there is a situation of insufficient sensitivity. The signal amplification strategy based on gold balls effectively solves this problem, but at the same time brings new problems, that is, the aggregation and sedimentation of gold balls increase the non-specific adsorption situation, and non-specific adsorption will bring false positive signals, thus affecting the detection sensitivity.

[0005] Therefore, how to avoid the non-specific signals caused by the aggregation and sedimentation of gold nanoparticles is one of the most urgent problems to be solved in the current gold nanoparticle-based signal amplification strategies. Summary of the Invention

[0006] In view of the problem that the non-specific signals caused by the aggregation and sedimentation of gold nanoparticles in the prior art affect the detection sensitivity, the present invention provides a gold nanoparticle-sensitized heteroporous microchannel array bioreaction chip and its application. The present invention is provided with a heteroporous microchannel array bioreaction generator, and a biochip formed after using the bioreaction generator to enhance the gold nanoparticle signal, and conducts ssDNA-related detection applications. The present invention strengthens the signal response degree of the target and improves the detection performance of the target.

[0007] The technical solution adopted by the present invention is as follows:

[0008] I. A gold nanoparticle-sensitized heteroporous microchannel array bioreaction chip

[0009] It includes at least one reaction chamber, and the reaction chamber is mainly composed of a sample injection chamber, a flow channel, and a sample outlet chamber. The sample injection chamber and the sample outlet chamber are arranged at intervals, and the flow channel is arranged on the connection line between the centers of the sample injection chamber and the sample outlet chamber. The sample injection chamber and the sample outlet chamber are connected through the flow channel. The diameter of the sample injection chamber is smaller than the diameter of the sample outlet chamber, and the width of the flow channel is the same as the diameter of the sample injection chamber.

[0010] Preferably, both the sample injection chamber and the sample outlet chamber are columnar, and the flow channel is cube-shaped.

[0011] Preferably, the depths of the sample injection chamber, the flow channel, and the sample outlet chamber are the same, and the diameter ratio of the sample injection chamber to the sample outlet chamber is 1:2, and the volume ratio is 1:4.

[0012] Specifically, a first probe is fixedly sealed on the inner bottom surface of the reaction chamber. The sample injection chamber and the sample outlet chamber are respectively communicated with the outside. After the sample solution is injected into the sample injection chamber, it flows into the sample outlet chamber through the flow channel and then flows out from the sample outlet chamber.

[0013] Preferably, the sample solution includes a mixed solution of a sample to be detected and a second probe, and a gold nanoparticle solution. The pH of both sample solutions is 3-4.

[0014] Specifically, the sample to be detected contains a target to be detected (i.e., target single-stranded DNA). The detection method of the present invention is mainly for detecting ssDNA with a base length range of 20-80 nt.

[0015] The concentration of the target in the mixed solution is preferably 10 ng / mL - 1 μg / mL.

[0016] The gold spheres are preferably gold nanoparticles modified with nickel ion - nitrilotriacetic acid (NTA), with a concentration range of 1 - 10 nmol / L and a particle size range of 1.8 - 10 nm.

[0017] Preferably, the first probe is an ssDNA containing a target - complementary fragment and modified with a thiol group at the end.

[0018] Preferably, the second probe is an ssDNA modified with a histidine tag at the head and complementary base - paired with the first probe at the end.

[0019] Preferably, the bio - reaction chip is mainly composed of a substrate, a micro - channel reaction layer, and an interface layer stacked in sequence from bottom to top; a gold film is provided on the top surface of the substrate, at least one heterogeneous - pore micro - channel is provided on the bottom surface of the micro - channel reaction layer, and each heterogeneous - pore micro - channel and the substrate enclose a reaction chamber. A plurality of stainless - steel tubes are penetrated through the interface layer.

[0020] Preferably, the heterogeneous - pore micro - channel is mainly composed of two columnar grooves and a cubic groove. The two columnar grooves are arranged at intervals and are connected by the cubic groove. Each columnar groove is communicated with the outside through a corresponding stainless - steel tube; the diameters of the two columnar grooves are different. The first columnar groove with a smaller diameter and the substrate enclose an injection chamber, the second columnar groove with a larger diameter and the substrate enclose a sampling chamber, and the cubic groove and the substrate enclose a flow channel; the cubic groove is arranged on the connection line between the centers of the two columnar grooves and has the same width as the diameter of the first columnar groove.

[0021] Optionally, the depth of the heterogeneous - pore micro - channel is less than the thickness of the micro - channel reaction layer.

[0022] II. A method for detecting biomolecules using the above - mentioned gold - sphere - sensitized heterogeneous - pore micro - channel array bio - reaction chip

[0023] The detection method includes the following steps:

[0024] S1) Fix and block the first probe on the surface of the substrate, and then assemble to obtain the gold - sphere - sensitized heterogeneous - pore micro - channel array bio - reaction chip. The step S1 includes the following steps:

[0025] S1.1) Clean the substrate with a gold film on its surface to obtain a cleaned substrate;

[0026] S1.2) Drop the reduced first - probe solution with a concentration of 10 - 100 μmol / L onto the surface of the cleaned substrate and let it stand. Then, wash the surface of the substrate with deionized water. After washing 1 - 3 times, obtain the substrate with the first probe fixed.

[0027] S1.3) After fixing the first probe, immerse the substrate in a 6-Mercapto-1-hexanol (MCH) solution, incubate it with shaking at room temperature in the dark, and obtain the substrate after the first probe is blocked.

[0028] S1.4) Through a commercial PDMS-glass bonding process, couple and connect the microchannel reaction layer and the interface layer; then adhere the gold film side surface of the substrate after the first probe is blocked to the groove side surface of the microchannel reaction layer to obtain the assembled bio-reaction chip.

[0029] S2) Prepare a gold nanoparticle solution and a mixed solution of the sample to be detected and the second probe; the pH values of both the gold nanoparticle solution and the mixed solution are 3-4.

[0030] The sample to be detected contains the target to be detected, and the concentration of the target in the mixed solution is 10 ng / mL - 1 μg / mL. The base length range of the target is 20 - 80 nt.

[0031] Preferably, the concentration range of the gold nanoparticle solution is 1 - 10 nmol / L.

[0032] S3) Control the mixed solution prepared in step S2 to pass through each of the heterogeneous microchannels of the gold nanoparticle-sensitized heterogeneous microchannel array bio-reaction chip, with a flow rate of 0.1 - 0.5 mL / min and a passing time of 10 - 20 min.

[0033] S4) Control the gold nanoparticle solution to pass through each of the heterogeneous microchannels of the gold nanoparticle-sensitized heterogeneous microchannel array bio-reaction chip, with a flow rate of 0.2 - 0.5 mL / min and a passing time of 10 - 20 min.

[0034] S5) After standing for 10 - 20 min, control the washing solution to pass through each of the heterogeneous microchannels of the gold nanoparticle-sensitized heterogeneous microchannel array bio-reaction chip.

[0035] In steps S3 - S5, the process of controlling the solution to pass through the heterogeneous microchannels of the gold nanoparticle-sensitized heterogeneous microchannel array bio-reaction chip is specifically as follows: Use a peristaltic pump to inject the solution from the stainless steel tube corresponding to the sample injection chamber into the heterogeneous microchannel and output it from the stainless steel tube corresponding to the sample output chamber.

[0036] S6) Use an optical detection device to detect the gold nanoparticle-sensitized heterogeneous microchannel array bio-reaction chip to obtain a detection signal.

[0037] Step S6 further includes: Input the detection signal into a pre-established standard curve to obtain the concentration of the target in the mixed solution.

[0038] Optionally, the standard curve is established as follows: Prepare a target-second probe mixed solution containing different concentrations of the target, detect the detection signals corresponding to various target-second probe mixed solutions, fit the target concentration and the corresponding detection signals to obtain a standard curve.

[0039] III. Application of a gold ball-sensitized heterogeneous pore microchannel array bioreaction chip in detecting nucleic acid molecules.

[0040] Preferably, the detection method of the present invention can detect single-stranded DNA with a base length range of 20 - 80 nt.

[0041] Preferably, the detection concentration of the detection method of the present invention is 10 ng / mL - 1 μg / mL.

[0042] The beneficial effects of the present invention are as follows:

[0043] 1. The bioreaction chip of the present invention realizes the result of reducing the aggregation and sedimentation of gold balls through the heterogeneous pore microchannels, and solves part of the problem of non-specific adsorption signals.

[0044] 2. By adding a surface electrical property modulation step during the fabrication of the bioreaction chip and the detection of nucleic acid molecules, the present invention realizes further enhancement of the target signal amplified by gold balls, and overcomes the defect of low target adsorption efficiency of traditional chips.

[0045] 3. The present invention is simple to operate and highly practical. It not only strengthens the signal response degree of the target substance, but also improves the detection performance of the target substance, and has broad application prospects in label-free optical biosensing technology.

[0046] 4. The detection method of the present invention can achieve high-precision detection for ssDNA with a base length of 20 - 80 nt within the concentration range of 10 ng / mL - 1 μg / mL. Description of the Drawings

[0047] Figure 1 It is a combined structural schematic diagram of the microchannel reaction layer and the interface layer in the bioreaction chip of the present invention;

[0048] Figure 2 It is a top view of the microchannel reaction layer and the interface layer in the bioreaction chip of the present invention; among them, (a) is the top view of the microchannel reaction layer, and (b) is the top view of the interface layer;

[0049] Figure 3 It is a schematic top view of the gold ball sedimentation principle in each heterogeneous pore microchannel of the bioreaction chip of the present invention;

[0050] Figure 4 It is a signal diagram of different regions in the sample outlet chamber of each heterogeneous pore microchannel of the bioreaction chip of the present invention;

[0051] Figure 5 Schematic diagram of the manufacturing and detection processes of the bio - reaction chip of the present invention;

[0052] Figure 6 Schematic diagram of the detection results of Example 2 and Comparative Example 2 of the present invention;

[0053] Figure 7 Schematic diagram of the detection results of Example 2 and Comparative Example 3 of the present invention. Detailed implementation manners

[0054] The present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings.

[0055] Below, the meanings of some terms adopted in the present invention are explained as follows:

[0056] In the present invention, "gold - sphere sensitization" means that in addition to the signal enhancement brought by the gold sphere itself, the specific signal when the gold sphere binds to the target is also enhanced, so that the sensitivity of the label - free optical biosensor is enhanced twice when detecting the target.

[0057] In the present invention, "gold - sphere sedimentation" refers to the behavior that the gold sphere adheres to the chip surface under the combined action of hydrodynamic force and gravity in the flow channel.

[0058] In the present invention, the "head end" and "tail end" of the nucleic acid refer to the 5'-end and 3'-end of the nucleic acid respectively.

[0059] Below in conjunction with Figures 3 - 5 The principle of the present invention is further described.

[0060] The principle of the present invention is specifically as follows:

[0061] Firstly, the present invention realizes the result of reducing gold - sphere sedimentation through the hetero - pore micro - channel, thereby solving part of the non - specific adsorption signal problem. As Figure 4 shown, compared with the general microarray unit, the present invention grasps the characteristic of the gradual change of molecular size in the process of mobile - phase transportation, adopts the design of injecting samples through small - volume pores (injection chambers) and discharging samples through large - volume pores (discharge chambers), so that the gold - sphere sedimentation is distributed as much as possible in the peripheral area of the large - volume pores (discharge chambers), and enough specific - binding areas for the target and the gold sphere are left skillfully in the middle of the large - volume pores (discharge chambers), improving the situation of specific binding.

[0062] In a second aspect, in the process of fabricating a bio-reaction chip and detecting nucleic acid molecules, the present invention adds a surface electrical property modulation step, thereby further enhancing the amplification of target signals based on gold nanoparticles. By changing the pH of the buffer solution, the gold nanoparticles and the target carry attractive charges, strengthening the binding force between the gold nanoparticles and the target and increasing the intensity of the target signal. Taking the pH of the mixed solution and the gold nanoparticle solution as 3.5 as an example, the electrical properties of the target ssDNA and gold particles in a buffer solution with a pH of 3.5 are shown in Table 1. The detection method provided by the present invention is simple to operate and highly practical. It not only enhances the signal response degree of the target substance but also improves the specificity of the target substance signal, and has broad application prospects in the field of label-free optical biosensing technology.

[0063] Table 1

[0064] Target ssDNA Gold particles Isoelectric point 4-4.5 - Buffer solution 3.5 3.5 Electric property Positive charge Negative charge

[0065] In a first aspect, the present invention provides a gold nanoparticle-sensitized heterogeneous pore microfluidic array bio-reaction chip.

[0066] The bio-reaction chip includes at least one reaction chamber, which is mainly composed of a sample injection chamber, a flow channel, and a sample output chamber. The sample injection chamber and the sample output chamber are arranged at intervals, and a flow channel is arranged on the line connecting the centers of the sample injection chamber and the sample output chamber. The sample injection chamber and the sample output chamber are connected through the flow channel. The diameter of the sample injection chamber is smaller than that of the sample output chamber, and the width of the flow channel is the same as the diameter of the sample injection chamber.

[0067] Preferably, both the sample injection chamber and the sample output chamber are columnar, and the flow channel is cube-shaped.

[0068] Preferably, the sample injection chamber, the flow channel, and the sample output chamber have the same depth. The diameter ratio of the sample injection chamber to the sample output chamber is 1:2, and the volume ratio is 1:4.

[0069] Optionally, as Figure 1 shown, the bio-reaction chip of the present invention is mainly composed of a substrate, a microfluidic reaction layer, and an interface layer that are stacked in sequence from bottom to top. A gold film is provided on the top surface of the substrate, and a plurality of heterogeneous pore microfluidic channels arranged in an array are provided on the bottom surface of the microfluidic reaction layer. A plurality of stainless steel tubes penetrate through the interface layer; each heterogeneous pore microfluidic channel and the substrate enclose a reaction chamber, and each reaction chamber is mainly composed of a sample injection chamber, a flow channel, and a sample output chamber. The sample injection chamber and the sample output chamber are arranged at intervals and are connected through the flow channel. The sample injection chamber and the sample output chamber are respectively connected to the outside through a corresponding stainless steel tube. The stainless steel tube corresponding to the sample injection chamber is used to inject the sample solution, and the stainless steel tube corresponding to the sample output chamber is used to output the reacted solution; the diameter of the sample injection chamber is smaller than that of the sample output chamber. Herein, the top surface of the substrate refers to the surface on the side where the substrate contacts the microfluidic reaction layer. The bottom surface of the microfluidic reaction layer refers to the surface on the side where the microfluidic reaction layer contacts the substrate.

[0070] Specifically, the injection chamber and the sample output chamber are respectively connected to the outside through a corresponding stainless steel tube, which means that the injection chamber is connected to one end of the corresponding stainless steel tube, and the other end of the stainless steel tube is used to receive the sample solution from the sample pool. The sample output chamber is connected to one end of the corresponding stainless steel tube, and the other end of the stainless steel tube is used to output the reacted solution to the waste liquid pool.

[0071] As an optional implementation manner of the present invention, the substrate is made of glass, and a layer of gold is attached to the glass surface. The attachment process is realized by a commercial physical vapor deposition (PVD) method. The microchannel reaction layer is made of polydimethylsiloxane (PDMS) material. The interface layer is made of poly(methyl methacrylate) (PMMA) material. The gold film layer of the substrate and the microchannel reaction layer are connected by extrusion through an external chip placement module. The coupling of the microchannel reaction layer and the interface layer (i.e., PMMA and PDMS) is realized by a commercial PDMS-glass bonding process.

[0072] As an optional implementation manner of the present invention, the specific way that a plurality of stainless steel tubes penetrate through the interface layer is as follows: a plurality of through holes are opened in the interface layer, each through hole is opened in the vertical direction, a stainless steel tube is embedded in each through hole, the bottom end of each stainless steel tube is connected to the corresponding cylindrical groove, and the top end is connected to a peristaltic pump through a rubber tube.

[0073] As an optional implementation manner of the present invention, the coupling between the interface layer and the stainless steel tube is realized by irradiating ultraviolet (UV) glue with an ultraviolet curing machine. The coupling method between the rubber tube and the stainless steel tube is realized by manually inserting the end of the top end of the stainless steel tube into one end of the rubber tube.

[0074] Specifically, the horizontal cross-section of each heterogeneous microchannel is in an asymmetric dumbbell shape (see Figure 2 and Figure 3 ). The heterogeneous microchannel is mainly composed of two columnar grooves and a cubic groove. The two columnar grooves are arranged at intervals and are connected by the cubic groove. Each columnar groove is connected to the outside through a corresponding stainless steel tube; the diameters of the two columnar grooves are different and the depths are the same. The first columnar groove with a smaller diameter and the substrate enclose an injection chamber, the second columnar groove with a larger diameter and the substrate enclose a sample output chamber, and the cubic groove and the substrate enclose a flow channel.

[0075] Preferably, the cubic groove is arranged on the connection line between the axes of the two columnar grooves, and the width is the same as the diameter of the first columnar groove with a smaller diameter. That is, on the horizontal cross-section of the cubic groove and the first columnar groove, the long side of the cubic groove is tangent to the first columnar groove. The flow channel is arranged on the connection line between the axes of the sample injection chamber and the sample output chamber, and the width is the same as the diameter of the sample injection chamber.

[0076] Specifically, the two columnar grooves and the cubic groove have the same depth.

[0077] Preferably, the diameter ratio of the first columnar groove to the second columnar groove is 1:2. In each heterogeneous pore microchannel, the relationship between the volume / diameter of the sample injection chamber and the volume / diameter of the sample output chamber is: V 进样室 : V 出样室 = 1:4, R 进样室 : R 出样室 = 1:2.

[0078] Optionally, the depth of the heterogeneous pore microchannel is less than the thickness of the microchannel reaction layer.

[0079] Preferably, the center of each columnar groove is vertically aligned with the center of the corresponding stainless steel tube.

[0080] Preferably, the heterogeneous pore microchannels are uniformly arranged at intervals along a rectangular array on the bottom surface of the microchannel reaction layer. For example, in the specific embodiment of the present invention, 12 heterogeneous pore microchannels are provided, and these heterogeneous pore microchannels are uniformly arranged at intervals along a 3×4 rectangular array (see Figure 1 and Figure 2 ).

[0081] Specifically, the inner bottom surface of the reaction chamber is fixed and sealed with a first probe. The sample injection chamber and the sample output chamber are respectively communicated with the outside. After the sample solution is injected into the sample injection chamber, it flows into the sample output chamber through the flow channel and then flows out from the sample output chamber.

[0082] Preferably, the sample solution includes a mixed solution of the sample to be detected and the second probe and a gold ball solution. The sample to be detected contains the target to be detected (i.e., the target single-stranded DNA).

[0083] Preferably, the base length range of the target is 20~80 nt. That is, the detection method of the present invention can detect single-stranded DNA with a base length range of 20~80 nt.

[0084] Preferably, the concentration range of the target in the mixed solution of the sample to be detected and the second probe is 10 ng / mL~1 μg / mL, and the concentration range of the second probe is 50~200 μmol / L. That is, the detectable concentration range of the present invention is 10 ng / mL~1 μg / mL.

[0085] Preferably, the pH values of the mixed solution of the sample to be detected and the second probe and the gold nanoparticle solution are both 3 to 4. By changing the pH of the buffer solution, the gold nanoparticles and the target carry attractive charges (see Table 1), strengthening the binding force between the gold nanoparticles and the target and improving the target signal intensity. In specific implementation, buffer solutions with a pH of 3 to 4 can be used to prepare these two sample solutions. Preferably, DEPC water with a volume concentration of 0.1% is used as the buffer solution, and hydrochloric acid is used to adjust the pH.

[0086] Preferably, the gold nanoparticles are gold nanospheres with a particle size range of 1.8 to 10 nm. Further, the gold nanoparticles are gold nanospheres modified with nickel ions-nitrilotriacetic acid.

[0087] Preferably, in the gold nanoparticle solution, the concentration of the gold nanoparticles ranges from 1 to 10 nmol / L.

[0088] Preferably, the first probe is ssDNA containing a target complementary fragment and modified with a thiol group at the end.

[0089] Preferably, the second probe is ssDNA modified with a histidine tag at the head and complementary base-paired with the first probe at the end.

[0090] Preferably, the sequence lengths of both the first probe and the second probe are less than 100 nt.

[0091] The second aspect of the present invention provides a detection method using the above gold nanoparticle-sensitized heterogeneous pore microfluidic array bioreaction chip.

[0092] The detection method of the present invention includes the following steps:

[0093] S1) Fix and block the first probe on the surface of the substrate, and then assemble to obtain the gold nanoparticle-sensitized heterogeneous pore microfluidic array bioreaction chip;

[0094] Step S1 includes the following steps:

[0095] S1.1) Clean the substrate with a gold film to obtain a cleaned substrate.

[0096] S1.2) Mix a tris(2-carboxyethyl)phosphine hydrochloride (TCEP) solution and a first probe solution, and let it stand for 1.5 to 2 h to obtain a reduced first probe solution; drop the reduced first probe solution with a concentration of 10 to 100 μmol / L onto the surface of the cleaned substrate and let it stand for 1 to 2 h, and then wash the surface of the substrate 1 to 3 times with deionized water to obtain a substrate with the first probe fixed. In this step, the surface of the substrate refers to the side surface provided with the gold film.

[0097] Preferably, the TCEP solution and the first probe solution are mixed at a molar ratio of 1:1000.

[0098] In specific implementation, the ratio of the volume of the first probe solution after reduction to the surface area of the substrate after cleaning can be selected according to the actual situation, as long as the first probe solution after reduction can completely cover the substrate.

[0099] S1.3) Immerse the substrate with the first probe fixed in a 6-Mercapto-1-hexanol (MCH) solution, and incubate it with shaking at room temperature in the dark for 2 - 3 h to obtain the substrate after the first probe is blocked; in specific implementation, the concentration of the MCH solution is at least 50 mmol / L.

[0100] S1.4) Through a commercial PDMS-glass bonding process, couple and connect the microfluidic reaction layer and the interface layer; then adhere the gold film side surface of the substrate after the first probe is blocked to the groove side surface of the microfluidic reaction layer to obtain the assembled bio-reaction chip.

[0101] S2) Prepare a gold ball solution and a mixed solution of the sample to be detected and the second probe;

[0102] Preferably, the pH values of both the gold ball solution and the mixed solution are 3 - 4;

[0103] Preferably, the sample to be detected contains a target (i.e., the target single-stranded DNA), and the base length range of the target is 20 - 80 nt.

[0104] Preferably, the concentration range of the gold balls is 1 - 10 nmol / L.

[0105] S3) Control the mixed solution to pass through each heteroporous microchannel of the gold ball-sensitized heteroporous microchannel array bio-reaction chip, with a flow rate of 0.1 - 0.5 mL / min and a passing time of 10 - 20 min;

[0106] The implementation method of controlling the mixed solution to pass through the heteroporous microchannel can be: use a peristaltic pump to inject the mixed solution from the stainless steel tube corresponding to the injection chamber into the heteroporous microchannel and output it from the stainless steel tube corresponding to the sampling chamber.

[0107] S4) Control the gold ball solution to pass through each heteroporous microchannel of the gold ball-sensitized heteroporous microchannel array bio-reaction chip, with a flow rate of 0.2 - 0.5 mL / min and a passing time of 10 - 20 min;

[0108] The implementation method of controlling the gold ball solution to pass through the heteroporous microchannel can be: use a peristaltic pump to inject the gold ball solution from the stainless steel tube corresponding to the injection chamber into the heteroporous microchannel and output it from the stainless steel tube corresponding to the sampling chamber.

[0109] S5) After standing for 10 to 20 minutes, control the washing solution to pass through each heterogeneous microchannel of the gold sphere - enhanced heterogeneous microchannel array bioreaction chip; the flow rate is 0.1 to 0.3 mL / min, and the passing time is 5 to 20 minutes;

[0110] S6) Use a label - free optical detection device to detect the gold sphere - enhanced heterogeneous microchannel array bioreaction chip to obtain a detection signal.

[0111] Step S6 is specifically: Place the heterogeneous microchannel array bioreaction chip into a label - free optical detection device, such as a surface plasmon resonance instrument (Surface Plasmon Resonance, SPR) or an ellipsometric imaging biosensing detection device, etc. Operate according to the usage specifications of the label - free optical detection device to record the biosensing signal on the surface of the gold film, and obtain the detection result based on the biosensing signal.

[0112] Step S6 further includes: Input the detection signal into a pre - established standard curve to obtain the concentration of the target in the mixed solution.

[0113] Optionally, the process of establishing the standard curve is: Use a standard solution of the target to prepare a target - second probe mixed solution containing different concentrations of the target. Detect according to the process of Step S3 to Step S6 to obtain the detection signals corresponding to various target - second probe mixed solutions, and fit the target concentration and the corresponding detection signals to obtain the standard curve.

[0114] The third aspect of the present invention provides an application of the above - mentioned gold sphere - enhanced heterogeneous microchannel array bioreaction chip in detecting nucleic acid molecules.

[0115] Preferably, the detection method of the present invention can detect single - stranded DNA with a base length range of 20 to 80 nt. The detectable concentration range of the method of the present invention is 10 ng / mL to 1 μg / mL.

[0116] The specific embodiments of the present invention are as follows:

[0117] Example 1

[0118] This example is a bioreaction chip provided with 12 heterogeneous microchannels, and its structure is as Figure 2 shown, specifically as follows:

[0119] The bio-reaction chip of this embodiment includes a substrate, a microchannel reaction layer, and an interface layer. If the substrate is used as the bottom layer, then from bottom to top are the substrate, the microchannel reaction layer, and the interface layer in sequence, and the size of the horizontal cross-section is 20 mm × 20 mm. The substrate layer is made of glass with a layer of gold attached to its surface. The attachment process is achieved through a commercial physical vapor deposition method (Physical Vapor Deposition, PVD). The thickness of the glass is 3 mm, and the thickness of the gold film is 50 ± 5 nm. The microchannel reaction layer is made of PDMS with a thickness of 2 mm, and the interface layer is made of PMMA with a thickness of 3 mm. The coupling between the microchannel reaction layer and the interface layer is achieved through a commercial PDMS-glass bonding process. The specific technological processes include the following: fabricating the chip mask plate, fabricating the chip male template, fabricating the microchannel reaction layer using PDMS, fabricating the interface layer using PMMA, and bonding the microchannel reaction layer and the interface layer.

[0120] As Figure 2 As shown in (a) of , in the bio-reaction chip of this embodiment, an array of different-orifice microchannels formed by arranging 12 different-orifice microchannels in a 3 (rows) × 4 (columns) matrix is provided on the bottom surface of the microchannel reaction layer. The horizontal cross-section of each different-orifice microchannel is in an asymmetric dumbbell shape, that is, a shape similar to a keyhole. The different-orifice microchannel is mainly composed of two columnar grooves and a cubic groove. In each different-orifice microchannel, the first columnar groove with a smaller diameter has a diameter of 1 mm and a depth of 1 mm; the second columnar groove with a larger diameter has a diameter of 2 mm and a depth of 1 mm. The cubic groove has a length of 2 mm, a width of 1 mm, and a depth of 1 mm. Among them, the center connection line of the two columnar grooves is parallel to the column direction (y direction). The length of the cubic groove refers to its dimension in the direction of the center connection line of the two columnar grooves (i.e., the y direction). For two adjacent different-orifice microchannels in the x direction, the center distance between the second columnar grooves of the two different-orifice microchannels is 5 mm. For two adjacent different-orifice microchannels in the y direction, the center distance between the adjacent first columnar groove and the second columnar groove is 3 mm.

[0121] In addition, in order to facilitate the insertion of stainless steel tubes, 24 through holes are provided on the bottom surface of the microchannel reaction layer. Each columnar groove corresponds to a through hole, and each columnar groove is coaxially arranged with its corresponding through hole, that is, they are aligned in the vertical direction.

[0122] As Figure 2 As shown in (b) of , in the bio-reaction chip of this embodiment, 24 through holes are provided on the interface layer. All the through holes are arranged in a 6 (rows) × 4 (columns) matrix and are all opened in the vertical direction. Each through hole has a diameter of 1 mm and a depth of 3 mm. The center interval between two adjacent through holes in the x direction is 5 mm, and the center interval between two adjacent through holes in the y direction is 3 mm.

[0123] In the bioreaction chip of this embodiment, the stainless steel tube is made of 304 stainless steel, with an outer diameter of 1 mm and an inner diameter of 0.8 mm. The coupling between the stainless steel tube and the interface layer is achieved by irradiating UV glue with an ultraviolet curing machine. The outer diameter of the transparent rubber tube is 1.2 mm and the inner diameter is 1 mm. The coupling between the transparent rubber tube and the stainless steel tube is achieved by manual insertion.

[0124] Example 2

[0125] In this embodiment, the bioreaction chip in Example 1 and the method of the present invention were used to detect ssDNA standard products with different concentrations. In this embodiment, ssDNA standard ssDNA-21 was used as the target, and its nucleotide sequence is shown in SEQ ID NO.5: 5’-TAGCTTATCAGACTGATGTTGA. The concentrations of the target were 1000 ng / mL, 500 ng / mL, 100 ng / mL, 50 ng / mL, and 10 ng / mL respectively.

[0126] As Figure 5 shown, the specific process of this embodiment is as follows:

[0127] S1) Fix and block the first probe on the surface of the substrate, and then assemble to obtain a gold ball-sensitized heteroporous microfluidic array bioreaction chip;

[0128] S1.1) Clean the substrate: Place the substrate with a gold film on its surface in a piranha solution (H2SO4∶H2O2 = 3∶1, v / v) and clean for 30 minutes, then alternately clean 3 times with deionized water and ethanol (99%) to obtain the cleaned substrate.

[0129] S1.2) Prepare the first probe and the second probe: Prepare a ssDNA with a thiol group (-SH) at the end and a target complementary sequence as the first probe. The second probe starts to be complementary 10 nt from the thiol end of the first probe and is modified with a histidine (His) tag at the end;

[0130] The nucleotide sequence of the first probe Probe ssDNA-21 is shown in SEQ ID NO.2: 5’-TCAACATCAGTCTGATAAGCTA-3’SH;

[0131] The nucleotide sequence of the second probe Probe ssDNA-21-2 is shown in SEQ ID NO.8: 5’His-AGCATGGCATCTTAGCTTATCAGACTGATGTTGA;

[0132] Reduce the first probe: Add 0.01 mL of a 100 mmol / L TCEP solution to 0.5 mL of a 100 μmol / L first probe solution and let it stand for 2 hours to obtain the reduced first probe solution;

[0133] Fix the first probe: Dilute the reduced first probe solution so that the concentration of the reduced first probe is 10 μmol / L. Use a pipette to aspirate 200 μL of the diluted reduced first probe solution and drop it onto the gold film surface of the washed substrate. After standing for 2 hours, wash it 3 times with deionized water to obtain the substrate with the first probe fixed.

[0134] S1.3) Block the gold film chip: Prepare 3 mL of a 50 mmol / L MCH solution. Immerse the substrate with the first probe fixed completely in the MCH solution and incubate it with shaking at room temperature for 2 hours in the dark to obtain the substrate with the first probe blocked;

[0135] S1.4) Through the commercial PDMS-glass bonding process, couple and connect the microchannel reaction layer and the interface layer; then naturally adhere the gold film side surface of the substrate with the first probe blocked to the groove side surface of the microchannel reaction layer to obtain the assembled bio-reaction chip.

[0136] Load the assembled bio-reaction chip into the imaging SPR detector. Connect the latex tube part of the heteroporous microchannel to the peristaltic pump. Connect the stainless steel tube corresponding to the injection chamber to the sample cell through a latex tube, and connect the stainless steel tube corresponding to the outlet chamber to the waste liquid cell through a latex tube.

[0137] S2) Mix the target with the second probe and prepare the gold ball solution: Prepare a buffer solution with a pH of 3.5 using a 0.1 mmol / L hydrochloric acid solution and a 0.1% (v / v) DEPC water. Prepare a 200 μmol / L second probe solution using the buffer solution. Mix 2 mL of the second probe solution with 1 mL of the prepared target solution and incubate for 1 hour to obtain the target-second probe mixed solution. Dilute the gold balls with Ni 2+ NTA to 2 nmol / L using a buffer solution with a pH of 3.5 to obtain the gold ball solution.

[0138] S3) Capture the second probe: Use the peristaltic pump to pass the target-second probe mixed solution through each heteroporous microchannel on the assembled bio-reaction chip at a flow rate of 0.1 mL / min for 10 minutes.

[0139] S4) Fix the gold balls: Use the peristaltic pump to pass the gold ball solution through each heteroporous microchannel of the assembled bio-reaction chip at a flow rate of 0.2 mL / min for 10 minutes;

[0140] S5) After stopping the flow rate of the gold ball solution, let it stand for 20 minutes, and then control the washing liquid to pass through each of the heterogeneous microfluidic channels of the gold ball-sensitized heterogeneous microfluidic channel array bioreaction chip at a flow rate of 0.3 mL / min for 10 minutes to rinse the gold balls that have not specifically bound to the surface.

[0141] S6) Use an imaging SPR detector to perform real-time detection on the gold ball-sensitized heterogeneous microfluidic channel array bioreaction chip during the process of steps S3 to S5 to obtain detection signals.

[0142] Example 3

[0143] In this example, a bioreaction chip was prepared according to the same steps as in Example 1, and ssDNA extracted from cells was detected according to the same steps as in Example 2.

[0144] The difference between this example and Example 1 and Example 2 is that in this example, ssDNA extracted from Hela cells is used as the sample to be detected. The sample to be detected contains target 126. The nucleotide sequences of the first probe Probe ssDNA 126, the second probe Probe ssDNA 126-2, and target 126 are shown in SEQ ID NO.1, SEQ ID NO.7, and SEQ ID NO.4 respectively.

[0145] Example 4

[0146] In this example, a bioreaction chip was prepared according to the same steps as in Example 1, and ssDNA extracted from plasma was detected according to the same steps as in Example 2.

[0147] The difference between this example and Example 1 and Example 2 is that in this example, ssDNA extracted from plasma is used as the sample to be detected. The sample to be detected contains target 106. The nucleotide sequences of the first probe Probe ssDNA 106, the second probe Probe ssDNA 106-2, and target 106 are shown in SEQ ID NO.3, SEQ ID NO.9, and SEQ ID NO.6 respectively.

[0148] Comparative Example 1

[0149] This comparative example is a bioreaction chip provided with 12 homogeneous microfluidic channels. In the bioreaction chip of this comparative example, the coupling method between each structure is the same as that of the heterogeneous microfluidic channels. The only difference is the size of the grooves on the side where the microfluidic reaction layer is attached to the substrate. In the homogeneous microfluidic channels, 12 grooves are opened on the side where the microfluidic reaction layer is attached to the chip. Each groove is rod-shaped, 4 mm long, 1 mm wide, and 1 mm deep. Among them, the length of the groove refers to its dimension in the column direction.

[0150] In this comparative example, the nucleotide sequences of the first probe and the second probe are the same as those in Example 1.

[0151] Comparative Example 2

[0152] In this comparative example, the bio-reaction chip prepared in Comparative Example 1 was used to detect ssDNA standard products with different concentrations. The detection method and the nucleotide sequence of the target in this comparative example are the same as those in Example 2.

[0153] Comparative Example 3

[0154] In this comparative example, the bio-reaction chip prepared in Example 1 was used to detect ssDNA standard products with different concentrations (the target sequence is the same as that in Example 2).

[0155] The difference between the detection method used in this comparative example and that in Example 2 is that in step S2, a buffer solution with a pH of 7.8 was used to prepare the mixed solution and the gold ball solution. That is, in this comparative example, ordinary gold balls were used instead of the sensitized gold balls.

[0156] The effects of the present invention will be further described below in combination with the results of Examples 1 to 4 and Comparative Examples 1 to 3:

[0157] 1. Comparison of specific signals for detecting ssDNA standard solutions in the same-hole and different-hole microarray reaction systems

[0158] By comparing the detection results of the same-hole microchannel array reaction generator (Comparative Example 2) and the different-hole microchannel array reaction generator (Example 2), when the concentration of the target is 1 μg / mL, an SPR detector was used to record the signal intensities of the reaction processes in steps S3 to S5 in Example 2 and Comparative Example 2. The results are as Figure 6 shown.

[0159] It can be seen that the mismatched signal in the same-hole microarray (Comparative Example 2) accounts for 18% (2200 / (14300 - 2200)) of the normal paired signal, while the mismatched signal in the different-hole microarray (Example 2) is only 8% (800 / (10803 - 800)). This shows that the different-hole design of the microchannel array reduces the mismatched signal, that is, reduces the non-specific adsorption signal.

[0160] 2. Comparison of signals for detecting ssDNA standard sample solutions with or without sensitized gold balls in different-hole microarrays

[0161] Comparing the detection results using the sensitized gold balls (Example 2) and ordinary gold balls (Comparative Example 3), when the ssDNA standard solution was diluted to 1000, 500, 100, 50, and 10 ng / mL respectively using the chip prepared in Example 1, the chip was placed on the SPR detector, and the signal intensities of the reaction process from Step S4 to Step S5 were recorded. The results are as Figure 7 shown.

[0162] It can be seen that at the same concentration, compared with the ordinary gold balls (Comparative Example 3), the sensitized gold balls (Example 2) bring a greater signal response and higher sensitivity, indicating that the sensitized gold balls improve the adsorption efficiency of the target.

[0163] 3. Signals in different regions of the sample chamber of each heterogeneous microchannel

[0164] Figure 4 The signal intensities in different regions of the sample chamber of one of the heterogeneous microchannels in the detection results of Example 2 are shown. It can be seen that the aggregation and sedimentation of the gold balls are distributed as much as possible in the peripheral region of the large pores, leaving enough target-specific binding regions with the gold balls in the middle of the large pores, improving the specific binding situation.

[0165] 4. Detection of ssDNA concentration in cells and plasma

[0166] When detecting ssDNA extracted from cells and plasma (Example 3 and Example 4), the signals of the targets are significantly different from the non-target signals.

[0167] In summary, the bioreaction chip provided by the present invention can detect single-stranded DNA with a base length of 20 - 80 nt and a concentration of 10 ng / mL - 1 μg / mL. And a method for detecting single-stranded DNA using this bioreaction chip is provided. The method of the present invention not only reduces the possibility of gold ball aggregation and sedimentation, solves part of the non-specific adsorption signal problem, but also enhances the binding between the target and the gold ball, improving the adsorption efficiency of the target.

[0168] The above specific embodiments are used to explain and illustrate the present invention, rather than to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the protection of the claims fall within the protection scope of the present invention.

[0169] The above are only the preferred embodiments of the present invention. Therefore, any equivalent changes or modifications made according to the structures, features, and principles described in the scope of the patent application of the present invention are included in the scope of the patent application of the present invention.

[0170] The nucleotide sequences involved in the present invention are specifically as follows:

[0171] SEQ ID NO.1:

[0172] Name: Nucleotide Sequence of Probe ssDNA 126

[0173] DNA Type: DNA (other DNA)

[0174] Organism Source: synthetic construct

[0175] Sequence: CGCATTATTACTCACGGTACGA - SH

[0176] SEQ ID NO.2:

[0177] Name: Nucleotide Sequence of Probe ssDNA - 21

[0178] DNA Type: DNA (other DNA)

[0179] Organism Source: synthetic construct

[0180] Sequence: TCAACATCAGTCTGATAAGCTA - SH

[0181] SEQ ID NO.3:

[0182] Name: Nucleotide Sequence of Probe ssDNA 106

[0183] DNA Type: DNA (other DNA)

[0184] Organism Source: synthetic construct

[0185] Sequence: AGACGTGACAGTCGTGAAAT - SH

[0186] SEQ ID NO.4:

[0187] Name: Nucleotide Sequence of Target 126

[0188] DNA Type: DNA (other DNA)

[0189] Organism Source: synthetic construct

[0190] Sequence: TCGTACCGTGAGTAATAATGCG

[0191] SEQ ID NO.5:

[0192] Name: Nucleotide Sequence of Target 21

[0193] DNA type: DNA (other DNA)

[0194] Organism source: synthetic construct

[0195] Sequence: TAGCTTATCAGACTGATGTTGA

[0196] SEQ ID NO.6:

[0197] Name: Nucleotide sequence of target 106

[0198] DNA type: DNA (other DNA)

[0199] Organism source: synthetic construct

[0200] Sequence: ATTTCACGACTGTCACGTCT

[0201] SEQ ID NO.7:

[0202] Name: Nucleotide sequence of Probe ssDNA 126-2

[0203] DNA type: DNA (other DNA)

[0204] Organism source: synthetic construct

[0205] Sequence: His-ATCGAATAGTCTTCGTACCGTGAGTAATAATGCG

[0206] SEQ ID NO.8:

[0207] Name: Nucleotide sequence of Probe ssDNA-21-2

[0208] DNA type: DNA (other DNA)

[0209] Organism source: synthetic construct

[0210] Sequence: His-AGCATGGCATCTTAGCTTATCAGACTGATGTTGA

[0211] SEQ ID NO.9:

[0212] Name: Nucleotide sequence of Probe ssDNA 106-2

[0213] DNA type: DNA (other DNA)

[0214] Organism source: synthetic construct

[0215] Sequence: His-ATTTCACGACTGATTTCACGACTGTCACGTCT

Claims

1. A gold ball - enhanced heterogeneous microchannel array bioreaction chip, characterized in that: It includes at least one reaction chamber, and the reaction chamber is mainly composed of a sampling chamber, a microchannel, and a sample - discharging chamber. The sampling chamber and the sample - discharging chamber are arranged at intervals, and a microchannel is arranged on the central connection line between the sampling chamber and the sample - discharging chamber. The sampling chamber and the sample - discharging chamber are connected through the microchannel; the diameter of the sampling chamber is smaller than that of the sample - discharging chamber, and the width of the microchannel is the same as the diameter of the sampling chamber; The bioreaction chip is mainly composed of a substrate, a microchannel reaction layer, and an interface layer, which are stacked in sequence from bottom to top; a gold film is arranged on the top surface of the substrate, at least one heterogeneous microchannel is arranged on the bottom surface of the microchannel reaction layer, and each heterogeneous microchannel and the substrate enclose a reaction chamber. A plurality of stainless - steel tubes penetrate through the interface layer; The heterogeneous microchannel is mainly composed of two columnar grooves and a cubic groove. The two columnar grooves are arranged at intervals and are connected by the cubic groove. Each columnar groove is connected to the outside through a corresponding stainless - steel tube; the diameters of the two columnar grooves are different. The first columnar groove with a smaller diameter and the substrate enclose the sampling chamber, the second columnar groove with a larger diameter and the substrate enclose the sample - discharging chamber, and the cubic groove and the substrate enclose the microchannel; the cubic groove is arranged on the connection line between the centers of the two columnar grooves, and the width is the same as the diameter of the first columnar groove; The inner bottom surface of the reaction chamber is fixedly sealed with a first probe. The sampling chamber and the sample - discharging chamber are respectively connected to the outside. After the sample solution is injected into the sampling chamber, it flows into the sample - discharging chamber through the microchannel and then flows out from the sample - discharging chamber; the pH of the sample solution is 3 - 4, and the sample solution includes a mixed solution and a gold ball solution; the mixed solution contains a sample to be detected and a second probe; The sample to be detected contains a target, the target is single - stranded DNA with a base length of 20 - 80 nt, and the concentration of the target in the mixed solution is 10 ng / mL - 1 μg / mL; the gold ball is a nickel ion - nitrilotriacetic acid - modified gold nanoparticle with a concentration range of 1 - 10 nmol / L and a particle size range of 1.8 - 10 nm; The microchannel reaction layer is made of polydimethylsiloxane material, and the interface layer is made of polymethyl methacrylate material.

2. The gold sphere-sensitized heterogeneous pore microfluidic channel array bioreaction chip according to claim 1, characterized in that: The depths of the sampling chamber, the microchannel, and the sample - discharging chamber are the same, and the diameter ratio of the sampling chamber to the sample - discharging chamber is 1:

2.

3. A detection method using the gold ball-sensitized heterogeneous microchannel array bioreaction chip as described in any one of claims 1 to 2, characterized in that: The detection method includes the following steps: S1) Fix and seal the first probe on the surface of the substrate, and then assemble to obtain a gold ball - enhanced heterogeneous microchannel array bioreaction chip; S2) Prepare the gold ball solution and the mixed solution. The sample to be detected contains a target; the mixed solution contains a sample to be detected and a second probe; The pH values of both the gold ball solution and the mixed solution are 3 - 4; S3) Control the mixed solution to pass through each heterogeneous microchannel of the gold ball - enhanced heterogeneous microchannel array bioreaction chip; S4) Control the gold ball solution to pass through each heterogeneous microchannel of the gold ball - enhanced heterogeneous microchannel array bioreaction chip; S5) After standing, control the washing solution to pass through each heterogeneous microchannel of the gold ball - enhanced heterogeneous microchannel array bioreaction chip; S6) Use an optical detection device to detect the gold ball-sensitized heterogeneous pore microchannel array bioreaction chip to obtain detection signals.

4. The detection method according to claim 3, wherein: In the step S3, the flow rate is 0.1~0.5 mL / min and the passing time is 10~20 min; in the step S4, the flow rate is 0.2~0.5 mL / min and the passing time is 10~20 min; in the step S5, leave it standing for 10~20 min.

5. The detection method according to claim 3, wherein: The first probe is a single-stranded DNA containing a target complementary fragment and modified with a mercapto group at the end; the second probe is a single-stranded DNA modified with a histidine tag at the head and complementary base-paired with the first probe at the end.

6. Use of the gold ball-sensitized heterogeneous pore microchannel array bioreaction chip according to any one of claims 1~2 in detecting nucleic acid molecules.

Images