Coelastrella sp. B2 and application thereof

Abstract

The application discloses a Coelastrella sp. B2 strain, which can obviously improve soil quality, increase soil nutrient content, enhance microbial activity, and promote nutrient transformation and utilization. The strain can also synthesize metabolites with plant growth regulation and stress resistance enhancement functions, improve plant salt tolerance, and produce insecticidal metabolites to provide natural insect resistance protection for plants. In addition, the Coelastrella sp. B2 increases the abundance of various beneficial microorganisms in the soil, which play an important role in promoting plant growth, enhancing stress resistance, promoting nitrogen absorption, enhancing heavy metal pollution tolerance, participating in pesticide stress response, and inhibiting pathogenic bacteria, thereby improving the soil environment and promoting the healthy growth of plants.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically a stress-resistant and growth-promoting single-star algae, Coelastrella sp. B2, and its applications. Background Technology

[0002] Agriculture is my country's primary industry and a crucial prerequisite for the sustainable development of other industries. Developing ecological agriculture, which combines agricultural production with ecological environmental protection, and promotes the sustainable development of the agricultural economy, is an inevitable trend in my country's agricultural production. Among these technologies, biotechnology centered on agricultural microbial resources is beneficial for increasing grain yields and maintaining environmental health, thus meeting the needs of modern ecological agriculture development.

[0003] In recent years, my country's agricultural microbial market has experienced rapid growth, but the market potential remains significant. Microalgae, in particular, are tiny algal communities whose morphology can only be discerned under a microscope. They are characterized by rapid reproduction and strong environmental adaptability. Furthermore, microalgae cultivation offers numerous advantages and broad application prospects, including not requiring arable land; utilizing seawater to conserve freshwater; utilizing livestock wastewater for environmental remediation; and efficiently utilizing CO2 resources. Therefore, microalgae are considered a treasure trove of novel, strategic biological resources and a hot research area in the international biotechnology industry. Currently, agricultural microalgae strains and products are relatively scarce, indicating substantial room for development.

[0004] Currently discovered Coelastrella sp. algae are mainly used for removing pollutants such as ammonia nitrogen from wastewater and as a feedstock for biodiesel production. In the agricultural field, there are only reports on the tolerance range of NaCl concentration and pH of the single-star algae Coelastrella sp. SDEC-28, as well as its effect on reducing the conductivity and pH of leachate from saline-alkali soils. Reports on the effects of Coelastrella sp. algae on plant growth and stress resistance, soil nutrients and soil microbial composition, and its metabolites are still lacking. Summary of the Invention

[0005] This invention aims to address the problems existing in the prior art by introducing a single-star algal strain named *Coelastrella* sp. B2. This strain offers multiple benefits: it significantly improves soil quality, specifically by increasing the levels of organic matter, available nitrogen, available phosphorus, available potassium, and total nitrogen and phosphorus in the soil. Simultaneously, it enhances soil microbial activity, including increasing microbial biomass carbon and nitrogen, thereby effectively promoting the transformation and utilization of soil nutrients. Furthermore, this algal strain can synthesize metabolites with plant growth-regulating functions. These metabolites not only directly promote plant growth and development but also enhance plant stress resistance, particularly its salt tolerance. More significantly, *Coelastrella* sp. B2 also produces insecticidal metabolites, providing plants with natural insect protection and potentially significantly improving their resistance to pests. In addition, this algal strain increased the abundance of microorganisms in the soil, including Pontibacter, Nitrospira, Archangium, Nocardioides, and Actinophytocola. These microorganisms play important roles in promoting plant growth and enhancing plant stress resistance, promoting plant nitrogen nutrient absorption, enhancing plant tolerance to heavy metal pollution, participating in plant responses to pesticide stress, and inhibiting plant pathogens, thereby improving the soil environment and promoting healthy plant growth.

[0006] This invention is achieved through the following technical solution:

[0007] This invention discloses Coelastrella sp. B2, an alga isolated from grassland soil in Shijiazhuang City, Hebei Province, China. The algal strain has been deposited at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on December 31, 2024, with accession number CCTCC NO: M20242971.

[0008] The stress-resistant and growth-promoting single-star algae Coelastrella sp. B2 has colonies that are dark green and protruding with smooth edges.

[0009] The stress-resistant and growth-promoting single-star algae Coelastrella sp.B2 has the tufA gene sequence shown in SEQ ID NO.1 and belongs to the genus Coelastrella.

[0010] The aforementioned stress-resistant and growth-promoting single-star algae, *Coelastrella* sp. B2, can regulate soil nutrients and promote their availability. This is mainly manifested in an increase of 2.72%–5.81% in soil organic matter, approximately 10.18% in available nitrogen, 7.19%–22.26% in available phosphorus, 10.31%–17.86% in available potassium, 0.70%–5.12% in total nitrogen, 9.42%–9.62% in total phosphorus, and approximately 0.76%–10.49% in total potassium.

[0011] The stress-resistant and growth-promoting algae *Coelastrella* sp. B2, under salt stress of 8.72 g / kg (NaCl / dry soil), can promote plant growth and improve plant salt tolerance. Taking wheat as an example, the main effects are an increase in aboveground fresh weight of 10.81%–54.05%, an increase in plant height of 10.07%–10.44%, and a decrease in malondialdehyde (MDA) content in the plant (including in stems and leaves) of 5.72%–12.45%.

[0012] The stress-resistant and growth-promoting single-star algae *Coelastrella* sp. B2 described in this invention can produce a variety of metabolites with significant biological activity. Specifically:

[0013] This single-star algae can produce a series of metabolites that can be used as plant growth regulators. These metabolites include diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and laurylamide, which have significant regulatory effects on plant growth.

[0014] In addition, this single-star alga can also produce metabolites that promote plant growth or enhance plant stress resistance, such as palmitic acid, pentanamide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, and L-isoleucine-L-threonine. These metabolites are excellent in improving plant growth performance and stress resistance.

[0015] It is worth noting that the stress-resistant and growth-promoting single-star algae Coelastrella sp. B2 can also produce capsaicin, a metabolite with insecticidal activity, providing new possibilities for the development of biopesticides.

[0016] Furthermore, this invention also reveals the positive impact of this single-star algae on the structure of soil microbial communities. Specifically, it can increase the abundance of beneficial microorganisms in the soil, such as Pontibacter, Nitrospira, Archangium, Nocardioides, and Actinophytocola, thereby improving the soil environment and promoting healthy plant growth.

[0017] Based on the above findings, the present invention further proposes several application schemes:

[0018] A microalgae preparation comprising the above-mentioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2 or its extracts and cultures.

[0019] A microbial fertilizer comprising at least the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed form, or the aforementioned microalgae preparation, to provide the nutrients required by plants and promote their growth.

[0020] A soil conditioner, also comprising the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed form, or the aforementioned microalgae preparation, for improving soil structure and enhancing soil fertility.

[0021] A plant growth regulator comprising the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed form, or the aforementioned microalgae preparation, to precisely regulate the plant growth process.

[0022] A biostimulant, also comprising the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed form, or the aforementioned microalgae preparation, for stimulating plant growth and development.

[0023] A biological pesticide, comprising a carrier and an active ingredient, wherein the active ingredient includes the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed product, provides a green and environmentally friendly pest and disease control solution for agricultural production.

[0024] Furthermore, this invention also proposes applications of the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, microalgae preparations, or microbial fertilizers in the following fields:

[0025] It enhances crop resistance to stress, especially salt tolerance, helping crops maintain healthy growth even in harsh environments;

[0026] Promote crop growth by providing essential nutrients and bioactive substances, thereby accelerating the crop growth process;

[0027] Soil improvement creates better environmental conditions for crop growth by improving the structure of soil microbial communities and increasing soil fertility.

[0028] Finally, the present invention also proposes corresponding implementation methods:

[0029] A method for improving crop stress resistance, promoting crop growth, and improving soil, comprising adding the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, microalgae preparations, or microbial fertilizers to the soil in which crops are grown.

[0030] A method for preparing a biopesticide, which uses the aforementioned stress-resistant and growth-promoting single-star algae Coelastrella sp. B2, its culture or processed products, provides a new technical approach for the production of biopesticides.

[0031] The advantages and beneficial effects of this invention are as follows:

[0032] The stress-resistant and growth-promoting single-star algae Coelastrella sp. B2 described in this invention exhibits many significant advantages and beneficial effects, specifically in the following aspects:

[0033] 1. Soil improvement and nutrient enhancement:

[0034] This single-star algae can significantly increase the content of organic matter, alkaline nitrogen, available phosphorus, and readily available potassium in the soil, while also improving the levels of total nitrogen, total phosphorus, and total potassium, thereby comprehensively improving soil nutrient status. By increasing soil microbial biomass carbon and microbial biomass nitrogen, this invention promotes the availability of soil nutrients, enhances the soil's ability to provide nutrients to plants, and provides valuable resources and technical support for developing efficient and environmentally friendly soil improvement technologies.

[0035] 2. Enhance plant salt tolerance and promote growth:

[0036] Under high salt stress conditions (e.g., 8.72 g / kg NaCl / dry soil), Coelastrella sp. B2 exhibits excellent stress resistance, significantly promoting the growth of crops such as wheat, increasing above-ground fresh weight and plant height, while reducing malondialdehyde (MDA) content in plants, effectively alleviating the damage caused by salt stress. This characteristic makes this single-star alga an ideal material for preparing microbial inoculants and biofertilizers, opening up new avenues for developing crop salt-tolerant and yield-increasing technologies based on microalgae.

[0037] 3. Abundant plant growth regulators:

[0038] Coelastrella sp. B2 produces a variety of metabolites that regulate plant growth, including diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and laurylamide; as well as metabolites that promote plant growth or enhance plant stress resistance, including palmitic acid, pentanamide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, and L-isoleucine-L-threonine. These substances play important roles in promoting plant growth and enhancing plant stress resistance. Especially under salt stress conditions, these metabolites can further enhance the plant's salt tolerance, reduce the degree of lipid peroxidation in stem and leaf cell membranes, and protect the plant from salt damage.

[0039] 4. Insecticidal activity and insecticidal potential:

[0040] It is worth noting that this single-star alga can also produce capsaicin, a metabolite with insecticidal activity, which provides new possibilities for the development of biopesticides, and is expected to improve the insect resistance of plants, reduce the use of chemical pesticides, and promote sustainable agricultural development.

[0041] 5. Increase the abundance of beneficial microorganisms in the soil:

[0042] This single-star algae significantly increases the abundance of various beneficial microorganisms in the soil, including *Pontibacter*, *Nitrospira*, *Archangium*, *Nocardioides*, and *Actinophytocola* (a member of the Actinobacteria phylum). These microorganisms play a crucial role in the soil, not only promoting plant growth but also enhancing plant resistance to adverse conditions such as salt and drought. They also promote nitrogen absorption and utilization, improving plant nutrition and further promoting growth and development. Simultaneously, they enhance plant tolerance to heavy metal pollution, protecting plants from environmental damage.

[0043] 6. Broad application prospects:

[0044] Based on the aforementioned advantages and beneficial effects, Coelastrella sp. B2 demonstrates broad application prospects in various fields, including soil conditioners, microbial fertilizers, plant growth regulators, biostimulants, and biopesticides. It not only provides green and environmentally friendly solutions for agricultural production but also offers abundant resources and technical support for the development of novel and efficient agricultural biotechnology products.

[0045] In summary, the stress-resistant and growth-promoting single-star algae Coelastrella sp. B2 described in this invention has multiple advantages and beneficial effects, such as significant soil improvement, plant growth promotion, enhanced stress resistance, and insecticidal activity, injecting new vitality into the sustainable development of modern agriculture.

[0046] Preservation Information

[0047] Coelastrella sp. B2, this strain has been deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on December 31, 2024, with accession number CCTCC NO: M20242971. Attached Figure Description

[0048] Figure 1 These are colony observation images of the single-star algae Coelastrella sp. B2 of this invention, (a) front view, (b) back view;

[0049] Figure 2 This is a phylogenetic tree of the tufA gene sequence of the single-star algae Coelastrella sp. B2 of this invention;

[0050] Figure 3 This is an observational diagram showing how the algal cells of the single-star algae Coelastrella sp. B2 promote wheat growth under salt stress conditions.

[0051] Figure 4 This is an observational diagram showing the effect of the culture supernatant of the single-star algae Coelastrella sp. B2 on promoting wheat growth under salt stress.

[0052] Figure 5 This invention relates to the effects of algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on wheat plant height and aboveground fresh weight under salt stress conditions;

[0053] Figure 6 This invention relates to the effects of algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on the malondialdehyde (MDA) content of wheat plants under salt stress conditions;

[0054] Figure 7 This invention relates to the effects of the algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on soil organic matter content;

[0055] Figure 8 This invention relates to the effects of the algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on the content of soil nutrients (alkaline nitrogen, available phosphorus and available potassium);

[0056] Figure 9 This invention relates to the effects of the algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on the content of soil nutrients (total nitrogen, total phosphorus, and total potassium);

[0057] Figure 10 This invention relates to the effects of the algal cells and culture supernatant of the single-star algae Coelastrella sp. B2 on soil microbial biomass carbon, nitrogen, and phosphorus.

[0058] Figure 11 This invention relates to the effects of algal cells and culture supernatants of the single-star algae Coelastrella sp. B2 on soil microbial species and their abundance.

[0059] For those skilled in the art, other related figures can be obtained from the above figures without any creative effort. Detailed Implementation

[0060] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described below with reference to specific embodiments.

[0061] In this paper, the terms “stress-resistant and growth-promoting single-star algae Coelastrella sp. B2”, “single-star algae Coelastrella sp. B2”, “Coelastrella sp. B2” and “B2” are interchangeable.

[0062] Example 1: Isolation, purification and culture of Coelastrella sp. B2

[0063] Sample source: Grassland soil from Shijiazhuang City, Hebei Province, China.

[0064] Preparation of A&A medium: Refer to the patent "A Chlamydomonas aeruginosa strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0065] Preparation of BG11 medium: Prepare according to the usage requirements of BG11 medium (Haibo Biotechnology, catalog number HB8793), autoclave, and then cool to room temperature.

[0066] Separation and purification steps: Refer to the patent "A Chlamydomonas aeruginosa strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0067] Example 2: Identification of Coelastrella sp. B2

[0068] 1) Identification of biological characteristics

[0069] The single-star algae *Coelastrella* sp. B2 forms dark green, raised colonies on BG11 medium with smooth edges. Figure 1 ).

[0070] 2) System classification and identification

[0071] Take an appropriate amount of B2 culture medium into a sterile 2mL centrifuge tube, centrifuge repeatedly, discard the supernatant until a certain amount of microalgae B2 cells are obtained. Transfer the B2 cells to... B2 genomic DNA was extracted into Lysing Matrix E tubes using the SPIN kit (MPBiomedicals, USA) following the prescribed procedure. The tufA gene sequence was amplified using primers tufAF (5'-GGNGCNGCNCAAATGGAYGG-3') and tufAR (5'-CCTTCNCGAATMGCRAAWCGC-3') (Ao Yuan, 2020). The PCR reaction volume was 50 μL, containing 10 μL EasyTaq buffer, 5 μL dNTPs, 0.5 μL primer 18F, 0.5 μL primer 18R, 1.5 μL DNA template, 2 μL EasyTaq DNA polymerase, and finally, sterile ultrapure water was added to bring the volume to 50 μL. The PCR reaction program was as follows: (i) 95℃ for 3 min pre-denaturation; (ii) 35 cycles of 94℃ for 30 s denaturation, 56℃ for 30 s annealing, and 72℃ for 1 min extension; (iii) final extension at 72℃ for 7 min. The PCR amplification products were submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The obtained tufA gene sequence of B2 is shown in SEQ ID NO.1.

[0072] The sequenced tufA gene sequence was homology-aligned using the NCBI (National Center for Biotechnology Information) database website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed. Figure 2The results showed that the tufA gene of Algae B2 forms a relatively stable evolutionary branch (bootstrap value of 78) with the tufA gene of three Algae from the Scenedesmaceae family, including Scenedesmaceae sp. YH-2023b, Asterarcys sp. GP-2019, and Coelastrella saipanensis strain KM2-2, and is the most evolutionarily distant from the tufA gene of Coelastrella saipanensis strain KM2-2. Furthermore, the tufA gene sequence of *Coelastrella tenuitheca isolate* FACHB-2315 (MH176147), *Coelastrella sp. QW-2021strain* FACHB-3315 (MW729747), and *Coelastrella sp. QW-2021strain* FACHB-3314 (MW729746) showed the highest similarity, with similarities of 100%, 97.16%, and 97.26%, respectively. Therefore, the *Coelastrella* sp. B2 obtained in this invention was identified as belonging to the genus *Coelastrella* of the subfamily Coelastroideae of the family Scenedesmaceae in the order Sphaeropleales of the class Chlorophyceae, and was named *Coelastrella sp. B2*.

[0073] Example 3: Effects of Coelastrella sp. B2 on wheat growth and salt tolerance under salt stress.

[0074] The wheat pot experiment was conducted with the following treatment groups: a negative control (labeled Control), a positive control (labeled BG11, mainly used to compare with the culture supernatant to eliminate the influence of the culture medium itself and to verify the effectiveness of the B2 metabolite), experimental groups treated with Coelastrella sp. B2 algal cell suspension (labeled B2 (algal cells)), and Coelastrella sp. B2 culture supernatant (labeled B2 (supernatant)). The Coelastrella sp. B2 culture medium was aliquoted into 50 mL sterile centrifuge tubes and centrifuged at 8500 rpm for 40 min. The supernatant was slowly poured into a new sterile Erlenmeyer flask, which served as the Coelastrella sp. B2 culture supernatant. After thorough removal of the supernatant, the algal cells were resuspended twice in sterile water (centrifuged at 8500 rpm for 40 min, supernatant removed, this operation repeated twice). The algal cells were then resuspended in sterile water to obtain the Coelastrella sp. B2 algal cell suspension; the algal cell content in 20 mL of Coelastrella sp. B2 algal cell suspension ranged from 0.0047 g to 0.0132 g. This experiment included a total of 4 treatment groups, each group was repeated 3 times to ensure the reliability of the experimental results (see wheat growth observation chart for details). Figure 3 and Figure 4 ).

[0075] The experiment used saline-alkali farmland soil that had been sieved through a 2mm sieve and thoroughly mixed. The soil had a salt content of 0.9 g / kg (NaCl / dry soil). The soil was packaged in pots containing 330 g of dry soil, and all pots were planted with the "Malan No. 1" wheat variety. Sixteen wheat seeds were sown in each pot. After uniform germination, thinning was performed, ultimately retaining six healthy wheat seedlings per pot.

[0076] The experimental culture conditions were set at a constant temperature of 25℃, with a photoperiod of 16 hours of light and 8 hours of darkness. In the early stages of wheat seedling growth, sterile water was used for irrigation to maintain normal growth. Once the seedlings reached a robust stage, salt stress treatment was initiated, involving irrigation with a 4 g / L NaCl solution. The irrigation frequency was adjusted according to soil moisture and plant growth requirements, irrigating every 1–3 days until the soil NaCl content reached approximately 8.72 g / kg (NaCl / dry soil), at which point NaCl irrigation was discontinued. Subsequently, 20 mL of Coelastrella sp. B2 algal cell suspension and Coelastrella sp. B2 culture supernatant were respectively applied to the soil. A negative control (Control) was applied using sterile water, and a positive control (BG11) was applied using BG11 culture medium. A total of 5 irrigations were performed during this phase to ensure the adequacy of the experimental treatment.

[0077] Experimental results are as follows Figure 3 , Figure 4 , Figure 5 and Figure 6 As shown, under severe salt stress (8.72 g / kg NaCl / dry soil), both the B2 (algal cells) and B2 (supernatant) treatments significantly promoted wheat growth. Specifically, compared with the negative control (Control), the aboveground fresh weight of wheat treated with B2 (algal cells) increased by 10.81%; while the aboveground fresh weight of wheat treated with B2 (supernatant) increased even more dramatically by 54.05%, and also increased by 29.55% compared with the positive control (BG11). In addition, the plant height of wheat treated with B2 (supernatant) also increased significantly, by 10.07% compared with the negative control (Control) and by 10.44% compared with the positive control (BG11).

[0078] In summary, the *Coelastrella* sp. B2 algal cells and their culture supernatant described in this invention significantly promote wheat growth under severe salt stress. These promoting effects are mainly reflected in the increase of above-ground fresh weight and plant height, as well as the decrease in malondialdehyde (MDA) content in the plants (including stems and leaves), thereby effectively reducing the degree of cell membrane lipid peroxidation in wheat under salt stress and alleviating the damage caused by salt stress.

[0079] Example 4: Effects of Coelastrella sp. B2 on soil nutrients under salt stress

[0080] Soil samples were collected after wheat harvest in Example 3, and comprehensive and detailed measurements were performed on the soil, including seven major nutrient indicators: organic matter, available nitrogen, available phosphorus, available potassium, total nitrogen, total phosphorus, and total potassium; and three major microbial biomass indicators: microbial biomass carbon, microbial biomass nitrogen, and microbial biomass phosphorus, for a total of 10 key indicators. The measurement results are as follows: Figure 7 , Figure 8 , Figure 9 and Figure 10 As shown, the specific improvements are as follows:

[0081] (1) Overall effects under severe salt stress:

[0082] Under severe salt stress (8.72 g / kg NaCl / dry soil), both the B2 (algal cells) and B2 (supernatant) treatments significantly increased the content of available nutrients such as organic matter, alkaline nitrogen, available phosphorus, and available potassium in the soil, while also increasing the total nutrient reserves, including total nitrogen, total phosphorus, and total potassium. More importantly, both treatments also significantly increased soil microbial biomass carbon and microbial biomass nitrogen, indicating enhanced soil microbial activity and thus improving the soil's effectiveness and capacity to provide nutrients for plant growth.

[0083] (2) Comparison with negative control treatment:

[0084] Compared with the negative control (Control) without any special treatment, the soil organic matter, available nitrogen, available phosphorus, available potassium, total nitrogen, and total phosphorus increased by 5.81%, 10.18%, 22.26%, 17.86%, 5.12%, and 9.62% respectively under the B2 (algal cell) treatment, demonstrating its comprehensive soil improvement effect. The B2 (supernatant) treatment also showed a significant soil improvement effect, with increases in soil organic matter, available phosphorus, available potassium, total nitrogen, total phosphorus, and total potassium of 2.72%, 7.19%, 10.34%, 0.70%, 9.42%, and 0.76% respectively. Although the increases in some indicators were slightly lower than those under the B2 (algal cell) treatment, it still showed a significant soil improvement effect. The soil microbial biomass carbon and nitrogen increased by 38.02% and 4.61% respectively under the B2 (algal cell) treatment, and by 38.97% and 72.24% respectively under the B2 (supernatant) treatment, thus improving the soil's ability to provide nutrients to plants and promoting plant growth.

[0085] (3) Comparison with the positive control (BG11) treatment:

[0086] To further verify the soil improvement effects of the B2 (algal cells) and B2 (supernatant) treatments, we compared them with the positive control (BG11). The results showed that compared with the BG11 treatment, the B2 (algal cells) treatment increased soil organic matter, available potassium, total nitrogen, and total potassium by 1.02%, 17.83%, 1.82%, and 7.33%, respectively, indicating better performance in these key nutrient indicators. Similarly, the B2 (supernatant) treatment also showed advantages, with increases in available potassium and total potassium of 10.31% and 10.49%, respectively. Although the increases in soil organic matter and total nitrogen were not significant, it showed a clear advantage in potassium supply. Soil microbial biomass carbon increased by 32.99% under the B2 (algal cells) treatment, and soil microbial biomass carbon and microbial biomass nitrogen increased by 33.90% and 19.11%, respectively, improving the soil's ability to provide nutrients to plants and promoting plant growth.

[0087] Example 5: Determination of metabolites from the algae Coelastrella sp. B2

[0088] Single colonies of Coelastrella sp. B2 growing well on solid BG11 medium were picked and inoculated into 50 mL of autoclaved liquid BG11 medium. The culture was carried out at 25°C and 160 rpm with a 12-hour light / 12-hour dark photoperiod for 14 days to ensure sufficient growth and reproduction of the algae. Subsequently, an appropriate amount of Coelastrella sp. B2 algal culture was taken and inoculated again into 50 mL of fresh BG11 liquid medium, with six replicates to improve data reliability. Under the same culture conditions (25°C, 160 rpm, 12-hour light / 12-hour dark), the culture continued until the algae reached the predetermined growth stage. The supernatant, rich in metabolites produced by Coelastrella sp. B2, was collected by centrifugation at 8000 rpm for 5 min and labeled as B2.

[0089] Meanwhile, for the purpose of a control experiment, 50 mL of BG11 liquid medium without Coelastrella sp. B2 algae inoculation was used, with 6 replicates, and cultured under the same conditions. The collected supernatant was used as the control sample and labeled as Control.

[0090] The collected B2 and Control supernatant samples were promptly stored at -80°C to maintain their stability. Subsequently, the samples were submitted to Shanghai Paisennuo Biotechnology Co., Ltd. for professional metabolomics analysis. The metabolomics results showed that the Coelastrella sp. B2 algal strain described in this invention can produce a variety of bioactive metabolites.

[0091] Metabolites such as diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and laurylamide can be used as plant growth regulators, significantly promoting plant growth. Furthermore, metabolites such as palmitic acid, pentanamide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, and L-isoleucine-L-threonine not only promote plant growth but also enhance plant stress resistance. Particularly under salt stress, they significantly improve salt tolerance and reduce cell membrane lipid peroxidation in plants like wheat, effectively mitigating the damage caused by salt stress. It is worth mentioning that this algal strain can also produce capsaicin, a metabolite with insecticidal activity. This indicates that Coelastrella sp. B2 not only has the potential to promote plant growth and improve plant stress resistance, but may also have the application prospect of improving plant insect resistance, providing new biological resources and technical support for sustainable agricultural development.

[0092] Example 6: Effects of Coelastrella sp. B2 on soil microbial composition under salt stress

[0093] Soil samples were collected after wheat harvest in Example 3, and the following methods were used. The SPIN reagent kit (MPBiomedicals, USA) was used, and the provided operating procedures were strictly followed to extract microbial DNA from the soil. Subsequently, the extracted soil microbial DNA samples were submitted to Shanghai Paisenno Biotechnology Co., Ltd., where sequencing technology was used to amplify and sequence the bacterial 16S rRNA gene. The sequencing results are as follows: Figure 11 As shown, comparative analysis reveals the following:

[0094] Compared to Control processing and BG11 processing:

[0095] Both the B2 (algal cell) and B2 (supernatant) treatments significantly increased the abundance of microorganisms such as *Pontibacter*, *Nitrospira*, and *Archangium* in the soil. In particular, the B2 (supernatant) treatment additionally increased the abundance of *Nocardioides* and *Actinophytocola* microorganisms in the soil. These microorganisms play important roles in the soil ecosystem, participating not only in the cycling and transformation of soil nutrients but also promoting plant growth and development by producing various bioactive substances. Furthermore, these microorganisms possess decomposition capabilities and the ability to utilize complex organic matter, potentially playing a significant role in promoting nitrogen uptake by plants and enhancing plant stress resistance.

[0096] These microorganisms have demonstrated significant functions and potential in promoting plant growth, enhancing plant stress resistance, promoting nitrogen nutrient absorption, increasing plant tolerance to heavy metal pollution, participating in plant responses to pesticide stress, and inhibiting plant pathogens. Their presence and increased abundance undoubtedly provide strong support for improving the soil environment and promoting healthy plant growth.

[0097] SEQ ID NO:1

[0098] >B2_tufA

[0099] >B2_843bp

[0100] TAAATTAATTGAACTGTTACTTCGATACGGTCTCCAGGCATAGCCATTTTATTTGAATGTT

[0101] CTTCAGCTACTGAAGAAGGGTTTTTCATTTGAATATGACTAAAACTTACGATTTTTCCAG

[0102] TTACATCAGTAGTACGAATGAAGAACTGTGGTTGATATCCAACTAAAAAAGGTGAGTGA

[0103] CGACCACCTTCTTCTTTTGTTAAAACATAAACTTGTGCTTCAAATTTTGTATGCGGAGTAA

[0104] TTGAACCTGGTTTTGCTAAAACCATTCCACGTTCTACATCTTTTTTTGAATACCACGTAA

[0105] AAGTACACCTACATTATCACCAGCCATTGTTTCATCTAATGTTTTTTTGAACATTTCAAGA

[0106] CCTGTTACAACTGTAGATTTTGTATCTTTTAATCCAACAAGTTCAACGTTTTCACCTACTT

[0107] TTAAAGTTCCTCTTTCAACACGTCCTGTTGCCACAGTTCCACGACCTGTGATAGATAAAA

[0108] CATCTTCAACTGCTAATAAGAAAGGTTTTTCTGTTTCACGATCTGGTGTTGGAATGTATTT

[0109] ATCTACTTGATCCATTAAATCATAGATTTTGTCTACCCATGTATTTTCACCACGTTTAACTG

[0110] AAGGTTTTCAACTAGAGCTTCTAAAGCTAATAAAGCTGATCCACTTACAACTGGAATTT

[0111] CATCTCCTGGAAATTCATATTTATCTAATGTTTCACGAACTTCTAATTCAACTAATTCTAAT

[0112] AATTCAGCATCGTCAACTTGGTCTTCTTTATTTAAGAATACAACCATGTTTGGTACACCTA

[0113] CTTGTTTTGCTAATAAGATGTGTTCTTTTGTTTGGGGCATGGGACCATCTGCA

[0114] The present invention has been described above by way of example. It should be noted that any simple modifications, alterations or other equivalent substitutions that can be made by those skilled in the art without creative effort without departing from the core of the present invention fall within the protection scope of the present invention.

Claims

1. A stress-resistant and growth-promoting single-star algae ( Coelastrella sp. B2, characterized in that, It was deposited at the China Center for Type Culture Collection on December 31, 2024, with accession number CCTCC NO:M 20242971.

2. A microalgae preparation, characterized in that, Including the stress-resistant and growth-promoting single-star algae according to claim 1 ( Coelastrella sp. B2 or its culture.

3. The microalgae preparation according to claim 2, characterized in that, The microalgae preparation is a microbial fertilizer, soil conditioner, or plant growth regulator for wheat under salt stress conditions.

4. A stress-resistant and growth-promoting single-star algae according to claim 1 ( Coelastrella sp. B2. The application of the microalgae preparation described in claim 2 or claim 3 in improving the salt resistance of wheat, promoting wheat growth under salt stress, or improving saline-alkali soil.

5. The application according to claim 4, characterized in that, The stress-resistant and growth-promoting single-star algae described in claim 1 ( Coelastrella sp. B2. The microalgae preparation described in claim 2 or claim 3 is added to saline-alkali soil where wheat is grown.

Images