Chlorella sorokiniana K2 and application thereof
By isolating and culturing Chlorella sorokiniana K2, the problems of insufficient soil nutrient conditioning and plant stress resistance in the agricultural field have been solved. Soil nutrient enhancement and plant growth promotion have been achieved, and a variety of metabolites have been provided for plant protection. It is suitable for microbial fertilizers and biopesticides.
Patent Information
- Application Number
- CN202510071198.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-01-16
AI Technical Summary
The research and application of Chlorella species in agriculture is relatively lagging behind in the current technology, and there is a lack of research and application on their effects on plant growth and stress resistance, especially in soil nutrient conditioning and plant protection under salt stress conditions.
A strain of Chlorella sorokiniana K2 was provided. This strain was obtained through isolation and cultivation. It can increase soil organic matter, alkaline nitrogen, available phosphorus and available potassium, and other nutrients. At the same time, it produces metabolites with plant growth regulation, stress resistance and insecticidal effects, which can be applied to microbial fertilizers, soil conditioners and biopesticides.
It significantly improves soil nutrient availability, promotes plant growth and salt tolerance, enhances plant stress resistance and insect resistance, provides a variety of metabolites for plant protection, and is suitable for microbial fertilizers, soil amendments, and biopesticides.
Smart Images

Figure CN119875844B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically a salt-resistant and growth-promoting Chlorella sorokiniana K2 strain and its applications. Background Technology
[0002] Microalgae are tiny algal communities characterized by rapid photosynthesis, high reproduction rates, and strong environmental adaptability. Their morphology is only discernible under a microscope. Their cellular metabolism produces fats, proteins, pigments, and polysaccharides. Due to their highly efficient photosynthesis and rich nutritional value, they are widely used in various industries, including food, nutrition products, biomedicine, aquaculture, animal feed, environmental protection, and bioenergy. They are considered to have enormous potential to address major real-world challenges such as the shortage of healthy food, the worsening greenhouse effect, environmental pollution, and the energy crisis. In contrast, research and application of microalgae in agriculture have lagged behind.
[0003] Currently, research on the *Chlorella* species *Sorokiniana* mainly focuses on the application of its metabolites, such as lipids, polysaccharides, proteins, and lutein, in the food, feed, and biomass energy sectors, as well as their application in purifying livestock and poultry wastewater. In the agricultural sector, research and application of *Sorokiniana* and its metabolites on plant growth and stress resistance, as well as soil nutrients, are lacking. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a *Chlorella sorokinina* strain, K2, which can increase soil organic matter, available nitrogen, available phosphorus, and available potassium, as well as total nitrogen, total phosphorus, and total potassium, and improve soil microbial biomass carbon and microbial biomass nitrogen, thereby promoting the availability of soil nutrients. Simultaneously, this strain can produce metabolites that can be used as plant growth regulators, as well as metabolites that promote plant growth or enhance plant stress resistance, thereby promoting plant growth, reducing cell membrane lipid peroxidation and cell damage, and improving plant salt tolerance. Furthermore, this strain can produce metabolites that can be used as insecticides, thus having the potential to improve plant insect resistance.
[0005] This invention is achieved through the following technical solution:
[0006] This invention discloses the following information regarding Chlorella sorokinina K2 isolated from grassland soil in Shijiazhuang City, Hebei Province, China:
[0007] This Chlorella has been deposited at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The specific deposit date is January 8, 2025, and the accession number is CCTCC NO:M 2025065.
[0008] The characteristics of salt-tolerant and growth-promoting Chlorella sorokiniana K2 are described as follows:
[0009] Its colonies are dark green and protruding with smooth edges. The tufA gene sequence of this Chlorella species has been identified, as shown in SEQ ID NO.1, and it belongs to the Chlorella sorokiniana species.
[0010] Specific data regarding soil nutrient conditioning and plant growth promotion are as follows:
[0011] Salt-tolerant and growth-promoting Chlorella sorokiniana K2 can significantly regulate soil nutrients and promote their availability. Specifically, it can increase soil organic matter content by 0.70%–5.48%, available nitrogen content by approximately 9.81%, available phosphorus content by 37.78%–140.03%, available potassium content by 10.99%–14.56%, total nitrogen content by 0.11%–0.66%, total phosphorus content by 3.52%–7.59%, and total potassium content by 1.18%–10.94%.
[0012] Under salt stress conditions of 8.72 g / kg (NaCl / dry soil), this Chlorella can promote plant growth and improve plant salt tolerance. Taking wheat as an example, aboveground fresh weight can increase by 6.82%–40.54%, plant height by 5.56%–7.16%, malondialdehyde (MDA) content in leaves decreases by 8.01%–23.11%, and peroxidase (POD) content in stems and / or leaves increases by 15.30%–68.00%.
[0013] Specific information regarding metabolites is as follows:
[0014] This Chlorella can produce a variety of metabolites that can be used as plant growth regulators, including but not limited to diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and laurylamide.
[0015] At the same time, it can also produce metabolites that promote plant growth or enhance plant stress resistance, such as palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, L-isoleucine-L-threonine, etc.
[0016] In addition, this Chlorella can also produce capsaicin, a metabolite that can be used as an insecticide.
[0017] The applications and preparation methods of Chlorella described above are as follows:
[0018] This invention proposes a microalgae preparation containing the aforementioned salt-resistant and growth-promoting Chlorella sorokiniana K2.
[0019] Meanwhile, a microbial fertilizer is also proposed, which contains the aforementioned Chlorella, its culture or its processed products, or the aforementioned microalgae preparation.
[0020] In addition, a soil conditioner, a plant growth regulator, and a biostimulant have been proposed, all of which contain the aforementioned Chlorella, its culture or its processed products, or the aforementioned microalgae preparations.
[0021] The present invention also proposes a biological pesticide comprising a carrier and an active ingredient, wherein the active ingredient comprises the aforementioned Chlorella, its culture or a processed product thereof.
[0022] In terms of application, this invention proposes the use of the above-mentioned Chlorella, microalgae preparations or microbial fertilizers in improving crop stress resistance (especially salt resistance), promoting crop growth and soil improvement.
[0023] The present invention also proposes a method for improving crop stress resistance, promoting crop growth and soil improvement, which includes adding the above-mentioned Chlorella, microalgae preparations or microbial fertilizers to the soil in which crops are grown.
[0024] Finally, the present invention also proposes a method for preparing a biopesticide, which is prepared by using the above-mentioned salt-tolerant and growth-promoting Chlorella sorokiniana K2, its culture or its processed products.
[0025] The salt-resistant and growth-promoting Chlorella sorokiniana K2 described in this invention has the following core advantages and beneficial effects:
[0026] I. Significantly improves soil nutrients:
[0027] This Chlorella species can significantly increase the content of organic matter, available nitrogen, available phosphorus, and available potassium in the soil, while also improving the levels of total nitrogen, total phosphorus, and total potassium. Furthermore, it can increase soil microbial biomass carbon and microbial biomass nitrogen, effectively promoting the availability of soil nutrients. This characteristic makes Chlorella sorokiniana K2 a highly efficient soil conditioner, significantly improving the soil's ability to provide nutrients to plants, and providing valuable resources and technical support for the development of soil improvement technologies based on Chlorella organisms.
[0028] II. Enhancing plant salt tolerance and growth:
[0029] Under salt stress conditions of 8.72 g / kg (NaCl / dry soil), *Chlorella sorokiniana* K2 exhibited remarkable ability to promote plant growth and enhance salt tolerance. Specifically, it significantly increased the aboveground fresh weight and plant height of wheat, reduced malondialdehyde (MDA) content in leaves, and increased peroxidase (POD) content in stems and / or leaves. These effects make this *Chlorella* highly suitable for preparing microbial inoculants and biofertilizers, providing strong resource and technical support for developing crop salt tolerance and yield-enhancing technologies based on *Chlorella*.
[0030] III. Produces a variety of beneficial metabolites:
[0031] Chlorella sorokiniana K2 produces a variety of metabolites with different functions. These include diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and lauramide, which can be used as plant growth regulators; and palmitic acid, pentanamide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, and L-isoleucine-L-threonine, which promote plant growth or enhance plant stress resistance. These metabolites not only help promote plant growth but also enhance the salt tolerance of plants under salt stress and reduce the peroxidation of leaf cell membrane lipids in plants such as wheat under salt stress, thereby effectively alleviating the damage caused by salt stress to plants.
[0032] IV. Possesses potential insect resistance:
[0033] Furthermore, *Chlorella sorokiniana* K2 can produce capsaicin, a metabolite that can be used as an insecticide, giving this algae the potential to enhance plant insect resistance. This discovery provides new resource support for the preparation of biopesticides and further broadens their application prospects in the agricultural field.
[0034] Preservation Information
[0035] Chlorella sorokiniana K2 strain has been deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, on January 8, 2025, with accession number CCTCCNO: M 2025065. Attached Figure Description
[0036] Figure 1 These are colony observation images of Chlorella sorokiniana K2, the present invention: (a) front view, (b) back view.
[0037] Figure 2 This is a phylogenetic tree of the tufA gene sequence of Chlorella sorokiniana K2 in this invention;
[0038] Figure 3 This is an observational image showing how algal cells of Chlorella sorokiniana K2 promote wheat growth under salt stress conditions, according to the present invention.
[0039] Figure 4 This is an observational diagram showing the effect of the culture supernatant of Chlorella sorokiniana K2 on promoting wheat growth under salt stress conditions.
[0040] Figure 5 This invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on wheat plant height and aboveground fresh weight under salt stress conditions;
[0041] Figure 6 This invention relates to the effect of algal cells and culture supernatant of Chlorella sorokiniana K2 on the malondialdehyde (MDA) content in wheat leaves under salt stress conditions;
[0042] Figure 7 This invention relates to the effects of algal cells and culture supernatants of Chlorella sorokiniana K2 on the peroxidase (POD) content in wheat stems and leaves under salt stress conditions;
[0043] Figure 8 This invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on soil organic matter content;
[0044] Figure 9This invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on soil nutrient (alkaline nitrogen, available phosphorus and available potassium) content;
[0045] Figure 10 This invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on soil nutrient (total nitrogen, total phosphorus, and total potassium) content;
[0046] Figure 11 This invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on soil microbial biomass carbon and microbial biomass nitrogen.
[0047] For those skilled in the art, other related figures can be obtained from the above figures without any creative effort. Detailed Implementation
[0048] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described below with reference to specific embodiments.
[0049] In this article, the terms “salt-resistant and growth-promoting Chlorella sorokiniana K2”, “Chlorella sorokiniana K2”, “Chlorella sorokiniana K2” and “K2” are used interchangeably.
[0050] Example 1: Isolation, purification and culture of salt-tolerant and growth-promoting Chlorella sorokiniana K2
[0051] Sample source: Saline-alkali soil from Haixing County, Cangzhou City, Hebei Province, China.
[0052] Preparation of A&A medium: Refer to the patent "A Chlamydomonas aeruginosa strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.
[0053] Preparation of BG11 medium: Prepare according to the usage requirements of BG11 medium (Haibo Biotechnology, catalog number HB8793), autoclave, and then cool to room temperature.
[0054] Separation and purification steps: Refer to the patent "A Chlamydomonas aeruginosa strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.
[0055] Example 2: Identification of salt-tolerant and growth-promoting Chlorella sorokiniana K2
[0056] 1) Identification of biological characteristics
[0057] Salt-tolerant and growth-promoting Chlorella sorokiniana K2 colonies on BG11 medium appear as dark green, raised bumps with smooth edges. Figure 1 ).
[0058] 2) System classification and identification
[0059] Take an appropriate amount of Chlorella K2 culture medium into a sterile 2mL centrifuge tube, centrifuge repeatedly, discard the supernatant until a certain amount of Chlorella K2 algal cells are obtained. Transfer the Chlorella K2 algal cells into FastDNA. ○R Genomic DNA of Chlorella K2 was extracted into Lysing Matrix E tubes using the SPIN kit (MP Biomedicals, USA) following the prescribed procedure. The tufA gene sequence was amplified using primers tufAF (5'-GGNGCNGCNCAAATGGAYGG-3') and tufAR (5'-CCTTCNCGAATMGCRAAWCGC-3') (Ao Yuan, 2020). The PCR reaction volume was 50 μL, containing 10 μL EasyTaq buffer, 5 μL dNTPs, 0.5 μL primer 18F, 0.5 μL primer 18R, 1.5 μL DNA template, 2 μL EasyTaq DNA polymerase, and finally, sterile ultrapure water was added to a final volume of 50 μL. The PCR reaction program was as follows: (i) pre-denaturation at 95℃ for 3 min; (ii) 35 cycles of denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, and extension at 72℃ for 1 min; (iii) final extension at 72℃ for 7 min. The PCR amplification products were submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequence of the tufA gene of microalga K2 obtained from sequencing is shown in SEQ ID NO.1 of the sequence listing.
[0060] Homology alignment of the sequenced tufA gene was performed using the NCBI (National Center for Biotechnology Information) database website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed. The results showed that the tufA gene of microalga K2 had a sequence similarity of 98.79% with the tufA gene from Chlorella sorokiniana SLA-04, and they formed a stable evolutionary branch (bootstrap value 90). Figure 2Therefore, the microalga K2 obtained in this invention is determined to be a species of Chlorella, specifically the genus Chlorella, named Chlorella sorokiniana K2.
[0061] Example 3: Effects of Chlorella sorokiniana K2 on wheat growth and salt tolerance under 8.72 g / kg (NaCl / dry soil) salt stress.
[0062] Wheat pot experiment:
[0063] A negative control (denoted as Control) and a positive control (denoted as BG11) were set up. The positive control was mainly used to compare with the culture supernatant to rule out the influence of the culture medium, thereby demonstrating the role of K2 metabolites. The experimental groups were treated with either Chlorella sorokiniana K2 algal cell suspension (denoted as K2 (algal cells)) or Chlorella sorokiniana K2 culture supernatant (denoted as K2 (supernatant)). The Chlorella sorokiniana K2 culture was aliquoted into 50 mL sterile centrifuge tubes and centrifuged at 8500 rpm for 40 min. The supernatant was slowly poured into a new sterile Erlenmeyer flask, which became the Chlorella sorokiniana K2 culture supernatant. After thorough removal of the supernatant, the algal cells were resuspended twice in sterile water (centrifuged at 8500 rpm for 40 min, supernatant removed, this operation repeated twice), and the algal cells were resuspended in sterile water to obtain the Chlorella sorokiniana K2 algal cell suspension. There were a total of 4 treatment groups, and each treatment group was repeated 3 times. Figure 3 and Figure 4 (Showing wheat growth observation charts).
[0064] The experiment used saline-alkali farmland soil that had been sieved through a 2mm sieve and thoroughly mixed. The soil had a salt content of 0.9 g / kg (NaCl / dry soil). Each pot was filled with 330 g of dry soil and planted with "Malan No. 1" wheat. 16 seeds were sown in each pot. After uniform emergence, thinning was carried out, and 6 wheat seedlings were ultimately retained in each pot.
[0065] The culture conditions were set at a constant temperature of 25℃ with a photoperiod of 16 hours of light / 8 hours of darkness. In the initial stage of the experiment, sterile water was used for irrigation. After the wheat seedlings had grown vigorously, salt stress treatment with a 4 g / L NaCl solution was initiated. Irrigation was carried out every 1–3 days until the soil NaCl content reached approximately 8.72 g / kg (NaCl / dry soil), at which point NaCl irrigation was discontinued. During this period, 20 mL of *Chlorella sorokiniana* K2 algal cells and *Chlorella sorokiniana* K2 culture supernatant were respectively irrigated into the soil. Simultaneously, the negative control treatment continued to be irrigated with sterile water, while the positive control treatment continued to be irrigated with BG11 medium. This irrigation process was repeated a total of 5 times.
[0066] Experimental results are as follows Figure 3 , Figure 4 , Figure 5 , Figure 6 and Figure 7 As shown:
[0067] Under severe salt stress (8.72 g / kg NaCl / dry soil), both K2 (algal cells) and K2 (supernatant) treatments significantly promoted wheat growth. They reduced cell membrane lipid peroxidation and cell damage, protecting cells from salt stress and thus improving wheat's salt tolerance.
[0068] The specific data are as follows: The aboveground fresh weight of wheat treated with K2 (algal cells) increased by 27.03% compared to the Control treatment and by 6.82% compared to the BG11 treatment; the plant height treated with K2 (algal cells) increased by 5.56% compared to the Control treatment and by 5.92% compared to the BG11 treatment. The aboveground fresh weight of wheat treated with K2 (supernatant) increased by 40.54% compared to the Control treatment and by 18.18% compared to the BG11 treatment; the plant height treated with K2 (supernatant) increased by 6.80% compared to the Control treatment and by 7.16% compared to the BG11 treatment.
[0069] Furthermore, the malondialdehyde (MDA) content in wheat leaves treated with K2 (algal cells) decreased by 10.21% compared to the Control treatment and by 8.01% compared to the BG11 treatment. The MDA content in wheat leaves treated with K2 (supernatant) decreased by 23.11% compared to the Control treatment and by 21.24% compared to the BG11 treatment. Simultaneously, the peroxidase (POD) content in wheat stems treated with K2 (supernatant) increased by 68.00% compared to the Control treatment; and the peroxidase (POD) content in leaves increased by 15.30% compared to the Control treatment and by 52.11% compared to the BG11 treatment.
[0070] In summary, both the Chlorella sorokiniana K2 algal cells and supernatant described in this invention significantly promoted wheat growth under severe salt stress (8.72 g / kg NaCl / dry soil). These promoting effects were specifically manifested in increased aboveground fresh weight and plant height of wheat plants, and decreased malondialdehyde (MDA) content in leaves. Figure 6 ), and an increase in the content of peroxidase (POD) in stems and / or leaves ( Figure 7 The decrease in malondialdehyde (MDA) content ( Figure 6 This indicates that the degree of lipid peroxidation in wheat cell membranes is reduced, and cell membrane damage is decreased, which is beneficial for maintaining cell membrane integrity and fluidity, ensuring that the cell membrane can normally participate in functions such as substance transport and signal transduction. The increase in peroxidase (POD) content ( Figure 7 These changes help reduce the level of reactive oxygen species (ROS) within cells, preventing their accumulation and oxidative damage, and enhancing the function of wheat's own antioxidant defense system. Together, these changes protect the integrity and biological activity of wheat stem and / or leaf cells under salt stress, effectively alleviating the damage caused by salt stress.
[0071] Example 4: Effects of Chlorella sorokiniana K2 on soil nutrients under severe salt stress
[0072] Soil samples were collected after the wheat pot experiment in Example 3, and nine indicators were measured, including soil organic matter, alkaline nitrogen, available phosphorus, available potassium, total nitrogen, total phosphorus, total potassium, microbial biomass carbon, and microbial biomass nitrogen. The results confirmed the positive effects of K2 (algal cells) and K2 (supernatant) on soil nutrients.
[0073] Under severe salt stress (8.72 g / kg NaCl / dry soil), comprehensive nutrient analysis was performed on collected soil samples. The results are as follows: Figure 8 , Figure 9 , Figure 10 and Figure 11 As shown, the specific findings are as follows:
[0074] The effects of K2 (algal cells) and K2 (supernatant) on soil nutrients:
[0075] Both significantly increased the content of organic matter, available nitrogen, available phosphorus, and available potassium in the soil, while also improving the levels of total nitrogen, total phosphorus, and total potassium. Furthermore, they increased soil microbial biomass carbon and microbial biomass nitrogen, further improving the soil's ability to provide nutrients for plant growth.
[0076] Comparison with Control processing:
[0077] K2 (algal cells) treatment increased soil organic matter, available phosphorus, available potassium, total nitrogen, total phosphorus, and total potassium by 2.99%, 140.03%, 11.02%, 0.66%, 7.59%, and 1.18%, respectively; meanwhile, K2 (algal cells) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 47.35% and 55.63%, respectively.
[0078] The K2 (supernatant) treatment increased soil organic matter, available nitrogen, available phosphorus, available potassium, total nitrogen, and total phosphorus by 5.48%, 9.81%, 121.03%, 14.56%, 0.11%, and 3.52%, respectively; meanwhile, the K2 (supernatant) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 23.43% and 38.78%, respectively.
[0079] Comparison with BG11 processing:
[0080] Compared to the BG11 treatment, the K2 (algal cell) treatment increased available phosphorus, available potassium, and total potassium by 49.63%, 10.99%, and 10.94%, respectively; at the same time, the K2 (algal cell) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 41.98% and 7.62%, respectively.
[0081] The K2 (supernatant) treatment increased soil organic matter, available phosphorus, and available potassium by 0.70%, 37.78%, and 14.53%, respectively; meanwhile, the K2 (supernatant) treatment increased soil microbial biomass carbon by 18.93%.
[0082] These results clearly demonstrate the positive effects of K2 (algal cells) and K2 (supernatant) on soil nutrients under severe salt stress, providing a more favorable soil environment for the growth of crops such as wheat.
[0083] Example 5: Determination of K2 metabolites from Chlorella sorokiniana
[0084] First, a single colony of *Chlorella sorokiniana* K2 was picked from solid BG11 medium and inoculated into 50 mL of liquid BG11 medium. The culture was carried out at a constant temperature of 25°C with shaking at 160 rpm, providing a 12-hour light-12-hour dark cycle for 14 days.
[0085] Subsequently, an appropriate amount of the above-cultured Chlorella sorokiniana K2 algal solution was taken and inoculated again into 50 mL of BG11 liquid medium, and the experiment was repeated 6 times to ensure the accuracy of the results. Under the same culture conditions (25℃, 160 r / min, 12h light / 12h dark), the culture was continued until the required time was reached. Afterwards, the supernatant was collected by centrifugation (8000 rpm, 5 min), and this supernatant was labeled K2.
[0086] In addition, for comparative analysis, 50 mL of BG11 liquid culture medium without Chlorella sorokiniana K2 algal inoculation was used as a control group, and the experiment was repeated 6 times. The supernatant of the control group was labeled as Control.
[0087] The collected K2 and Control supernatant samples were stored at -80°C for subsequent metabolomics analysis. These samples were then submitted to Shanghai Paisenno Biotechnology Co., Ltd. for professional metabolomics analysis.
[0088] The test results show that the *Chlorella sorokiniana* K2 described in this invention can produce a variety of bioactive metabolites. These include metabolites that can be used as plant growth regulators, such as diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine, and laurylamide. In addition, this algal strain can also produce metabolites that promote plant growth or enhance plant stress resistance, such as palmitic acid, pentanamide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, and L-isoleucine-L-threonine. These metabolites show significant effects in promoting plant growth, especially under salt stress conditions, significantly improving the salt tolerance of plants and reducing the degree of lipid peroxidation in leaf cell membranes of plants such as wheat under salt stress conditions, thereby effectively alleviating the damage caused by salt stress to plants.
[0089] It is worth mentioning that this algae strain can also produce capsaicin, a metabolite with insecticidal activity, which further indicates its potential role in enhancing plant insect resistance.
[0090] SEQ ID NO:1
[0091] >K2_tufA
[0092] >K2_824bp
[0093] AGGTTTGATTAATTCTACAATCATTTTAATACGGTCACCAGGCATAACCATTTGTGTAGCA
[0094] CTATCATCATCTGCACGGAATGATTCAATCTTTTCCTGTTACGTCTGTTGTACGAACATAAA
[0095] ATTCGGTCGGTATCCAGGAAAGAATGGAGTATGACGACCACCTTCTTCTTTTGTTAAGA
[0096] CATAAACTTGTGCTTCGAATTTAGTGTGAGGCGTAATACTGCCCGGTTTTGCAAGAACCA
[0097] TACCACGTTCAATATCTATTTTTTGAACACCACGAAGTAAAATTCCAACATTATCTCCAGC
[0098] TACACTTTCATCTAATGTTTTTTGGAACATTTCTAAACCAGTAACAGTTGTTGTTTTTGTA
[0099] TCACGTAAACCAACAAGTTCAACTGTATCACCAATTTTTACACACCCACGTTCGACACG
[0100] ACCTGTCGCTACAGTTCCACGACCTGTAATTGAAAAAACGTCCTCAACAGCCATTAAAA
[0101] ATGGTTTCTCTGTTTCACGTTCTCGGAGTTGGAATATAAGAATCAACTTGATCCATAAGGTT
[0102] ATAAAATTTTATCAACCCATTTACTATCACCAGGTTGAATTTGTGGATTCTCTGTTAATGCTT
[0103] CTAAAGCAAGAAGTGCTGAACCAGCAATGATTGGGATTTCATCGCCAGGGAATTCATATT
[0104] TATCTAATGTTTCACGAATTTCTAATTCAACAAGTTCTAATAATTCTGCATCATCAACTTGA
[0105] TCTTCTTTATTTAAAAAGACAACAATATTTGGAACACCTACTTGTTTTGCTAAAAGTAAAT
[0106] GTTCTTTTGTTTTGTGGCATAGGACCGTCAGCACCAG
[0107] The present invention has been described above by way of example. It should be noted that any simple modifications, alterations or other equivalent substitutions that can be made by those skilled in the art without creative effort without departing from the core of the present invention fall within the protection scope of the present invention.
Claims
1. A salt-tolerant and growth-promoting Chlorella strain K2, characterized in that, This Chlorella was deposited at the China Center for Type Culture Collection on January 8, 2025, with accession number CCTCC NO: M 2025065.
2. A Chlorella preparation, characterized in that, The formulation contains the salt-resistant and growth-promoting Chlorella sorokiniana K2 as described in claim 1.
3. A microbial fertilizer, characterized in that, The fertilizer contains at least one of the following components: salt-tolerant and growth-promoting Chlorella sorokiniana K2 or a culture thereof as described in claim 1, or a Chlorella preparation as described in claim 2.
4. A soil conditioner, characterized in that, The conditioner contains at least one of the following ingredients: salt-tolerant and growth-promoting Chlorella sorokiniana K2 or a culture thereof as described in claim 1, or a Chlorella preparation as described in claim 2.
5. A plant growth regulator for wheat under salt stress conditions, characterized in that, The regulator comprises at least one of the following components: salt-tolerant Chlorella sorokiniana K2 or a culture thereof as described in claim 1, or a Chlorella preparation as described in claim 2.
6. The application of the salt-resistant and growth-promoting Chlorella sorokiniana K2 as described in claim 1, the Chlorella preparation as described in claim 2, or the microbial fertilizer as described in claim 3 in improving the salt resistance of wheat, promoting wheat growth under salt stress, or improving saline-alkali soil.
7. The application according to claim 6, characterized in that, The salt-tolerant and growth-promoting Chlorella sorokiniana K2 described in claim 1, the Chlorella preparation described in claim 2, or the microbial fertilizer described in claim 3 are added to the soil in which wheat is grown.
Citation Information
Patent Citations
A Chlamydomonas aeruginosa strain m9v and its application
CN109749937B
Method for improving saline-alkali soil and promoting growth of quinoa by utilizing chlorella
CN114854421A
Preparation method of nutrient solution for promoting growth of crops on saline-alkaline barren land
CN116178085A