Application of acinetobacter piceli LGC1-1 in prevention and treatment of tobacco mosaic virus

Abstract

The invention discloses an application of Acinetobacter piceli LGC1-1 (Acinetobacter piceli sp.LGC1-1) in prevention and treatment of tobacco mosaic virus viruses, the Acinetobacter piceli LGC1-1 (Acinetobacter piceli sp.LGC1-1) is preserved in the China Center for Type Culture Collection on November 13, 2024, and the preservation number is CCTCC NO: M 20242552. The Acinetobacter piceli LGC1-1 is preserved in the China Center for Type Culture Collection on November 13, 2024, and the preservation number is CCTCC NO: M 20242552. The acinetobacter piceli LGC1-1 is used as an antagonistic strain and is used for inhibiting tobacco mosaic virus virus infection. The inhibition rates of the acinetobacter piceli LGC1-1 on the tobacco mosaic virus TMV and the pepper light mottle virus PMMoV are 82.8% and 77.7% respectively, while the inhibition rates of the conventional medicament ningnanmycin on the tobacco mosaic virus TMV and the pepper light mottle virus PMMoV are 50.8% and 53.3% respectively, which indicates that the acinetobacter piceli LGC1-1 has an outstanding passivation effect on the tobacco mosaic virus TMV and the pepper light mottle virus PMMoV; the control effect of the acinetobacter pichi LGC1-1 is far higher than that of a conventional medicament ningnanmycin, and the acinetobacter pichi LGC1-1 is a screened natural virus inoculated bacterium, has no pollution to the environment and does not destroy biological diversity.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to application of Acinetobacter pilosicoli LGC1-1 in preventing and controlling tobacco mosaic virus. Background Art

[0002] There are many members in the genus Tobamovirus, and ICTV has reported 37 species (Genus: Tobamovirus | ICTV). Among them, tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) are common viral pathogens that harm pepper and tobacco crops. When TMV infects tobacco, the leaves show mosaic symptoms, the plants grow weakly, and the quality of tobacco is seriously affected. When PMMoV infects pepper, it harms pepper, seriously affecting the color change of pepper fruit and affecting the economic benefits of pepper.

[0003] Viruses are obligate intracellular parasites. Once tobacco plants are infected, there is no effective drug to completely control them in production. Screening for natural microbial antagonists to control crop virus diseases meets the national green prevention and control development needs, and can also reduce the pollution of chemical pesticides to the soil and environment. At present, there are many studies on biological control of tobacco mosaic virus in China. For example, patent No. CN201910790132.1 discloses an Acinetobacter beijerinckii strain, codenamed S1, and discloses that the strain can be used for the prevention and control of tobacco mosaic virus (tobacco mosaic disease TMV), and has a good inhibitory effect on tobacco mosaic disease TMV. Therefore, it is of great practical significance to develop more biocontrol bacteria and apply them to the prevention and control of tobacco mosaic virus. Summary of the invention

[0004] The invention provides a use of Acinetobacter pilosicarius LGC1-1 in preventing and controlling tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) in order to screen natural microbial antagonists for preventing and controlling tobacco mosaic virus (TMV) and pepper mild mottle virus (PMMoV) and reduce the pollution of chemical pesticides to soil and the environment.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The present invention provides a kind of Acinetobacter pekinensis LGC1-1. The living pure culture of the Acinetobacter pekinensis LGC1-1 (Acinetobacter sp, named as Acinetobacter pekinensis LGC1-1 / Acinetobacter sp.LGC1-1) has been registered and preserved in the China Center for Type Culture Collection, the preservation time is November 13, 2024, the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, and the preservation number is CCTCC NO: M 20242552.

[0007] The Acinetobacter pilosella LGC1-1 has a milky white round colony with neat edges, a smooth surface, and opaque protrusions. Gram staining proves that the bacterium belongs to Gram-negative bacteria. During purification culture, a spread plate method is used on NA medium (beef extract 3.0 g / L, sucrose 10.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, agar 15.0 g / L, pH=7.1) and cultured at 28°C for 24 hours.

[0008] The present invention also provides an application of Acinetobacter pekinensis LGC1-1 in preventing and controlling tobacco mosaic virus. The Acinetobacter pekinensis LGC1-1 is used as an antagonistic strain to inhibit infection of tobacco mosaic virus.

[0009] The tobacco mosaic virus is tobacco mosaic virus TMV and / or pepper mild mottle virus PMMoV.

[0010] The 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.1.

[0011] The amplification primers for the 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 are:

[0012] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0013] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0014] The beneficial effect of the present invention is that the inhibition rates of the Acinetobacter pekinensis LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 82.8% and 77.7% respectively, while the inhibition rates of the conventional agent Ningnanmycin on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV are 50.8% and 53.3% respectively, indicating that the passivation effect of Acinetobacter pekinensis LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV is outstanding, which is much higher than the prevention effect of the conventional agent Ningnanmycin, and the Acinetobacter pekinensis LGC1-1 is a natural virus-linked antibacterial screened out, which has no pollution to the environment and will not destroy biodiversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a colony morphology diagram of Acinetobacter pilosicarius LGC1-1 of the present invention;

[0016] Figure 2 This is a comparison diagram of the inactivation effects of the Acinetobacter pilosellae LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on tobacco mosaic virus TMV (tobacco leaves);

[0017] Figure 3 This is a comparison chart (tobacco leaves) of the inactivation effects of the Acinetobacter pilosella LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on pepper mild mottle virus PMMoV. DETAILED DESCRIPTION

[0018] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0019] 1. Materials

[0020] 1. Acinetobacter sp. LGC1-1 (Acinetobacter sp., named as Acinetobacter sp. LGC1-1 / Acinetoba cter sp. LGC1-1). The live pure culture of Acinetobacter sp. LGC1-1 has been registered and preserved in the China Center for Type Culture Collection. The preservation time is November 13, 2024. The preservation address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 20242552.

[0021] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0022] 2. Methods

[0023] 2.1 Preparation of Acinetobacter pilosicola LGC1-1:

[0024] 1. Sampling: In the tobacco field where mosaic disease has occurred, select healthy tobacco plants and select the rhizosphere soil of the tobacco plants at a depth of 20 cm from the roots of the tobacco plants for later use;

[0025] 2. Grinding: Place 10g of the reserved soil in a sterilized Erlenmeyer flask, add 20ml of sterile water, shake until the liquid becomes turbid, let stand at room temperature for 10 minutes, and set aside;

[0026] 3. Purification: 200 μL of the liquid supernatant after standing was sucked with a sterile pipette tip, and the plate method was used on NA medium (beef extract 3.0 g / L, sucrose 10.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, agar 15.0 g / L, pH = 7.1), and cultured at 28°C for 24 hours. After the colonies grew on the separation plate, the isolated single colonies were picked out one by one with an inoculation loop according to the morphology, size, surface structure, edge structure, texture, gloss, transparency, color and soluble pigments produced by the microbial colonies. The single colonies with different morphologies were picked out and streaked on the corresponding blank NA medium plates for purification, and inverted incubator at 28°C for 24 hours to obtain the purified strains for standby use;

[0027] like Figure 1 As shown, the milky white round colonies of Acinetobacter pilosicola LGC1-1 have neat edges, smooth surfaces, and opaque protrusions. Gram staining proves that the bacteria belong to Gram-negative bacteria. The pathogen DNA was extracted using Wizard genomic DNA purification kit (Promega, Madison, WI).

[0028] The primers for amplification of 16S rDNA sequences are:

[0029] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0030] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0031] PCR amplification was performed using the above primers, and the PCR amplification reaction system was 50 μL (10×PCR buffer 5 μL, dNTP 1 μL, P0 2 μL, P6 2 μL, Tag enzyme 1 μL, template DNA 2 μL, dd H2O 37 μL).

[0032] The PCR amplification conditions were: 94℃5min; 94℃30s, 55℃1min, 72℃90s, 30 cycles; 72℃1min; 10℃20min. The 16SrDNA gene sequencing results of the strain were compared with BLAST software on the NCBI website, and the biocontrol bacteria were preliminarily identified as Acinetobacter sp.

[0033] 4. Screening: Select a single bacterial colony and place it in a sterilized 100 ml conical flask containing 20 ml of culture medium. Culture it with shaking (28°C, 200 r / min) for 24 hours to ensure that the bacterial liquid content is large enough to serve as a spare strain for fermentation.

[0034] 2.2 Infection inhibition test of tobacco mosaic virus TMV and pepper mild mottle virus PMMoV:

[0035] Nicotiana tabacum var.samsun NN has an allergic necrosis reaction to tobacco mosaic virus TMV and pepper mild mottle virus PMMoV. The half-leaf method was used to determine the inhibition rate of Acinetobacter pilosulae LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV infection. Specifically, the young leaves of tobacco mosaic virus TMV or pepper mild mottle virus PMMoV virus sources that are fully diseased are ground and filtered with distilled water at a ratio of 1:10 (mass to volume) and used as virus test samples. The virus test sample is mixed with an equal volume of liquid NA culture medium, and rubbed on the left half of the leaf of Nicotiana tabacum var.samsun NN (from the front of the leaf, the same below) after 30 minutes as a control. The LGC1-1 to be tested is mixed with an equal volume of the virus sample, and rubbed and inoculated on the right half of the leaf of Nicotiana tabacum var.samsun NN after 30 minutes as a treatment. In the same way, the treatment and control of Ningnanmycin (purchased from Chengdu Jiaye Biotechnology Co., Ltd.) are set.

[0036] After the necrosis spots appeared, the number of necrosis spots on the left and right half leaves was recorded. The experiment was repeated three times, and three leaves were inoculated on each tobacco plant. The number of necrosis spots on the left and right half leaves and the inhibition rate are shown in Table 1-2 below:

[0037] Table 1 Statistical table of the inhibition test data of tobacco mosaic virus TMV

[0038]

[0039] Table 2 Statistical table of inhibition test data on pepper mild mottle virus PMMoV

[0040]

[0041]

[0042] The inhibition rate was calculated by the following formula: inhibition rate (%) = [(number of control necrosis spots - number of treated necrosis spots) / number of control necrosis spots] × 100%, and the evaluation was performed based on the average inhibition rate.

[0043] From the data in Table 1-2, it can be seen that the antagonistic effect of Acinetobacter pilosulae LGC1-1 on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV is significantly better. The results of three repeated tests showed that the inhibition rates of conventional agent Ningnanmycin on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV were 50.8% and 53.3%, respectively, but the inhibition rates of LGC1-1 fermentation liquid on tobacco mosaic virus TMV and pepper mild mottle virus PMMoV were as high as 82.8% and 77.7%, respectively. The specific control effect is shown in Figure 2-3 .

[0044] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An application of Acinetobacter pilosellae LGC1-1 in preventing and treating tobacco mosaic virus, characterized in that: The live pure culture of the Acinetobacter sp. LGC1-1 was deposited in the China Center for Type Culture Collection on November 13, 2024, with the deposit number CCTCC NO: M 20242552; the Acinetobacter sp. LGC1-1 is used as an antagonistic strain to inhibit infection by tobacco mosaic virus.

2. The use according to claim 1, characterized in that: The tobacco mosaic virus is tobacco mosaic virus TMV and / or pepper mild mottle virus PMMoV.

3. The use according to claim 1, characterized in that: The 16SrDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.

1.

4. The use according to claim 1, characterized in that: The amplification primers for the 16SrDNA sequence of the Acinetobacter pekinensis LGC1-1 are: SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG; SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

Images