Stenotrophomonas maltophilia with hydroxybenzophenone degradation capacity and application of stenotrophomonas maltophilia

Abstract

The invention discloses stenotrophomonas maltophilia CJY with hydroxybenzophenone degradation capacity and application of the stenotrophomonas maltophilia CJY. The stenotrophomonas maltophilia CJY is taken from sludge of a sewage plant and has an efficient degradation effect on hydroxybenzophenone; pollutants can be completely converted into harmless substances such as CO2 and H2O, so that the method has a wide application prospect in biological purification of industrial waste gas and wastewater. According to the stenotrophomonas maltophilia CJY disclosed by the invention, the removal rate of 50 mg / L of hydroxybenzophenone in an environment with the pH value of 7 can reach 50%, and the removal rate of hydroxybenzophenone within 125 mg / L can reach 30%.

Description

(I) Technical field

[0001] The invention relates to a strain of Stenotrophomonas maltophilia having the ability to degrade oxybenzone and application thereof. (II) Background technology

[0002] Oxybenzone is an organic compound and a derivative of benzophenone. Oxybenzone is also known as p-hydroxybenzoate or p-hydroxybenzoate. It is a slightly yellow crystalline powder with a melting point of 66°C. It is a chemical preservative widely used in cosmetics, food and medicine. It is insoluble in water but soluble in a variety of organic solvents such as ethanol, ethyl acetate and methanol.

[0003] Oxybenzone has multiple negative biological effects, including inhibition of androgen activity, endocrine disruption, and genotoxicity. Although it is low-toxic, due to its widespread use, oxybenzone has been detected in environmental water bodies including Swiss lakes, Spanish rivers, and Chinese river sediments. This pollutant is difficult to remove through conventional water treatment processes, so the monitoring and control of oxybenzone has become an urgent problem to be solved.

[0004] Therefore, it is necessary to study the efficient degradation of oxybenzone in the environment for human health. (III) Summary of the invention

[0005] The present invention aims to provide a strain of Stenotrophomonas maltophilia with the ability to degrade oxybenzone and its application. The Stenotrophomonas maltophilia CJY of the present invention can achieve efficient degradation with oxybenzone as the only carbon source, and has a mild growth environment and is easy to expand and culture. The discovery of the degradation bacteria is of great significance for the efficient purification of new pollutants such as oxybenzone in wastewater.

[0006] The technical solution adopted by the present invention is:

[0007] The present invention provides a new oxybenzone-degrading bacterium, Stenotrophomonas maltophilia CJY, which is deposited in China Center for Type Culture Collection, with a deposit number of CCTCC NO: M20242471, a deposit date of November 7, 2024, and an address of Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of the Stenotrophomonas maltophilia CJY of the present invention are: the colony is light yellow, disc-shaped, spore-free and has flagella; the edges are neat, opaque and easy to pick up, and the bacterial lawn grows along the streaking line; it is aerobic and Gram-negative.

[0009] The present invention also provides an application of Stenotrophomonas maltophilia in degrading oxybenzone. Specifically, the application is to add a bacterial solution obtained by expanding the culture of Stenotrophomonas maltophilia CJY or resting cells obtained by centrifuging the bacterial solution to an inorganic salt culture medium containing oxybenzone at a pH of 6 to 8, and culture the culture medium at 10 to 30° C. and 100 to 200 rpm to achieve degradation of oxybenzone.

[0010] Furthermore, in the inorganic salt culture solution, the amount of bacterial solution added is expressed as OD 600 The amount of resting cells added is 50-150 mg / L (preferably 92 mg / L) based on dry weight.

[0011] Furthermore, the initial concentration of oxybenzone added to the inorganic salt culture solution is 50 to 150 mg / L.

[0012] Further, the inorganic salt culture medium is composed of: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl30.0162g / L, trace element mother solution 5mL / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution is composed of: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0013] Further, the resting cells of Stenotrophomonas maltophilia CJY are prepared according to the following steps:

[0014] (1) Slant culture:

[0015] Stenotrophomonas maltophilia CJY was inoculated into a slant LB solid culture medium and cultured at 30°C for 24-36 hours to obtain slant bacteria. The final concentration of the LB solid culture medium was as follows: NaCl 10 g / L, tryptone 10 g / L, yeast powder 5 g / L, agar 18-20 g / L, the solvent was deionized water, and the pH value was natural.

[0016] (2) Expanding training

[0017] Use an inoculation loop to pick the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 30°C, 160 rpm for 24-36 h to obtain the OD 600 =0.1-0.2 bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt culture solution, and obtain resting cells of Stenotrophomonas maltophilia CJY; the final concentration of the LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The Stenotrophomonas maltophilia CJY provided by the present invention is taken from sewage plant sludge, has a highly efficient degradation effect on oxybenzone, and can relatively completely convert pollutants into harmless substances such as inorganic substances (CO2, H2O) and cell biomass, and thus has broad application prospects in the biological purification of industrial waste gas and wastewater.

[0020] The Stenotrophomonas maltophilia CJY of the present invention can achieve a removal rate of 50% for 50 mg / L of oxybenzone in an environment of pH=7, and a removal rate of 30% for oxybenzone within 125 mg / L. (IV) Description of the drawings

[0021] Figure 1 This is a photo of the colony morphology of strain CJY on LB medium.

[0022] Figure 2 Transmission electron micrograph of strain CJY.

[0023] Figure 3 This is the phylogenetic tree of strain CJY.

[0024] Figure 4 This is a liquid chromatography analysis chart of oxybenzone.

[0025] Figure 5 This is the degradation curve of Stenotrophomonas maltophilia CJY for different concentrations of oxybenzone.

[0026] Figure 6 The degradation curves of Stenotrophomonas maltophilia CJY for 100 mg / L oxybenzone at different pH values.

[0027] Figure 7 The degradation rate of 100 mg / L oxybenzone by Stenotrophomonas maltophilia CJY at different pH values ​​at 12 days.

[0028] Figure 8 OD of the culture medium 600 and bacterial dry weight value curve. (V) Specific implementation methods

[0029] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] The composition of the inorganic salt culture medium is: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl3 0.0162g / L, trace element mother solution 5mL / L, the solvent is deionized water, pH 7.0; the trace element mother solution composition is: CuSO4·5H2O0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0032] The final concentration composition of LB solid medium is: NaCl 10g / L, tryptone 10g / L, yeast powder 5g / L, agar 18-20g / L, the solvent is deionized water, and the pH value is natural.

[0033] The final concentration of LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0034] Example 1: Isolation, purification and identification of strain CJY.

[0035] 1. Isolation and purification of strain CJY.

[0036] Strain CJY is a Gram-negative bacterium domesticated and isolated from activated sludge from a sewage plant.

[0037] The specific steps are as follows:

[0038] Add 100 mL of inorganic salt medium to a 300 mL shake flask, add 10 mL of activated sludge and 100 mg / L of oxybenzone for enrichment culture. When the oxybenzone concentration is lower than the initial concentration, take out 5 mL of enrichment solution and add it to 100 mL of fresh inorganic salt medium. Add the same concentration of oxybenzone. Repeat the above enrichment process 5 times, then apply gradient dilution of the last enrichment solution to LB solid medium, select single colonies to separate the plate and purify by drawing lines ( Figure 1 ), the candidate bacteria were added to inorganic salt medium, and oxybenzone was added as the only carbon source and energy source for verification, and the target strain CJY was obtained. Its morphology was determined by transmission electron microscopy ( Figure 2 ).

[0039] 2. Identification of strain CJY

[0040] (1) Characteristics of strain CJY: The colonies are light yellow and disc-shaped, with neat edges, opaque, and easy to pick. Under a transmission electron microscope, the bacteria are ellipsoidal, have flagella, are 3000×7000nm in size, and are Gram-negative.

[0041] (2) Identification through 16S rRNA sequence analysis and physiological and biochemical experiments

[0042] DNA of strain CJY was extracted and purified using Ezup column bacterial genomic DNA extraction kit and stored at 4°C. Purified DNA was amplified by PCR using universal bacterial primers, 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), and the PCR reaction program was set to 94°C pre-denaturation for 4 min, then 94°C denaturation for 45 s, 55°C annealing for 45 s, 72°C extension for 1 min, 30 cycles, and finally 72°C repair extension for 10 min. The PCR product was purified and recovered for sequencing (Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)), and the 16S rRNA sequencing results were uploaded to NCBI, obtaining accession number PQ579954, and the sequence was compared with the gene sequence in the NCBI database by Blast. It was found to belong to the genus Stenotrophomonas and had 92% homology with Stenotrophomonas maltophilia strain HIB-100, Stenotrophomonas maltophilia strain F4-2-40 and Stenotrophomonas sp.DT40. Ten representative strains of Stenotrophomonas were selected from the results and a phylogenetic tree was constructed using MEGA-X version 10.2.6 software based on the homology of 16S rRNA gene sequences. Figure 3 The strain was identified as Stenotrophomonas maltophilia by comparison of genetic distance and 16S rRNA sequence.

[0043] (3) The ability of strain CJY to utilize 47 carbon sources on the BioMérieux GN card.

[0044] use The metabolic status of the strains to 47 different carbon sources was investigated using the 2compact fully automatic microbial analysis system (GN card) (entrusted to Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. 2compact fully automatic microbial analysis system (GN card) detection showed that strain CJY could utilize 10 carbon sources strongly, but could not utilize the other 37 carbon sources.

[0045] Table 1 Strain CJY 2Compact fully automatic microbial analysis system biochemical reaction results

[0046]

[0047]

[0048] Note: +, positive reaction; -: negative reaction

[0049] Through strain morphological characteristics, 16S rRNA sequence analysis and physiological and biochemical experiments, strain CJY was identified as Stenotrophomonas maltophilia, named Stenotrophomonas maltophilia CJY, and deposited in the China Center for Type Culture Collection, with the deposit number: CCTCCNO:M 20242471, the deposit date: November 7, 2024, address: Wuhan University, Wuhan, 430072, China.

[0050] Example 2. Obtaining resting cells of Stenotrophomonas maltophilia CJY

[0051] 1. Slant culture:

[0052] Inoculate Stenotrophomonas maltophilia CJY into LB liquid culture medium, culture at 30°C, 160rpm for 24-36h, then draw lines on solid LB plates and culture in a 30°C incubator, take single colonies and continue to draw lines on the plates to detect the purity of the bacteria, and store them in LB test tube slants as usual (4°C).

[0053] 2. Expand training

[0054] Inoculate the slant cells in step 1 into LB liquid medium and culture at 30°C, 160 rpm for 24-36 h to obtain the OD 600 = 0.1-0.2 of the bacterial liquid, centrifuge, collect the wet bacteria, wash with inorganic salt medium, and obtain the resting cells of Stenotrophomonas maltophilia CJY.

[0055] Example 3: Degradation performance test of Stenotrophomonas maltophilia CJY on oxybenzone at different concentrations.

[0056] The inorganic salt culture medium was divided into 300 mL shaking flasks, 100 mL per flask, and sterilized at 110°C for 40 min. After sterilization, it was placed at room temperature for 2 days to ensure that no foreign bacteria grew. The resting cells obtained by the method of Example 2 were added to a final concentration of 92 mg / L (based on cell dry weight), and then oxybenzone was added as the sole carbon source to a final concentration of 50, 75, 100, 125, and 150 mg / L, respectively. After the shaking flask was sealed, it was cultured in a shaking table at 30°C and 160 rpm, and a blank control without bacteria was performed. The residual oxybenzone concentration in the shaking flask was determined by liquid chromatography at regular intervals ( Figure 4 (a) is the liquid chromatogram of the reaction solution after 0h reaction with 100mg / L substrate, and the removal rate curve of oxybenzone with different initial concentrations of the strain over time is drawn. The results are shown in Figure 5 The results showed that when the concentration of oxybenzone was 50-125 mg / L, strain CJY could effectively degrade the added substrate.

[0057] Liquid chromatography parameters for determining the concentration of oxybenzone: the chromatograph was a Waters Alliance e2695 high performance liquid chromatograph (Waters, USA), the chromatographic column was a CORBAX SB-C18 column (5 μm, 4.5×250 mm), the volume ratio of the mobile phase of water to methanol containing 3% acetic acid was 25:75, the injection time was 6 min, the detection wavelength was 290 nm, the injection volume was 10 μL, and the volume flow rate was 1.0 mL×min -1 , column temperature was 30°C, and peak elution time was approximately 4.5 min.

[0058] Example 4: Degradation performance of Stenotrophomonas maltophilia CJY on 100 mg / L oxybenzone under different initial pH environments.

[0059] The inorganic salt medium was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0) with 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution, and the bacterial solution prepared by the method of Example 2 was inoculated under the condition that the initial oxybenzone concentration was 100 mg / L, so that the initial bacterial solution concentration in each parallel sample was OD 600 The sample was shaken and cultured in a constant temperature shaker at 30°C and 160 rpm, and a blank control without bacteria was made. The residual oxybenzone concentration in the shake flask was determined regularly using the method in Example 3, and the removal rate curve of oxybenzone under different pH environments of the strain over time and the degradation rate of 100 mg / L oxybenzone under different pH at 12 days were plotted. The results are shown in FIG. Figure 6 and Figure 7 The results showed that Stenotrophomonas maltophilia CJY had a good degradation effect on hydroxybenzone at pH 6-8, and the degradation effect of hydroxybenzone was the best at pH 7.

[0060] Different amounts (1, 1.5, 2, 2.5, 3, 3.5 mL) of the maltogenic bacteria CJY culture prepared by the method of Example 2 were added to 100 mL of inorganic salt culture medium, and the corresponding OD values ​​were measured using an ultraviolet absorption analyzer. 600 The inorganic salt medium containing the bacterial solution was centrifuged and dried, and the corresponding bacterial dry weight was obtained by weighing. The OD values ​​corresponding to different bacterial dry weights were plotted. 600 Value curve, the results are shown in Figure 8 .

[0061] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the protection scope of the present invention. Any changes and modifications made by any technician familiar with the technology without departing from the concept and scope of the present invention should fall within the protection scope of the present invention.

Claims

1. A strain of Stenotrophomonas maltophilia CJY with the ability to degrade oxybenzone, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO: M 20242471, deposit date: November 7, 2024, address: Wuhan University, Wuhan, China, 430072.

2. Use of Stenotrophomonas maltophilia CJY according to claim 1 in degrading oxybenzone.

3. The use according to claim 2, characterized in that The application is to obtain bacterial liquid or resting cells obtained by centrifugation of bacterial liquid after expanding the culture of Stenotrophomonas maltophilia CJY, add it to an inorganic salt culture medium with a pH of 6 to 8 and containing oxybenzone, and culture it at 10 to 30° C. and 100 to 200 rpm to achieve the degradation of oxybenzone.

4. The use according to claim 3, characterized in that The initial concentration of oxybenzone added to the inorganic salt culture medium is 50-150 mg / L.

5. The use according to claim 3, characterized in that In the inorganic salt medium, the amount of bacterial solution added is expressed as OD 600 The amount of resting cells added is 50-150 mg / L based on dry weight.

6. The use according to claim 3, characterized in that The inorganic salt culture medium is composed of: K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NaNO3 1.7 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, FeCl3 0.0162 g / L, trace element mother solution 5 ml / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution Composition: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, the solvent is deionized water.

7. The use according to claim 3, characterized in that Stenotrophomonas maltophilia CJY resting cells were prepared as follows: (1) Slant culture: Stenotrophomonas maltophilia CJY was inoculated into a slant LB solid medium and cultured at 30°C for 24-36 h to obtain slant cells; (2) Expansion culture: Use an inoculation loop to pick up the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 30°C and 160 rpm for 24 to 36 h to obtain the OD 600 = 0.1-0.2 of the bacterial liquid, centrifuge, collect the wet bacteria, wash with inorganic salt culture solution, and obtain the resting cells of Stenotrophomonas maltophilia CJY.

Images