Method for increasing passage frequency of mammary epithelial cell line and application of method

Abstract

The invention discloses a method for increasing the passage frequency of a mammary epithelial cell line and application of the method, and belongs to the technical field of mammary epithelial cell lines. It is found for the first time that an insulator-stent attachment area exogenous fragment HS4-SAR fragment is connected with a p-Ef1a-SV40LT-Puro vector or a pEF1a-eGFP vector, commercial immortalized cell lines and primary cell lines are transfected, the passage number of mammary gland epithelial cell lines can be remarkably increased, and the mammary gland epithelial cell lines can be obtained. After 120 generations of passage, the cell morphology is still normal, malignant transformation is avoided, and the gene expression level is still not reduced, so that immortalization is realized; the established milk goat mammary gland epithelial cell line still has the capability of synthesizing and secreting protein; the provided method for increasing the passage frequency of the mammary epithelial cell line is simple and easy to operate, has a remarkable effect on an immortalized cell line and a primary cell line, and is expected to increase the passage frequency of stable passage of various mammary epithelial cell lines and reduce the cell cost of related research.

Description

Technical Field

[0001] The invention relates to the technical field of mammary epithelial cell lines, in particular to a method for increasing the number of passages of mammary epithelial cell lines and an application thereof. Background Art

[0002] Mammary epithelial cell lines refer to epithelial cells isolated and cultured from mammary tissues. These cells can survive and proliferate for a long time in vitro. According to their sources and characteristics, mammary epithelial cell lines can be divided into two categories: primary cell lines and immortalized cell lines.

[0003] Primary cell lines refer to epithelial cells directly isolated from normal or diseased (such as tumor) breast tissue, which have similar biological characteristics to those in vivo; the number of subcultures is limited, and usually around 10-20 generations begin to show signs of decreased proliferation, differentiation or aging; because they are closer to the actual situation in vivo, they are suitable for studying normal physiological functions or early pathological processes.

[0004] Immortalized cell lines refer to cell lines that have been genetically modified (such as the introduction of SV40 large T antigen, hTERT, etc.) or isolated from tumor tissues. They can be passaged indefinitely and maintain stable proliferation ability and morphological characteristics. After genetic modification, some cell lines may lose some of their original characteristics, but still retain important pathological characteristics. Common immortalized cell lines include MCF-7, MDA-MB-231, SK-BR-3, etc. These cell lines are widely used in breast cancer research, drug screening and development, regenerative medicine research, toxicology research and other fields.

[0005] However, mammary epithelial cell lines often encounter the phenomenon of reduced transgene expression levels and transgene silencing. For example, the mammary epithelial cell line disclosed in the Chinese invention (publication number CN 111154807A) began to have poor cell status at the 50th generation, and green fluorescence was not expressed at the 60th generation because the green fluorescence was fused with the SV40LT gene, so SV40LT was silenced at the 60th generation. Gene silencing limits the number of passages and use of mammary epithelial cell lines. Chromatin insulators and scaffold / matrix attachment regions have been integrated into CHO cells alone or in combination to increase transgene expression levels and reduce silencing. Summary of the invention

[0006] The purpose of the present invention is to provide a method for increasing the number of passages of a mammary epithelial cell line and its application, so as to solve the current phenomenon that the transgene expression level decreases and the transgene is silenced after the mammary epithelial cell line is passaged for 50-60 generations, and to provide a method for significantly increasing the number of passages of a mammary epithelial cell line for stable passage.

[0007] To achieve the above object, the present invention provides the use of HS4-SAR and MAR2 fragments in increasing the number of passages of mammary epithelial cell lines. After the HS4-SAR and MAR2 fragments are connected to the target gene, they are transferred into mammary epithelial cells for conventional culture.

[0008] Preferably, the target gene is one of the SV40 large T antigen gene and the immortalization gene; the immortalization gene includes telomerase TERT, SV40 T antigen, proto-oncogene, and tumor suppressor gene.

[0009] The use of a vector containing the above HS4-SAR and MAR2 fragments in increasing the number of passages of a mammary epithelial cell line, wherein the vector is one of a p-Ef1a-SV40LT-Puro vector and a pEF1a-eGFP vector.

[0010] Preferably, the pEF1a-eGFP vector is constructed by using the vector ROSA26-E F1a-Nramp1 donor as a template, EF-1a-egfp-F and EF-1a-egfp-R as primers, and Takara high-fidelity enzyme The reaction system was prepared according to the instructions of HSDNA Polymerase enzyme, and the reaction procedure was: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 3 minutes, 35 cycles; complete extension at 72°C for 10 minutes.

[0011] Preferably, the EF-1a-egfp-F sequence is shown as SEQ ID NO.5, and the EF-1a-egfp-R sequence is shown as SEQ ID NO.6.

[0012] Preferably, the method for constructing the p-Ef1a-SV40LT-Puro vector is as follows: using Ef1a_Large T-antigen_Puro as a backbone vector, digesting with NheI, and recovering the target fragment of 11672Bp from the gel after electrophoresis.

[0013] A method for increasing the number of passages of a mammary epithelial cell line, comprising encapsulating the p-Ef1a-SV40LT-Puro vector containing the HS4-SAR fragment with a lentivirus to obtain lentiviral particles, infecting mammary epithelial cells with the lentiviral particles, adding 1 μg / mL Puromycin to the culture medium for screening for 7 to 10 days until a pinpoint-sized cell clone can be observed in a cell culture dish, i.e., positive cells are obtained, and the positive cells can be routinely cultured and passaged.

[0014] Preferably, during infection, the lentiviral particles are mixed with an equal volume of fresh DMEM / F12 culture medium and then added to a cell culture dish, and 8 μg / mL of polybrene is added to enhance the infectivity of the virus.

[0015] Preferably, the method for obtaining lentiviral particles is: using the p-Ef1a-SV40LT-Puro vector containing the HS4-SAR or MAR2 fragment as a lentiviral vector, using psPAX2 and pMD2.G as auxiliary packaging vectors, co-transfecting 293T cells to obtain lentiviral particles.

[0016] A mammary epithelial cell line obtained by the method for increasing the passage number of mammary epithelial cell line as described above.

[0017] Therefore, the present invention provides a method for increasing the number of passages of a mammary epithelial cell line and its application, and its specific technical effects are as follows:

[0018] (1) The present invention first discovered that the exogenous fragment HS4-SAR fragment of the insulator-scaffold attachment region was connected to the p-Ef1a-SV40LT-Puro vector or the pEF1a-eGFP vector and transfected into commercial immortalized cell lines and primary cell lines, which can significantly increase the number of passages of the breast epithelial cell line. After 120 passages, the cell morphology is still normal, there is no malignant transformation, and the gene expression level is still not reduced, thus achieving immortalization;

[0019] (2) The expression levels of milk protein-related genes in the goat mammary epithelial cell line established by the method provided by the present invention were significantly higher than those in the control cell line, indicating that the established goat mammary epithelial cell line still has the ability to synthesize and secrete proteins;

[0020] (3) The method for increasing the number of passages of mammary epithelial cell lines provided by the present invention is simple and easy to operate, and has significant effects on both immortalized cell lines and primary cell lines. It is expected to increase the number of passages of various mammary epithelial cell lines that can be stably cultured and reduce the cell cost of related research. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0022] Figure 1It is a structural diagram of pEF1a-eGFP, pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, and pEF1a-eGFP-HS4-SAR vectors in Example 1 of the present invention;

[0023] Figure 2 The inverted fluorescence microscope observation results (a) of different groups of cells transfected for 48 hours in Example 1 of the present invention, the statistical results of transfection efficiency (b), and the statistical results of relative expression of eGFP (c);

[0024] Figure 3 The inverted fluorescence microscope observation results of different groups of cells transfected for 14 days in Example 1 of the present invention (A), the fluorescent protein MFI graph (B), the MFI bar graph (C), and the MFI magnification bar graph (D);

[0025] Figure 4 The inverted fluorescence microscope observation results of different groups of cells transfected for 60 days and 90 days in Example 1 of the present invention (A), the fluorescent protein MFI graph (B), the MFI bar graph (C), and the MFI magnification bar graph (D);

[0026] Figure 5 is a structural diagram of the p-Ef1a-SV40LT-Puro vector in Example 2 of the present invention;

[0027] Figure 6 is a structural diagram of the p-Ef1a-SV40LT-Puro-HS4 vector in Example 2 of the present invention;

[0028] Figure 7 This is the inverted fluorescence microscope observation result of breast epithelial cell identification in Example 3 of the present invention; wherein part A is a bright field image of primary cells, and part B is a CK-18 immunofluorescence staining identification image of primary cells;

[0029] Figure 8 These are the observation results of different passage numbers in Example 3 of the present invention under an inverted fluorescence microscope; the scale bars in the figures are all 200 μm;

[0030] Fig. 9 This is the result of investigating the malignant transformation of cells transfected with p-Ef1a-SV40LT-Puro-HS4 in Example 3 of the present invention;

[0031] Fig.10 This is the result of karyotype analysis of cells transfected with p-Ef1a-SV40LT-Puro-HS4 in Example 3 of the present invention;

[0032] Fig.11This is the result of cell senescence detection of p-Ef1a-SV40LT-Puro-HS4 transfected in Example 3 of the present invention; wherein Part A is a β-galactosidase staining image of primary mammary epithelial cells F8, and Part B is a β-galactosidase staining image of immortalized mammary epithelial cells;

[0033] Fig.12 This is the Oil Red O detection result of cells transfected with p-Ef1a-SV40LT-Puro-HS4 in Example 3 of the present invention; wherein Part A is a 40× Oil Red O staining result diagram, and Part B is a 100× Oil Red O staining result diagram;

[0034] Fig.13 It is the relative expression level of milk protein related genes in cells transfected with p-Ef1a-SV40LT-Puro-HS4 in Example 4 of the present invention. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0036] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0037] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources. The methods and steps not described in detail in the examples are all conventional techniques in the art.

[0038] Embodiment 1

[0039] To select the best fragments, follow these steps:

[0040] S11. Send the sequence information of MAR2 (sequence as shown in SEQ ID NO.1) and HS4-SAR (sequence as shown in SEQ ID NO.2) to a biological company, and synthesize plasmids containing MAR2 and HS4-SAR fragments, respectively, and name them T-MAR2 and T-HS4-SAR, respectively.

[0041] SEQ ID NO.1:

[0042] TATACGTGAATAGTTTTTCTTCCCTCTGTGTGTTTTAAAATAGTTACTAATGCTTTCTTGGATCTGCATTTAGGAGTTATCCTTTCCATTAAAAATATAAGCTGTTTCTTCCAAGGCGACTCCTGGGCGTGGAGCTACCCTGGGGTATGGTTGATAAACACAGTGTCACTGTACATTGTTAGTTATAAATTATATAACTAATTTTAATTATAAAATTAACACTAATTATAATAGCATTATTAATGAAATTAACATTGATTATAATAAAACAAC ATTAATAATAAAATTAACATTGTAGACACTGGCTTGGAGTGCTATTAACCAAAACAGGCTGAGTGCCATTATTAGCAACAAGAGGCAAGATGATTTCCCTGCTTACAGAGAAATGGGGGCATTTTTAGGTAATGACA GAGTAATAGGTGTACTGATGGGGTAGGAGACATGGCTCAACAGTTAAGCTCTTGCTACACAGTTATTAGGACCGATTCAGATCCTAGCACCCACATAAAAGCAAAAGGGCATCCTGTGAACTTCTCAGTTCCAACTC

[0043] SEQ ID NO.2:

[0044]

[0045] S12, using HELA genome as template, hu-MAR-F (sequence as shown in SEQ ID NO.3) and hu-MAR-R (sequence as shown in SEQ ID NO.4) as primers, according to Takara high-fidelity enzyme The reaction system was constructed according to the instructions attached to the HSDNA Polymerase enzyme, and PCR amplification was performed. The PCR amplification conditions were: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 1 minute and 30 seconds, 35 cycles; complete extension at 72°C for 10 minutes, and the humar fragment (hu-MAR) was obtained after purification of the PCR product.

[0046] SEQ ID NO.3:GTCGACGGATCCCATTCTCCTTGATG

[0047] SEQ ID NO.4:GTCGACGAATTCAAACAACTCAATAGCAAG

[0048] S13. Homologous recombination of MAR2, HS4-SAR and hu-MAR fragments into the downstream region of pEF1a-eGFP. The specific steps are as follows:

[0049] Using the vector ROSA26-EF1a-Nramp1 donor (for the construction method, see Yuan Mengke's doctoral dissertation at Northwest Agriculture and Forestry University, "Study on improving the gene editing efficiency of disease-resistant cloned cattle based on CRISPR / Cas9 system optimization") as a template, EF-1a-egfp-F (sequence as shown in SEQ ID NO.5) and EF-1a-egfp-R (sequence as shown in SEQ ID NO.6) as primers, and Takara high-fidelity enzyme The reaction system was constructed according to the instructions attached to the HSDNA Polymerase enzyme, and PCR amplification was performed. The amplification program was 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 3 minutes, 35 cycles; 72℃ full extension for 10 minutes. An equal volume of ordinary Taq enzyme was added and extended for another 20 minutes. The amplified product was subjected to agarose gel electrophoresis, and the 2885bp fragment was recovered from the gel and ligated to the T-Vector pMD TM 19 (Simple) and named pEF1a-eGFP.

[0050] SEQ ID NO.5:AAGCTTGCTCCCGGTGCCCGTCAGTG

[0051] SEQ ID NO.6:GTCGACTAAGATACATTGATGAGTTTGGAC

[0052] Using T-MAR2 and T-HS4-SAR obtained in step S11 and hu-MAR obtained in step S12 as templates, homologous recombination primers are designed for PCR amplification. The homologous recombination primers are MAR2-F (sequence as shown in SEQ ID NO.7), MAR2-R (sequence as shown in SEQ ID NO.8), hu-MAR-F (sequence as shown in SEQ ID NO.9), hu-MAR-R (sequence as shown in SEQ ID NO.10), HS4-SAR-F (sequence as shown in SEQ ID NO.11), and HS4-SAR-R (sequence as shown in SEQ ID NO.12).

[0053] SEQ ID NO.7:atcaatgtatcttagtcgacTATACGTGAATAGTTTTTTCTTCCCT

[0054] SEQ ID NO.8:gccgttcgacgattgtcgacGAGTTGGAACTGAGAAGTTCACA

[0055] SEQ ID NO.9:atcaatgtatcttagtcgacGGATCCCATTCTCCTTGATGTA

[0056] SEQ ID NO.10:gccgttcgacgattgtcgacGAATTCAAACAACTCAATAGCAAGA

[0057] SEQ ID NO.11:atcaatgtatcttagtcgacCGGGGACAGCCCCC

[0058] SEQ ID NO.12:gccgttcgacgattgtcgacGAATATATCTTATTTTAAAATCAGT

[0059] Press Takara High Fidelity Enzyme The reaction system was prepared according to the instructions of HSDNA Polymerase, and PCR amplification was performed. The amplification program was 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 15 seconds, 72℃ extension for 1 minute 30 seconds, 35 cycles; 72℃ full extension for 10 minutes. MAR2 fragment (589bp), hu-MAR2 fragment (1273bp) and HS4-SAR fragment (1050bp) were recovered from gel.

[0060] pEF1a-eGFP was digested with SalI, and the 5579 bp fragment was recovered by gel extraction. -Basic Seamless Cloning and Assembly Kit Homologous recombination kit The MAR2 fragment, hu-MAR2 fragment and HS4-SAR fragment recovered from gel were connected with pEF1a-eGFP respectively, and the correctly connected vectors were named pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, pEF1a-eGFP-HS4-SAR respectively (the obtained recombinant vector structure is shown in Figure 1 shown).

[0061] S14. After MAC-T cells were revived, the cells were cultured at 37°C and 5% CO2 until the cell confluence reached 80%.

[0062] Based on Lipofectamine TM According to the instructions of Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA), 15 μL Lipofectamine 3000 and 10 μL P3000 transfection reagent were added for every 5 μg of vector. After mixing, the mixture containing pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, pEF1a-eGFP-HS4-SAR or pEF1a-eGFP vector was added to a cell dish with a confluence of 80%. After transfection for 48 hours at 37°C and 5% CO2, the cells were observed under an inverted fluorescence microscope. The results are shown in Figure 2. Figure 2 As indicated, cells were collected in triplicate and the expression of eGFP was analyzed by flow cytometry for transfection efficiency ( Figure 2 B) and the expression of fluorescent proteins ( Figure 2 C). The results showed that the transfection efficiency and fluorescent protein expression of pEF1a-eGFP-hu-MAR were significantly different from those of the control group, while there were no significant differences between the other two groups and the control group.

[0063] S15, 1 μg mL-1 was added 48 h after transfection -1 PURO screens cells transfected with the vector and kills cells not transfected with the vector. About one week after transfection, stable transfected cell colonies form, and all cells in the control group not transfected with the plasmid die. Then, 0.5 μg mL -1 The cells were cultured in PURO and DMEM / F12 medium without PURO, and the medium was changed every 2-3 days. On the 14th day after transfection, the cells were photographed under an inverted fluorescence microscope, and the cells were collected for flow cytometry analysis of eGFP expression. The expression level of eGFP was determined by measuring the MFI. Figure 3As shown, part A is a cell microscope photo, part B is an MFI graph, part C is a MFI bar graph, and part D is a magnification bar graph of four groups of MFI. The results showed that compared with the control group, cells stably transfected with hu-MAR and HS4-SAR fragments could slightly increase the expression of fluorescent protein, but the difference was not significant.

[0064] The subculture was continued and the cells were observed under an inverted fluorescence microscope on the 60th and 90th day after transfection. Figure 4 As shown, part A is the fluorescence graph without puro or with 0.5ug / ml puro on the 60th and 90th day of transfection, part B is the MFI graph, part C is the MFI bar graph, and part D is the retention rate of fluorescent protein expression intensity. The results showed that although the MFI and fluorescent protein expression intensity retention rate of cells containing MAR2 fragments at 90 days with 0.5ug / mL puro were significantly higher than those of the pEF1a-eGFP group, the MFI and fluorescent protein expression intensity retention rate of cells containing HS4-SAR fragments at 60 days and 90 days were significantly higher than those of the pEF1a-eGFP group. Therefore, the HS4-SAR fragment was selected for subsequent experiments.

[0065] Embodiment 2

[0066] The immortalized lentiviral plasmid containing the HS4-SAR fragment was constructed as follows:

[0067] S21, using Ef1a_Large T-antigen_Puro as the backbone vector, digested with NheI, and recovered the target fragment (11672 bp) after electrophoresis, named p-Ef1a-SV40LT-Puro (vector structure as shown in Figure 5 shown).

[0068] S22, amplify to obtain HS4-SAR fragment. Use T-HS4-SAR synthesized by the company as a template, use HS4-SAR-F (sequence as shown in SEQ ID NO.13) and HS4-SAR-R (sequence as shown in SEQ ID NO.14) as primers to perform PCR amplification, and recover the target fragment after electrophoresis of the amplified product.

[0069] SEQ ID NO.13:atacgaagttatcggctagcCGGGGACAGCCCCC

[0070] SEQ ID NO.14:tacagtccggaccagctagcGAATATATCTTATTTTAAAATCAGT

[0071] S23, the p-Ef1a-SV40LT-Puro obtained in step S21 and the gel recovery product obtained in S22 were connected using a homologous recombination kit of Quanshijin, and the recombinant vector was named p-Ef1a-SV40LT-Puro-HS4 (the vector structure is as follows Figure 6 shown).

[0072] Embodiment 3

[0073] The effect of HS4 fragment on the passage number and status of Saanen goat mammary epithelial cell line was investigated. The specific steps are as follows:

[0074] S31. Saanen goat mammary epithelial cells were obtained by tissue adhesion method.

[0075] The steps to obtain mammary epithelial cells of Saanen goats are as follows: ① Take a lactating goat from the cloned goat base of Northwest Agriculture and Forestry University, cut the skin of the breast with a blade, cut the breast, take the mammary tissue between the nipple and the bottom of the breast, put it in a dish with a diameter of 6 cm, rinse it with saline with twice the amount of antibiotics, put it in the dish to squeeze the milk, pour iodine, and move it to the operating table. ② Put in PBS containing antibiotics, use squeezing to wash away the milk, and wash until there is no milk in the eluent. Pick up the mammary tissue with tweezers, and you can see small particles. Cut off the small particles and put them in the center of the 24-well plate. ③ Migrated cells can be seen around 7 days. When the cells fill the field of view under a low-power microscope, add trypsin for digestion and passage.

[0076] S32. Identification of mammary epithelial cells.

[0077] Discard the culture medium, add 1 mL PBS and wash 3 times, 5 min each time; add 500 μL Fix with 4% paraformaldehyde for 15 min; wash with PBS 3 times, 3 min each time; add 0.1% TritonX-100 (dissolved in PBS, concentration is 100μL / 10mL) to each well and penetrate at room temperature for 10 min; wash with 0.1% TritonX-100, PBS 2 times, 5 min each time; block with 5% (0.5g / 10mL, dissolved in PBS) skim milk powder at room temperature for 1 h; discard the blocking solution, wash with PBS 2 times, 3 min each time; dilute CK-18 primary antibody (1:100) in primary antibody diluent, add 300μL to each well, and incubate at 4℃ overnight (more than 18h); wash with PBS 5 times, 3 min each time; dilute fluorescently labeled AlexaFluor488 labeled goat anti-mouse IgG (H+L) secondary antibody in PBS at 1:500, add 300μL to each well, and incubate at room temperature in the dark for 1-2h; wash with PBS 3 times, 5 min each time; add 300μL to each well DAPI (0.01%) was added at room temperature for 3 min; PBS was washed 3 times, 5 min each time; and then observed under an inverted fluorescence microscope. Figure 7As shown, the migrated cells were stained with CK-18, indicating that the separated cells were very pure and were mammary epithelial cells, which could be used for subsequent immortalized cell construction.

[0078] S33. Use p-Ef1a-SV40LT-Puro and p-Ef1a-SV40LT-Puro-HS4 constructed in Example 2 as lentiviral vectors, and use psPAX2 and pMD2.G as auxiliary packaging vectors to co-transfect 293T cells to obtain lentiviral particles.

[0079] The specific steps for obtaining lentiviral particles are: p-Ef1a-SV40LT-Puro / p-Ef1a-SV40LT-Puro-HS4 recombinant expression vector, packaged, and co-transfected with delivery vectors psPAX2 and pMD2.G into HEK-293T cells. The transfection ratio of the three vectors is p-Ef1a-SV40LT-Puro:psPAX2:pMD2.G=4:3:1. For specific transfection steps, refer to the instructions of Lipofectamine 2000 liposome transfection reagent. After 8 hours of transfection, replace with fresh DMEM culture medium and continue to culture in a 37°C 5% CO2 incubator for 48 hours. After observing that the culture medium turns orange-yellow, collect the culture supernatant, centrifuge at 1500rpm for 5 minutes to remove excess cell debris in the culture medium, and then filter with a 0.45μm filter to concentrate the lentivirus, store it at -80°C for a long time after aliquoting, and do not freeze and thaw repeatedly to reduce the virus titer, thereby affecting the infection efficiency.

[0080] S34, when the Saanen goat mammary epithelial cells digested in step S31 grow to a density of 60-70%, the lentiviral particles obtained in step S33 are used for infection:

[0081] ① Mix the virus supernatant with an equal volume of fresh DMEM / F12 culture medium and add it to the cell culture dish. At the same time, add 8μg / mL polybrene to enhance the virus's infection ability. After culturing in a 37℃5% CO2 incubator for 24 hours, discard the virus-containing culture medium supernatant. Gently rinse the cells twice with PBS, add ordinary fresh DMEM / F12 culture medium, and continue to culture in a 37℃5% CO2 incubator for subsequent experiments. ② If the cell density is too high after changing the medium, it is necessary to pass it. 72 hours after infection, add 1μg / mL Puromycin to the culture medium for screening for 7 to 10 days until pinpoint-sized cell clones can be observed in the cell culture dish, that is, positive cells are obtained.

[0082] The positive cells were routinely cultured and passaged, and observed under an inverted fluorescence microscope at the 10th passage (F10), 20th passage (F20), 30th passage (F30), 40th passage (F40), 50th passage (F50), 60th passage (F60), and 70th passage (F70). The results are as follows: Figure 8 As shown, the cell morphology of the mammary epithelial cell line without HS4 changed at the F40 generation, and the cells grew very slowly at the F60 generation, while the cell morphology of the cell line containing the HS4-SAR fragment remained stable at the F120 generation.

[0083] S35. Detect malignant transformation of cells transfected with p-Ef1a-SV40LT-Puro-HS4 (soft agar), using HELA cells and cells passaged 100 times in step S31 as controls. The specific steps are as follows:

[0084] Ultrapure water was used to prepare two concentrations of agarose solutions, 1.2% and 0.7%. Cells in the logarithmic phase were taken, digested with trypsin and centrifuged, and fully resuspended into single cells with 2×DMEM / F12 culture medium, counted, and the cell density was adjusted to 1000 cells / mL with DME / F12 cell culture medium. The cell suspension and 0.7% agarose solution were mixed in equal proportions, and 200 μL was pipetted into a cell culture dish with a 1.2% agarose bottom layer to form a double agar layer, which was cultured in a 37°C, 5% CO2 incubator. After two weeks, the clone formation was observed under a microscope, and then 0.005% crystal violet was added for staining for 30 minutes, and photos were taken under the microscope.

[0085] The results are as follows Fig. 9 As shown, HELA is a cancer cell with tumorigenicity, serving as a positive control. Primary GMECs are normal cells without tumorigenicity, serving as a negative control. The constructed mammary epithelial cell line also did not form colonies, indicating that the cell line did not undergo malignant transformation.

[0086] S36. Perform karyotype analysis on cells transfected with p-Ef1a-SV40LT-Puro-HS4: DNA content is indicated by DNA index. Collect test cells (immortalized mammary epithelial cell line) and reference cells (normal mammary epithelial cell line), fix with ice-cold 70% ethanol; stain with PI staining solution; divide the stained test cells into 2 equal parts, and mix them with reference cells that have been stained in the same ratio of 1:1; perform flow cytometric analysis on the samples using a flow cytometer, and analyze 20,000 cells for each sample.

[0087] The results are as follows Fig.10 As shown: The immortalized mammary epithelial cell line is a non-integer ploidy cell line, which is consistent with the results of previous immortalized cell transfection or infection with SV40 large T antigen and is a normal phenomenon.

[0088] S37. Perform senescence detection on cells transfected with p-Ef1a-SV40LT-Puro-HS4, using cells passaged 8 after digestion in step S31 (primary F8) as a control. The specific steps are as follows:

[0089] The cell senescence β-galactosidase staining kit of Biyuntian Company was used; the operation steps were as follows: for cells cultured in 6-well plates, the cell culture medium was discarded, washed once with PBS, 1 mL of β-galactosidase staining fixative was added, and fixed at room temperature for 15 minutes; the cell fixative was removed, and the cells were washed 3 times with PBS, each time for 3 minutes; PBS was removed, and 1 mL of staining working solution was added to each well. The staining working solution was prepared in a 15 mL polypropylene centrifuge tube: 10 μL of β-galactosidase staining solution A, 10 μL of β-galactosidase staining solution B, 30 μL of β-galactosidase staining solution C9, and 50 μL of X-Gal solution; incubated at 37°C overnight, and the 6-well plate was sealed with a sealing film to prevent evaporation; observed under an inverted fluorescence microscope and photographed and recorded.

[0090] The results are as follows Fig.11 As shown, primary F8 cells showed more β-gal positive cells, while the cell line transfected with p-Ef1a-SV40LT-Puro-HS4 showed almost no β-gal positive cells, indicating that the cell line had overcome replicative senescence and achieved immortality.

[0091] S38. Perform Oil Red O detection on cells transfected with p-Ef1a-SV40LT-Puro-HS4: Use the Solebow Oil Red O kit. The specific steps are as follows:

[0092] Remove the cell culture medium, wash twice with PBS, and fix with Oil Red O fixative for 20-30 minutes; discard the fixative, wash twice with distilled water, and add 60% isopropanol to soak for 20-30 seconds; discard the 60% isopropanol and add the newly prepared Oil Red O staining solution, and soak for 10-20 minutes; discard the staining solution, rinse with 60% isopropanol for 10-20 seconds until the stroma is clear; wash with distilled water 2-5 times until no excess stain comes out; add distilled water to cover the cells and observe under a microscope. The results are as follows Fig.12 As shown, red lipid droplets of varying sizes are diffusely distributed in the cytoplasm, indicating that the immortalized mammary epithelial cell line has lactation function and can be used for related experimental research.

[0093] Embodiment 4

[0094] The ability of the cell line transfected with p-Ef1a-SV40LT-Puro-HS4 to synthesize and secrete casein was investigated. The specific steps are as follows:

[0095] The 100-passage Saanen goat mammary epithelial cell line was inoculated into a 6-well plate. When the cells were about 80-90% confluent, the induction medium was added to induce. The induction medium contained: 5μg / mL prolactin, 1×ITS, 3μg / mL hydrocortisone and 10ng / mL EGF for 48h. RNA was extracted. Cells without prolactin were used as controls. qPCR was used to detect the expression of milk protein-related genes. The results are shown in Fig.13 As shown, cells are sensitive to prolactin, and the expression of CSN2 in cells containing prolactin is significantly higher than that in cells without prolactin.

[0096] Therefore, the present invention first discovered that the exogenous HS4-SAR fragment of the insulator-scaffold attachment region is connected to the p-Ef1a-SV40LT-Puro vector or the pEF1a-eGFP vector, and transfected into commercial immortalized cell lines and primary cell lines, which can significantly increase the number of passages of the mammary epithelial cell line. After 120 passages, the cell morphology is still normal, there is no malignant transformation, and the gene expression level has not decreased, thereby achieving immortalization; the established dairy goat mammary epithelial cell line still has the ability to synthesize and secrete proteins; the provided method for increasing the number of passages of the mammary epithelial cell line is simple and easy to operate, has a significant effect on both immortalized cell lines and primary cell lines, and is expected to increase the number of stable passages of various mammary epithelial cell lines and reduce the cell cost of related research.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of HS4-SAR and MAR2 fragments in increasing the number of passages of mammary epithelial cell lines, characterized in that: After the HS4-SAR and MAR2 fragments were connected to the target gene, they were transferred into mammary epithelial cells and cultured routinely.

2. The use of the HS4-SAR and MAR2 fragments according to claim 1 in increasing the number of passages of mammary epithelial cell lines, characterized in that: The target gene is one of the SV40 large T antigen gene and the immortalization gene; the immortalization gene includes telomerase TERT, SV40 T antigen, proto-oncogene and tumor suppressor gene.

3. Use of a vector comprising the HS4-SAR and MAR2 fragments of claim 1 in increasing the number of passages of a mammary epithelial cell line, characterized in that: The vector is one of a p-Ef1a-SV40LT-Puro vector and a pEF1a-eGFP vector.

4. Use of the vector comprising HS4-SAR and MAR2 fragments according to claim 3 in increasing the number of passages of a mammary epithelial cell line, characterized in that: The construction method of pEF1a-eGFP vector is as follows: using vector ROSA26-EF1a-Nramp1donor as template, EF-1a-egfp-F and EF-1a-egfp-R as primers, and Takara high-fidelity enzyme The reaction system was prepared according to the instructions attached to the HSDNA Polymerase enzyme. The reaction procedure was: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 3 minutes, 35 cycles; complete extension at 72°C for 10 minutes.

5. Use of the vector comprising HS4-SAR and MAR2 fragments according to claim 4 in increasing the number of passages of a mammary epithelial cell line, characterized in that: The EF-1a-egfp-F sequence is shown in SEQ ID NO.5, and the EF-1a-egfp-R sequence is shown in SEQ ID NO.

6.

6. Use of the vector comprising HS4-SAR and MAR2 fragments according to claim 3 in increasing the number of passages of a mammary epithelial cell line, characterized in that: The construction method of p-Ef1a-SV40LT-Puro vector is as follows: using Ef1a_Large T-antigen_Puro as the backbone vector, digesting with NheI, and recovering the target fragment of 11672Bp from the gel after electrophoresis.

7. A method for increasing the number of passages of a mammary epithelial cell line, characterized in that: The p-Ef1a-SV40LT-Puro vector and the p-Ef1a-SV40LT-Puro vector containing the HS4-SAR fragment described in claim 3 are respectively encapsulated with lentivirus to obtain lentiviral particles, and the mammary epithelial cells are infected with the lentiviral particles. 1 μg / mL Promycin is added to the culture medium for screening for 7-10 days until a pinpoint-sized cell clone can be observed in the cell culture dish, i.e., positive cells are obtained, and the positive cells can be routinely cultured and passaged.

8. A method for increasing the number of passages of a mammary epithelial cell line according to claim 7, characterized in that: During infection, the lentiviral particles were mixed with an equal volume of fresh DMEM / F12 culture medium and added to the cell culture dish. At the same time, 8 μg / mL of polybrene was added to enhance the infection ability of the virus.

9. A method for increasing the number of passages of a mammary epithelial cell line according to claim 7, characterized in that: The method for obtaining lentiviral particles is as follows: using p-Ef1a-SV40LT-Puro vector or p-Ef1a-SV40LT-Puro vector containing HS4-SAR or MAR2 fragment as lentiviral vector, using psPAX2 and pMD2.G as auxiliary packaging vectors, co-transfecting 293T cells to obtain lentiviral particles.

10. A mammary epithelial cell line obtained by the method for increasing the number of passages of a mammary epithelial cell line according to any one of claims 7 to 9, characterized in that: The mammary epithelial cell lines are cell lines transfected with p-Ef1a-SV40LT-Puro-HS4 and cell lines transfected with p-Ef1a-SV40LT-Puro.

Images