Protein with alkaline phosphatase activity and application thereof

Abstract

The invention relates to a protein with alkaline phosphatase activity and application thereof. In particular to a protein with alkaline phosphatase activity, a gene for coding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing alkaline phosphatase and application of the alkaline phosphatase in preparation of high-temperature-resistant and / or alkali-resistant products. The protein with alkaline phosphatase activity disclosed by the invention has relatively high high temperature resistance and alkali resistance, and lays a foundation for improving the application of alkaline phosphatase in the fields of food, feed, medicine, environmental governance, pesticide degradation and the like.

Description

Technical Field

[0001] The present disclosure relates to the field of gene engineering technology, and in particular, to a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector having the gene inserted therein, a transformant having the gene transformed therein, a method for preparing alkaline phosphatase, and application of alkaline phosphatase in preparing products having high temperature resistance and / or alkali resistance. Background Art

[0002] Alkaline phosphatase is a non-specific phosphomonoesterase widely present in animals, plants and microorganisms. It hydrolyzes phosphate compounds under alkaline conditions to produce inorganic phosphate. It also has the activity of catalyzing phosphate group transfer reactions.

[0003] Alkaline phosphatase is widely used in enzyme-linked immunosorbent assay, biosensors, non-isotopic probes, hybridization and sequencing, and degradation of organophosphorus pesticides. Currently, commercial alkaline phosphatase has a serious problem of poor thermal stability, and it is urgent to explore more efficient and stable alkaline phosphatase resources. Summary of the invention

[0004] The purpose of the present disclosure is to provide a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector having the gene inserted therein, a transformant having the gene transformed therein, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products having high temperature resistance and / or alkali resistance.

[0005] In order to achieve the above-mentioned object, the present disclosure provides, in a first aspect, a protein having alkaline phosphatase activity, wherein the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0006] The second aspect of the present disclosure provides a gene encoding the protein described in the first aspect.

[0007] Optionally, the nucleotide sequence of the gene is the DNA molecule shown in SEQ ID NO.2.

[0008] The third aspect of the present disclosure provides a recombinant vector into which the gene described in the second aspect is inserted.

[0009] Optionally, the recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is the DNA molecule shown in SEQ ID NO.3.

[0010] A fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene described in the second aspect, or the transformant is introduced with the recombinant vector described in the third aspect.

[0011] Optionally, the genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis.

[0012] A fifth aspect of the present disclosure provides a method for preparing alkaline phosphatase, the method comprising: culturing the transformant described in the fourth aspect to obtain a cultured material.

[0013] A sixth aspect of the present disclosure provides an application of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the first aspect.

[0014] The seventh aspect of the present disclosure provides the use of the recombinant vector described in the third aspect or the transformant described in the fourth aspect in the preparation of a product with high temperature resistance and / or alkali resistance.

[0015] Through the above technical scheme, the present disclosure provides a protein with alkaline phosphatase activity, a gene encoding the protein, a recombinant vector with the gene inserted, a transformant with the gene, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products with high temperature resistance and / or alkali resistance. The protein with alkaline phosphatase activity disclosed in the present disclosure has high high temperature resistance and alkali resistance, which lays a foundation for improving the application of alkaline phosphatase in the fields of food, feed, medicine, environmental management and pesticide degradation.

[0016] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 This is the SDS-PAGE electrophoresis result of alkaline phosphatase BliAlpN.

[0018] Figure 2 It is the structural analysis result of alkaline phosphatase BliAlpN; wherein A shows the simulated 3D structure of alkaline phosphatase BliAlpN, and B shows the metal ion binding amino acid residues of alkaline phosphatase BliAlpN.

[0019] Figure 3 It is the result of enzymatic property analysis of alkaline phosphatase BliAlpN; wherein A is the specific enzyme activity of alkaline phosphatase BliAlpN at different temperatures; and B is the specific enzyme activity of alkaline phosphatase BliAlpN at different pH values.

[0020] Figure 4 These are the stability test results of BliAlpN.

[0021] Figure 5 The effect of different metal ions on the enzyme activity of alkaline phosphatase BliAlpN. DETAILED DESCRIPTION

[0022] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0023] In the present disclosure, the terms "protein having alkaline phosphatase activity", "alkaline phosphatase" and "BliAlpN protein" can be used interchangeably, and all refer to the protein having an amino acid sequence as shown in SEQ ID NO.1.

[0024] In the present disclosure, the terms "gene encoding the protein described in the first aspect" and " BliAlpN "Gene" can be used interchangeably and refers to a DNA molecule whose nucleotide sequence is shown in SEQ ID NO.2.

[0025] In a first aspect, the present disclosure provides a protein having alkaline phosphatase activity, wherein the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0026] In the present disclosure, the protein having alkaline phosphatase activity is preferably a protein of natural origin, for example, the protein is from Bacillus licheniformis. The inventors of the present disclosure surprisingly found that the protein having alkaline phosphatase activity of the present disclosure has high resistance to high temperature and alkali, which lays a foundation for improving the application of alkaline phosphatase in the fields of food, feed, medicine, environmental management and pesticide degradation.

[0027] The second aspect of the present disclosure provides a gene encoding the protein described in the first aspect.

[0028] Wherein, the nucleotide sequence of the gene is the DNA molecule shown in SEQ ID NO.2.

[0029] In the present disclosure, the full-length sequence of the gene is 1743 bp, which encodes a protein of 580 amino acids. The inventors of the present disclosure used Swiss-Model (https: / / swissmodel.expasy.org / ) to perform structural analysis on the BliAlpN protein, as shown in FIG. Figure 2 As shown, the amino acid similarity of this protein to the reported Bacillus licheniformis alkaline phosphatase protein (AAU39240.1) is 81.93%, and the protein structure contains conserved amino acid residues that may interact with metal ions, indicating that this protein is a new protein with alkaline phosphatase activity.

[0030] The third aspect of the present disclosure provides a recombinant vector into which the gene described in the second aspect is inserted.

[0031] Wherein, the recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is the DNA molecule shown in SEQ ID NO.3.

[0032] A fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene described in the second aspect, or the transformant is introduced with the recombinant vector described in the third aspect.

[0033] In one embodiment of the present disclosure, the genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis. For example, when the recombinant vector is pET28a, the host of the transformant is Escherichia coli.

[0034] A fifth aspect of the present disclosure provides a method for preparing alkaline phosphatase, the method comprising: culturing the transformant described in the fourth aspect to obtain a cultured material.

[0035] A sixth aspect of the present disclosure provides an application of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the first aspect.

[0036] The seventh aspect of the present disclosure provides the use of the recombinant vector described in the third aspect or the transformant described in the fourth aspect in the preparation of a product with high temperature resistance and / or alkali resistance.

[0037] The present disclosure is further described in detail below through examples, but the present disclosure is not limited thereby.

[0038] The raw materials used in the following examples can all be obtained through commercial sources; Escherichia coli BL21 (DE3) strain was purchased from Nanjing Novezan Biotechnology Co., Ltd.

[0039] Experimental reagents: C115-01 recombinant enzyme and E112-01 protein detection solution were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; pET28a vector was purchased from Merck, Germany, and NTA series buffer (Cat. No.: C600304-0500) was purchased from Sangon Biotech (Shanghai) Co., Ltd.; M5 HiPer Bacteria Genomic DNA Kit bacterial genome extraction kit was purchased from Beijing Juhemei Biotechnology Co., Ltd.

[0040] Experimental instruments: The 70666-3 nickel column was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.

[0041] Example 1 This example is used to illustrate the construction of a recombinant expression Escherichia coli engineering strain expressing the BliAlpN gene.

[0042] 1. Amplified based on the genome sequence of the Bacillus licheniformis strain isolated from the Tara planting base in Yimen County, Yuxi City, Yunnan Province BliAlpN Gene, PCR specific primers are: BliAlpN-F: 5'GAAGGAGATATACCATGGGCGCACCGAGGTTCTCCGAAT3'SEQ ID NO.4; BliAlpN-R: 5'TGGTGGTGGTGGGTGCTCGAGCTTTTTCTCCTTTTGCTTC3' SEQ ID NO.5.

[0043] 2. Amplify the target gene by PCR BliAlpN The PCR amplification system was 20 μL, including 10 μL 2×Phanta Max Master Mix, 1 μL DNA template, 1 μL upstream primer with an initial concentration of 10 μmol / L, 1 μL downstream primer with an initial concentration of 10 μmol / L, and 7 μL ddH 2 O, PCR amplification program is 95℃ denaturation for 3min→(95℃ denaturation for 30s→60℃ annealing for 30s→72℃ extension for 1min)×35 cycles→72℃ extension for 5min→4℃ storage, BliAlpN Gene.

[0044] 3. After the PCR product is recovered by gel, it is converted into BliAlpN Genes connected to Nco I / XOt The E. coli expression vector pET28a- BliAlpN The expression vector was transformed into Escherichia coli BL21 (DE3), and the inserted sequence was verified to be correct by PCR, restriction digestion, and sequencing. The strain was named BL21- BliAlpN .

[0045] 4. Protein structure analysis: The Swiss-Model (https: / / swissmodel.expasy.org / ) was used to analyze the structure of BliAlpN protein. The results are as follows: Figure 2 shown.

[0046] The experimental results of this embodiment are as follows: BliAlpNThe full length of the gene is 1743bp (sequence see SEQ ID NO.2), which encodes a protein of 580 amino acids (sequence see SEQ ID NO.1), of which amino acids 1-56 are signal peptide segments. Homology comparison analysis shows that the BliAlpN protein in Bacillus licheniformis found in Yunnan has an amino acid similarity of 81.93% with the reported Bacillus licheniformis alkaline phosphatase protein (AAU39240.1) and an amino acid similarity of 74.60% with the Bacillus subtilis alkaline phosphatase protein (WP_009969242.1). The BliAlpN protein structure contains conserved amino acid residues that may interact with metal ions, indicating that the BliAlpN protein is a newly discovered phosphatase protein. Through gene sequencing identification, the present disclosure successfully cloned BliAlpN The gene does not contain a signal peptide sequence and is successfully expressed BliAlpN Recombinant Escherichia coli engineered strains.

[0047] Example 2 This example is about the induced expression and purification of BliAlpN protein.

[0048] The experimental materials of this embodiment include: Recombinant engineering strain: The strain obtained in Example 1 contains BliAlpN Recombinant gene expression strains; The experimental method of this embodiment includes: 1. Induced expression and purification of recombinant protein: (1) Add 5 mL of engineered strain BL21- BliAlpN Seed solution (OD 600 =5) Inoculate the bacteria into 500 mL of LB liquid medium supplemented with kanamycin (50 μg / mL) at a 1% inoculum volume and culture at 37°C until the bacterial concentration reaches 0.6-0.8; (2) IPTG (final concentration 0.3 mmol / L) was added to induce protein expression at 16°C for 20 h. IPTG is an inducer for inducing the expression of BliAlpN protein in the recombinant strain, but not a substrate for the catalytic reaction.

[0049] 2. Purification of recombinant protein by affinity chromatography: (1) Collect the cells by centrifugation at 5000 rpm for 10 min, resuspend in NTA-0 buffer, and then disrupt by ultrasonication for 10 min; (2) Set the ultrasonic power to 400 W, and rest for 5 seconds after each 3 seconds of ultrasonication; after the end of ultrasonication, centrifuge at 5000 rpm for 30 minutes to collect the supernatant to obtain the crude enzyme solution; (3) The crude enzyme solution was used to wash the 70666-3 nickel column twice at a washing flow rate of 1 mL / min, and then NTA-10 buffer, NTA-20 buffer, NTA-40 buffer, NTA-60 buffer, NTA-580 buffer, and NTA-100 buffer were used for gradient elution at a flow rate of 1 mL / min. At the same time, E112-01 protein detection solution was used for detection and the elution peak was collected. After ultrafiltration and centrifugation to remove imidazole, a purified BliAlpN enzyme solution was obtained. The BliAlpN enzyme solution was subjected to SDS-PAGE electrophoresis. The results are as follows: Figure 1 As shown, lane M is a protein marker, lane 1 is a BL21-BliAlpN bacterial solution without IPTG induction, lane 2 is a total protein of the engineered strain BL21-BliAlpN induced by IPTG, lane 3 is a crude enzyme solution of alkaline phosphatase BliAlpN, lane 4 is a column flow-through of the crude enzyme solution of alkaline phosphatase BliAlpN, lane 5 is a 0mmol / L imidazole NTA-0 elution flow-through, lane 6 is Lane 7 is the elution flow-through of 10mmol / L imidazole NTA-10, lane 7 is the elution flow-through of 20mmol / L imidazole NTA-20; lane 8 is the elution flow-through of 40mmol / L imidazole NTA-40; lane 9 is the elution flow-through of 60mmol / L imidazole NTA-60; lane 10 is the elution flow-through of 80mmol / L imidazole NTA-80; lane 11 is the elution flow-through of 100mmol / L imidazole NTA-100.

[0050] The experimental results show that BliAlpN The gene can be expressed in large amounts in E. coli. When eluted with 60mM, 80mM and 100mM imidazole eluents, a single protein band appeared at about 59kDa, which was close to the predicted protein size of the fused His-Tag, indicating that BliAlpN was eluted in a buffer containing 60-100mM imidazole. The SDS-PAGE electrophoresis of the purified BliAlpN protein had a clear background, high protein purity and high expression level. The purified protein was used for the next step of enzymatic property research.

[0051] Example 3 This example is an analysis of the enzymatic properties of alkaline phosphatase BliAlpN.

[0052] The experimental materials of this example include: the BliAlpN protein obtained in Example 2.

[0053] The experimental method of this embodiment includes: 1. Enzyme activity determination: The purified BliAlpN protein was diluted to 500 mg / L, 100 μL of the diluted protein solution was taken, and 50 μL of p-NPP substrate (1 mg / mL) with different pH values ​​(pH values ​​were 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) was added, and the reaction was carried out at different temperatures (temperatures were 20, 30, 40, 50, 60, 70, 80, 90, 100 ° C) for 20 min, and 50 μL of 0.5 mol / L NaOH was added to terminate the reaction. The absorbance was measured at 405 nm, and the enzyme activity was calculated. One enzyme activity unit (U) was defined as the amount of enzyme required to catalyze the hydrolysis of the substrate to produce 1 μmol of p-nitrophenol (pNP) within 1 min.

[0054] 2. Enzyme characteristics analysis: (1) Determination of the optimal reaction temperature: The reaction system was placed in a 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 10) and reacted at 20, 30, 40, 50, 60, 70, 80, 90, or 100°C for 20 min.

[0055] The maximum enzyme activity was taken as 100%, and the relative enzyme activity at different temperatures (the percentage of enzyme activity at various temperatures relative to the maximum enzyme activity) was calculated.

[0056] (2) Determination of optimal reaction pH: According to the enzyme activity determination method, the enzyme activity of the recombinant protein was measured when the reaction system temperature was set at 80°C in 0.1 mol / L citric acid-sodium citrate buffer solution at pH values ​​of 3.0, 4.0, 5.0, and 6.0, 0.2 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution at pH values ​​of 7.0 and 8.0, and 0.2 mol / L glycine-sodium hydroxide buffer solution at pH values ​​of 9.0, 10.0, 11.0, and 12.0.

[0057] The maximum enzyme activity was taken as 100%, and the relative enzyme activity at different pH values ​​(the percentage of enzyme activity at various pH values ​​relative to the maximum enzyme activity) was calculated.

[0058] (3) Temperature stability test: The BliAlpN enzyme solution was diluted to 500 mg / L, and then treated at 80°C, 90°C and 100°C for 0, 30, 60 and 90 min, respectively. A 0.2 mol / L glycine-sodium hydroxide buffer solution was added to adjust the pH of the reaction system to 10. The specific enzyme activity was determined according to the above method. The enzyme activity measured at 0 min treatment under each temperature condition was taken as 100%. The calculation formula is: Relative enzyme activity (%) = U 1 / U 0 ×100%, where U 0 The highest enzyme activity was obtained when the treatment was performed at 0 min. 1The enzyme activity is treated at 80, 90, and 100°C for 30, 60, and 90 minutes respectively.

[0059] (4) Effects of different metal ions on enzyme activity: 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 10) was used to prepare 10 mM K + , Ca 2+ Mg 2+ , Cu 2+ , Mn 2+ 、Ni 2+ 、Zn 2+ 、Co 2+ , Fe 2+ 9 metal ion solutions were used according to the enzyme activity determination method. The reaction system without metal ions was used as the control (CK) 100%, and the relative enzyme activity under different metal ion conditions was calculated using the following formula: Relative enzyme activity (%) = U 2 / U 3 ×100%, where U 3 is the highest enzyme activity of the control (CK), U 2 It is the enzyme activity of solutions containing different metal ions.

[0060] The experimental results of this embodiment are as follows: The results of the enzymatic property analysis of BliAlpN are as follows Figure 3-5 As shown by Figure 3 A It can be seen that the alkaline phosphatase BliAlpN cloned from the Bacillus licheniformis isolated from the Tara planting base in Yunnan disclosed in the present invention has the highest relative enzyme activity at 80°C in vitro catalytic reaction. Under the reaction conditions of 60-90°C, BliAlpN can exert good enzyme activity, and the enzyme activity is retained by more than 80%. Figure 3 B It can be seen that the optimal pH value of the in vitro catalytic reaction of BliAlpN is 10, and the relative enzyme activity is highest at pH 7-11, and more than 80% of the enzyme activity can be retained.

[0061] Depend on Figure 4 It can be seen that the enzyme activity of BliAlpN can be retained by more than 80% after being treated at pH 10 and temperature 80°C for 90 minutes, indicating that BliAlpN has good stability. The results show that BliAlpN is a thermostable and alkaline phosphatase, and its specific enzyme activity at the optimum temperature of 80°C and pH 10 is 8326±16.32U / mg.

[0062] according to Figure 5 The results show that Ca 2+ and Mn 2+ It has a significant promoting effect on the activity of alkaline phosphatase BliAlpN. 2+ 、Zn 2+and Mg 2+ It has an inhibitory effect on the activity of alkaline phosphatase BliAlpN. 2+ It can increase the activity of alkaline phosphatase BliAlpN by 1.81 times.

[0063] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0064] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0065] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A protein having alkaline phosphatase activity, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

1.

2. A gene encoding the protein according to claim 1.

3. The gene according to claim 2, wherein The nucleotide sequence of the gene is the DNA molecule shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: The recombinant vector is inserted with the gene according to claim 2 or 3.

5. The recombinant vector according to claim 4, wherein The recombinant vector is a recombinant expression vector, and the nucleotide sequence of the recombinant expression vector is the DNA molecule shown in SEQ ID NO.

3.

6. A transformant, characterized in that The host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene according to claim 2 or 3, or the transformant is introduced with the recombinant vector according to claim 4 or 5.

7. The transformant according to claim 6, wherein The genetically engineered bacteria is at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis.

8. A method for preparing alkaline phosphatase, characterized in that: The method comprises: culturing the transformant according to claim 6 or 7 to obtain a cultured material.

9. Use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, characterized in that: The alkaline phosphatase is the protein according to claim 1.

10. Use of the recombinant vector according to claim 4 or 5 or the transformant according to claim 6 or 7 in preparing a product having high temperature resistance and / or alkali resistance.

Images