Method for improving activity of alkaline phosphatase and application

Abstract

The invention relates to a method for improving the activity of alkaline phosphatase and application. In particular to a method for improving the activity of alkaline phosphatase, a protein with the activity of alkaline phosphatase, a gene for coding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing alkaline phosphatase and application of alkaline phosphatase in preparation of high-temperature-resistant and / or alkali-resistant products. Compared with wild alkaline phosphatase, the mutant PhoDl-M1 has better high temperature resistance, alkali resistance and stability, and lays a foundation for improving the application of the alkaline phosphatase in the fields of food, feed, medicine, environmental governance, pesticide degradation and the like.

Description

Technical Field

[0001] The present disclosure relates to the field of gene engineering technology, and in particular, to a method for improving the activity of alkaline phosphatase, a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing alkaline phosphatase, and application of alkaline phosphatase in preparing products with high temperature resistance and / or alkali resistance. Background Art

[0002] Alkaline phosphatase is a non-specific phosphomonoesterase widely present in animals, plants and microorganisms. It hydrolyzes phosphate compounds under alkaline conditions to produce inorganic phosphate. It also has the activity of catalyzing phosphate group transfer reactions.

[0003] Alkaline phosphatase is widely used in enzyme-linked immunosorbent assay, biosensor, non-isotope probe, hybridization and sequencing, and degradation of organophosphorus pesticides. Currently, commercial alkaline phosphatase has a serious problem of poor thermal stability, and a method for improving the activity of alkaline phosphatase is urgently needed. Summary of the invention

[0004] The purpose of the present disclosure is to provide a method for improving the activity of alkaline phosphatase, a protein having alkaline phosphatase activity, a gene encoding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products with high temperature resistance and / or alkali resistance.

[0005] In order to achieve the above-mentioned purpose, the first aspect of the present disclosure provides a method for improving the activity of alkaline phosphatase, which comprises mutating a wild-type amino acid residue fragment to be mutated, wherein the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2; the amino acid residue fragment to be mutated is the 354th to 369th position, and the mutation modification is the replacement of the amino acid residue fragment.

[0006] Optionally, the mutation modification includes: mutating the amino acid residue fragment AEQEAWLFDNLSRSEA from position 354 to position 369 to KDQEQWVESKLASSST.

[0007] The second aspect of the present disclosure provides a protein having alkaline phosphatase activity, wherein the protein is obtained by subjecting a wild-type alkaline phosphatase to a mutation-modified amino acid residue fragment to be mutated, wherein the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2; the amino acid residue fragment to be mutated is from position 354 to position 369, and the mutation-modified protein is a substitution of the amino acid residue fragment.

[0008] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.1.

[0009] The third aspect of the present disclosure provides a gene encoding the protein described in the second aspect, wherein the gene is a DNA molecule whose nucleotide sequence is shown in SEQ ID NO.3.

[0010] The fourth aspect of the present disclosure provides a recombinant vector, which is a recombinant expression vector, and the gene described in the third aspect is inserted into the recombinant vector.

[0011] A fifth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene described in the third aspect, or the transformant is introduced with the recombinant vector described in the fourth aspect.

[0012] A sixth aspect of the present disclosure provides a method for preparing alkaline phosphatase, the method comprising: culturing the transformant described in the fifth aspect to obtain a cultured material.

[0013] A seventh aspect of the present disclosure provides a use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the second aspect.

[0014] An eighth aspect of the present disclosure provides use of the recombinant vector described in the fourth aspect or the transformant described in the fifth aspect in preparing a product with high temperature resistance and / or alkali resistance.

[0015] Through the above technical scheme, the present disclosure provides a method for improving the activity of alkaline phosphatase, a protein with alkaline phosphatase activity, a gene encoding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing alkaline phosphatase, and the use of alkaline phosphatase in preparing products with high temperature resistance and / or alkali resistance. The mutant PhoDl-M1 has better high temperature resistance, alkali resistance and stability than the wild-type alkaline phosphatase, laying a foundation for improving the application of alkaline phosphatase in the fields of food, feed, medicine, environmental management and pesticide degradation.

[0016] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 It is the result of multiple amino acid sequence alignment analysis of alkaline phosphatase BliAlpN.

[0018] Figure 2The figure shows the SDS-PAGE electrophoresis results of alkaline phosphatase PhoD1 and mutant PhoD1-M1.

[0019] Figure 3 These are the optimal temperatures for the enzyme activity of alkaline phosphatase PhoD1 and its mutant PhoD1-M1.

[0020] Figure 4 This is the optimal pH value for the enzyme activity of alkaline phosphatase PhoD1 and mutant PhoD1-M1.

[0021] Figure 5 Results of enzyme activity stability analysis of alkaline phosphatase PhoD1 and mutant PhoD1-M1. DETAILED DESCRIPTION

[0022] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0023] In the present disclosure, the terms "alkaline phosphatase PhoD1-M1", "PhoD1-M1" and "mutant PhoDbl-M1" can be used interchangeably, and all refer to the protein having an amino acid sequence as shown in SEQ ID NO.1.

[0024] The term "recombinant alkaline phosphatase gene PhoDbl-M1 ", "Alkaline phosphatase gene PhoDbl-M1 "and" PhoDbl- M1 ” can be used interchangeably and refer to a DNA molecule with a nucleotide sequence such as that shown in SEQ ID NO.3.

[0025] The first aspect of the present disclosure provides a method for improving the activity of alkaline phosphatase, which comprises mutating a wild-type amino acid residue fragment to be mutated. The amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2; the amino acid residue fragment to be mutated is from position 354 to position 369, and the mutation modification is a substitution of the amino acid residue fragment.

[0026] In one embodiment, the mutation modification includes: mutating the amino acid residue fragment AEQEAWLFDNLSRSEA from position 354 to position 369 to KDQEQWVESKLASSST.

[0027] In the present disclosure, the inventors of the present disclosure surprisingly found that the mutant PhoDl-M1 in which the amino acid residue fragment AEQEAWLFDNLSRSEA at positions 354 to 369 mutated to KDQEQWVESKLASSST has better high temperature resistance, alkali resistance and stability than the wild-type alkaline phosphatase, laying a foundation for improving the application of alkaline phosphatase in food, feed, medicine, environmental governance and pesticide degradation.

[0028] The second aspect of the present disclosure provides a protein having alkaline phosphatase activity, wherein the protein is obtained by subjecting a wild-type alkaline phosphatase to a mutation-modified amino acid residue fragment to be mutated, wherein the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2; the amino acid residue fragment to be mutated is from position 354 to position 369, and the mutation-modified protein is a substitution of the amino acid residue fragment.

[0029] Wherein, the amino acid sequence of the protein is shown as SEQ ID NO.1.

[0030] The third aspect of the present disclosure provides a gene encoding the protein described in the second aspect, wherein the gene is a DNA molecule whose nucleotide sequence is shown in SEQ ID NO.3.

[0031] The fourth aspect of the present disclosure provides a recombinant vector, which is a recombinant expression vector, and the gene described in the third aspect is inserted into the recombinant vector.

[0032] A fifth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene described in the third aspect, or the transformant is introduced with the recombinant vector described in the fourth aspect.

[0033] In the present disclosure, the genetically engineered bacteria may be at least one of Escherichia coli, Bacillus subtilis and Bacillus licheniformis.

[0034] A sixth aspect of the present disclosure provides a method for preparing alkaline phosphatase, the method comprising: culturing the transformant described in the fifth aspect to obtain a cultured material.

[0035] A seventh aspect of the present disclosure provides a use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, wherein the alkaline phosphatase is the protein described in the second aspect.

[0036] An eighth aspect of the present disclosure provides use of the recombinant vector described in the fourth aspect or the transformant described in the fifth aspect in preparing a product with high temperature resistance and / or alkali resistance.

[0037] The present disclosure is further described in detail below through examples, but the present disclosure is not limited thereby.

[0038] The raw materials used in the following examples can all be obtained through commercial sources; Escherichia coli BL21 (DE3) strain was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; Experimental reagents: C115-01 recombinant enzyme and E112-01 protein detection solution were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; pET28a vector was purchased from Merck, Germany, and NTA series buffer (Cat. No.: C600304-0500) was purchased from Sangon Biotech (Shanghai) Co., Ltd.; M5 HiPer Bacteria Genomic DNA Kit bacterial genome extraction kit was purchased from Beijing Juhemei Biotechnology Co., Ltd.; Experimental instruments: 70666-3 nickel column was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.

[0039] Example 1 Figure 1 It is amino acid sequence alignment and structural analysis, among which, BliAlpN The gene was produced by a strain of Bacillus licheniformis isolated from the Tara cultivation base in Yimen County, Yuxi City, Yunnan Province; Figure 1 It can be seen that the motif fragment KDQEQWVESKLASSST located in the α6 structure plays a role in maintaining the structural stability of alkaline phosphatase. Therefore, the inventors of the present disclosure used this motif fragment to optimize and transform the alkaline phosphatase reported in the database.

[0040] Using the nucleotide sequence of the Bacillus licheniformis alkaline phosphatase gene PhoD disclosed in the NCBI database (gene ID: BLi00281, protein ID: AAU39240.1) as a template, the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2, and the gene encoding the wild-type alkaline phosphatase protein is shown in SEQ ID NO.4.

[0041] The functional amino acid residue fragment AEQEAWLFDNLSRSEA encoded in the nucleotide sequence of the alkaline phosphatase gene PhoD was artificially replaced with KDQEQWVESKLASSST. Suzhou GeneWeizhi Biotechnology Co., Ltd. was commissioned to perform chemical synthesis to obtain the replaced nucleotide sequence of PhoDbl-M1.

[0042] Among them, the nucleotide sequence of the coding fragment AEQEAWLFDNLSRSEA is: GCGGAGCAGGAGGCTTGGCTGTTTGACAATCTGAGTCGCTCCGAGGCG; The nucleotide sequence of the coding fragment KDQEQWVESKLASSST is: AAAGATCAGGAACAGTGGGTTGAAAGCAAACTTGCCAGCTCCAGCACC.

[0043] Obtain recombinant alkaline phosphatase gene PhoDbl-M1 (as shown in SEQ ID NO.3), thereby realizing the conversion of the α6 structure AEQEAWLFDNLSRSEA motif (sequence is Ala354-Glu355-Gln356-Glu357-Ala358-Trp359-Leu360-Phe361-Asp362-Asn363-Leu364-Ser365-Arg366-Ser367-Glu368- Ala369) was replaced with a KDQEQWVESKLASSST motif (sequence: Lys354-Asp355-Gln356-Glu357-Gln358-Trp359-Val360-Glu361-Ser362-Lys363-Leu364-Ala365-Ser366-Ser367-Ser368-Thr369) to obtain the recombinant alkaline phosphatase PhoDbl-M1 (as shown in SEQ ID NO.1).

[0044] Example 2 This example constructs the expression PhoDbl-M1 Recombinant gene expression vector and transformant.

[0045] 1. Through C115-01 recombinase PhoDbl-M1 Genes connected to Nco I / XOt The E. coli expression vector pET28a- PhoDbl-M1 The expression vector was transformed into Escherichia coli BL21 (DE3), and the inserted sequence was verified to be correct by PCR, restriction digestion, and sequencing. The strain was named BL21- PhoDbl- M1 .

[0046] in, PhoDbl and mutants PhoDbl-M1 The gene sequence was commissioned to Suzhou Genewise Biotechnology Co., Ltd. for synthesis.

[0047] 2. Protein induction expression and purification of recombinant alkaline phosphatase: (1) Add 5 mL of engineered strain BL21- PhoDbl-M1 Seed solution (OD 600=5) Inoculate the bacteria into 500 mL of LB liquid medium supplemented with kanamycin (50 μg / mL) at a 1% inoculum volume and culture at 37°C until the bacterial concentration reaches 0.6-0.8; (2) Add IPTG (final concentration 0.3 mmol / L) to induce protein expression at 16°C for 20 h. IPTG is a key factor in inducing the expression of recombinant strains. PhoDbl-M1 The inducer of the protein is not the substrate for the catalytic reaction. Figure 2 shown.

[0048] exist Figure 2 middle, Figure 2 Lane A is alkaline phosphatase PhoD1, lane M is protein marker, lane 1 is bacterial suspension without IPTG induction, lane 2 is total protein of engineered strain induced by IPTG, lane 3 is crude alkaline phosphatase PhoD1 enzyme solution, and lane 4 is purified alkaline phosphatase PhoD1 enzyme solution; Figure 2 B is the alkaline phosphatase mutant PhoDl-M1, lane M is the protein Marker, lane 1 is the bacterial suspension without IPTG induction, lane 2 is the total protein of the engineered strain induced by IPTG, lane 3 is the mutant PhoDl-M1 crude enzyme solution, and lane 4 is the purified mutant PhoDl-M1 enzyme solution.

[0049] The experimental results showed that both alkaline phosphatase PhoDbl and mutant PhoDbl-M1 could be expressed soluble in Escherichia coli.

[0050] Example 3 This example is an analysis of the enzymatic properties of alkaline phosphatase PhoD1-M1.

[0051] Enzyme activity assay: The purified PhoDbl and mutant PhoDbl-M1 proteins were diluted to 500 mg / L, 100 μL of the diluted protein solution was taken, 50 μL of p-nitrophenyl phosphate (p-NPP) of different pH values ​​was added as substrate (1 mg / mL), and the reaction was carried out at different temperatures or different pH values ​​for 20 min, and 50 μL of 0.5 mol / L NaOH was added to terminate the reaction. The absorbance was measured at 405 nm, and the enzyme activity was calculated. One enzyme activity unit (U) was defined as the amount of enzyme required to catalyze the hydrolysis of the substrate to produce 1 μmol of p-nitrophenol (pNP) within 1 min.

[0052] (1) Determination of the optimal reaction temperature of PhoDbl and mutant PhoDbl-M1: The optimal reaction temperature was determined by placing the reaction system in a 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 9) and reacting at 30, 40, 50, 60, 70, 80, 90, and 100°C for 20 min. The highest enzyme activity was taken as 100%, and the relative enzyme activity at different temperatures was calculated. The relative enzyme activity results are shown in Figure 3 The results of enzyme activity are shown in Table 1.

[0053] The highest enzyme activity was taken as 100%, and the relative enzyme activity at different temperatures (the percentage of enzyme activity at various temperatures relative to the highest enzyme activity) was calculated.

[0054] Table 1

[0055] (2) Determination of the optimal pH values ​​of PhoDbl and mutant PhoDbl-M1: According to the enzyme activity determination method, the recombinant protein was tested for enzyme activity in a 0.1 mol / L citric acid-sodium citrate buffer solution with a pH value of 6.0, a 0.2 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution with pH values ​​of 7.0 and 8.0, and a 0.2 mol / L glycine-sodium hydroxide buffer solution with pH values ​​of 9.0, 10.0, 11.0, and 12.0. The relative enzyme activity results are shown in Figure 2. Figure 4 The results of enzyme activity are shown in Table 2.

[0056] Taking the highest enzyme activity as 100%, the relative enzyme activity at different pH values ​​(the percentage of enzyme activity at various pH values ​​relative to the highest enzyme activity) was calculated.

[0057] Table 2

[0058] (3) The purified PhoDbl and mutant PhoDbl-M1 were diluted to 500 mg / L, and then 0.2 mol / L glycine-sodium hydroxide buffer solution (pH 9) was added to each of them, and the mixture was treated at 70°C for 0, 60, 120, 180, 240 and 300 min. The relative enzyme activity of alkaline phosphatase PhoDbl and mutant PhoDbl-M1 was calculated by taking the highest enzyme activity measured at 0 min as 100%. The calculation formula is: Relative enzyme activity (%) = U5 / U4×100%, where U4 is the highest enzyme activity at 0 min, and U5 is the enzyme activity of alkaline phosphatase PhoDbl and mutant PhoDbl-M1 at 70°C for 0, 60, 120, 180, 240 and 300 min, respectively. The results are shown in Figure 2. Figure 5 shown.

[0059] Depend on Figure 3 , Figure 4 As can be seen from Tables 1 and 2, the optimum temperature and optimum pH value of PhoDbl and mutant PhoDbl-M1 are basically consistent, with the optimum temperature being 70°C and the optimum pH being 9.0.

[0060] Depend on Figure 5 It can be seen that the specific enzyme activity of the control alkaline phosphatase PhoDbl after treatment at pH 9 and 70°C for 180 minutes dropped to 63%, while the specific enzyme activity of the mutant PhoDbl-M1 under this treatment condition was still above 91%; when the specific enzyme activity of the control alkaline phosphatase PhoDbl dropped to 44% after treatment for 240 minutes, the specific enzyme activity of the mutant PhoDbl-M1 was still retained at 87%, which was 1.97 times that of the control alkaline phosphatase PhoDbl. After treatment for 300 minutes, the mutant PhoDbl-M1 still retained 85% of the enzyme activity, which was 2.13 times that of the control alkaline phosphatase PhoDbl. This indicates that the motif fragment KDQEQWVESKLASSST of the α6 structure can significantly improve the enzyme activity stability of alkaline phosphatase under high temperature conditions and alkaline environment, and can be used for the functional optimization of alkaline phosphatase.

[0061] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0062] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0063] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A method for increasing the activity of alkaline phosphatase, characterized in that: The method comprises mutating a wild-type amino acid residue fragment to be mutated, wherein the amino acid sequence of the wild-type alkaline phosphatase is as shown in SEQ ID NO.2; the amino acid residue fragment to be mutated is from position 354 to position 369, and the mutation modification is a substitution of the amino acid residue fragment.

2. The method according to claim 1, wherein: The mutation modification comprises: The amino acid residue segment AEQEAWLFDNLSRSEA from position 354 to position 369 was mutated to KDQEQWVESKLASSST.

3. A protein having alkaline phosphatase activity, characterized in that The protein is obtained by subjecting a wild-type alkaline phosphatase amino acid residue fragment to mutation modification, wherein the amino acid sequence of the wild-type alkaline phosphatase is shown in SEQ ID NO.2; the amino acid residue fragment to mutation is from position 354 to position 369, and the mutation modification is the replacement of the amino acid residue fragment.

4. The protein according to claim 3, wherein The amino acid sequence of the protein is shown in SEQ ID NO.

1.

5. A gene encoding the protein according to claim 4, characterized in that: The gene is a DNA molecule whose nucleotide sequence is shown as SEQ ID NO.

3.

6. A recombinant vector, characterized in that: The recombinant vector is a recombinant expression vector, and the gene according to claim 5 is inserted into the recombinant vector.

7. A transformant, characterized in that: The host of the transformant is a genetically engineered bacterium; The transformant is introduced with the gene according to claim 5, or the transformant is introduced with the recombinant vector according to claim 6.

8. A method for preparing alkaline phosphatase, characterized in that: The method comprises: culturing the transformant according to claim 7 to obtain a cultured material.

9. Use of alkaline phosphatase in preparing a product with high temperature resistance and / or alkali resistance, characterized in that: The alkaline phosphatase is the protein according to claim 3 or 4.

10. Use of the recombinant vector according to claim 6 or the transformant according to claim 7 in preparing a product having high temperature resistance and / or alkali resistance.

Images