DNA site-directed mutagenesis method and protein mutant phenotype screening method based on DNA site-directed mutagenesis method

Abstract

The invention discloses a DNA site-directed mutagenesis method and a protein mutant phenotype screening method based on the DNA site-directed mutagenesis method. The DNA site-directed mutagenesis method comprises a first reaction, a second reaction and a third reaction. According to the DNA site-directed mutagenesis method provided by the invention, the experimental process of the PCR part is optimized and improved, the construction of the DNA site-directed mutagenesis can be realized through simple three PCR cycles without DNA purification or monoclonal selection, and the method has high success rate and accuracy.

Description

Technical Field

[0001] The invention relates to a DNA site-directed mutagenesis method and a protein mutant phenotype screening method based thereon, belonging to the technical field of gene site-directed mutagenesis. Background Art

[0002] With the rapid development of whole genome sequencing technology and the emergence of artificial intelligence-driven protein design technology, the research paradigm of cytogenetics has gradually been refined from the overall gene and protein level to the nucleotide and amino acid level. The study of cytological phenotypes of single nucleotide variations (and the single amino acid missense mutations caused by them) has received increasing attention, which relies on genetic manipulation of protein coding sequences (i.e., DNA) such as site-directed mutagenesis or random mutagenesis to obtain mutants. For example, commonly used in vitro DNA (such as plasmid) site-directed mutagenesis techniques include overlap extension polymerase chain reaction (PCR), cassette mutagenesis, and reverse PCR cyclization; in vitro DNA random mutagenesis techniques include PCR based on degenerate primers or sequential error-prone PCR. Furthermore, the phenotype of protein mutants is explored by transiently transfecting DNA into cells. As the cornerstone of cell biology and molecular biology, these mutation construction technologies play a vital role in the development of life sciences.

[0003] However, existing methods are unable to achieve low-cost, high-throughput saturation mutant construction on the basis of precise DNA site-directed mutagenesis. For example, cassette mutagenesis and inverse PCR circularization methods both require the constructed DNA fragments to be transformed into competent bacteria and the monoclonal colonies to be sequenced to screen positive clones (for example, Lacoste et al. recently constructed 3448 mutants using this method and transfected them into cell lines to observe the phenotype) [1]. Although such methods ensure the accuracy of mutations, they are costly, time-consuming, and have complicated steps, making it difficult to achieve high-throughput mutant construction in a short period of time. Although some methods have been improved on this basis, such as Ma et al.'s recent invention of SMuRF technology to achieve high-throughput, high-precision mutant construction [2], its core link still relies on high-cost and time-consuming technologies such as purification of intermediates and enzyme digestion, and therefore cannot achieve the goal of fast, accurate and low-cost mutant construction. Although random mutagenesis (such as error-prone PCR) techniques can achieve the construction of a large number of mutant DNAs in a short period of time, the mutations are not directional and controllable, which makes it very difficult to accurately study the functions of genes and proteins, and also makes such techniques unable to meet the requirements of saturation and high-precision mutant construction. In addition, recent studies have used DNA full-sequence synthesis to achieve high-throughput construction of mutants [3], but this method is extremely costly and lacks universal application, and cannot meet the urgent needs of the current scientific research field.

[0004] The traditional overlap extension PCR method (SOEing-PCR) is based on the method of introducing mutations in the overlapping region of the reverse primer pair (primer pair), and constructs site-directed mutation DNA fragments through three rounds of PCR. Therefore, it does not require transformation and monoclonal colony sequencing steps, and is low-cost and time-consuming. It is currently a commonly used precise mutation construction technology. However, this method relies on the purification of intermediate product fragments, and the steps are still relatively complicated, making it difficult to achieve the goal of rapid, high-throughput, and automated mutation construction; and the amplification efficiency of this method is affected by the DNA sequence of the overlapping region, and the error rate and failure rate are still high, making it difficult to provide effective guarantees for high-precision, saturated mutant construction.

[0005] Therefore, new methods need to be developed to meet the needs of low-cost, high-precision, high-throughput and automated mutation construction targets and protein phenotype screening and analysis.

[0006] References:

[0007] [1] Lacoste J et al. Pervasive mislocalization of pathogenic codingvariants underlying human disorders. Cell. 2024 Nov 14.

[0008] [2] Ma K et al. Saturation mutagenesis-reinforced functional assays for disease-related genes. Cell. 2024 Nov 14.

[0009] [3] Beltran A et al. Site-saturation mutagenesis of 500 human proteindomains. Nature. 2025 Jan. Summary of the invention

[0010] Problem that the invention aims to solve

[0011] The traditional overlap extension PCR method (SOEing-PCR) relies on the purification of intermediate product fragments, and the steps are still relatively complicated, making it difficult to achieve the goal of rapid, high-throughput, and automated mutation construction.

[0012] In order to achieve the goal of low-cost, high-precision, high-throughput and automated DNA (or protein) mutant construction and phenotypic screening, the present invention improved the key technologies and methods of SOEing-PCR on the basis of overlap extension PCR and constructed a new DNA site-directed mutagenesis method.

[0013] Furthermore, a protein mutant phenotypic screening method was constructed based on the DNA site-directed mutagenesis method. In the present invention, the protein mutant phenotypic screening method is also referred to as the DEEplus (Directed efficient engineering of protein by linear unbiased SOEing) framework, abbreviated as DEEplus.

[0014] Solutions for solving problems

[0015] [1]. A method for site-directed DNA mutagenesis, comprising:

[0016] In the first reaction, a first upstream universal primer pF1 is used as an upstream primer, a downstream mutation primer pMut-R is used as a downstream primer, and a polynucleotide containing the DNA to be mutated is used as a template to perform a polymerase chain reaction to obtain a first amplicon;

[0017] In the second reaction, the upstream mutation primer pMut-F is used as the upstream primer, the first downstream universal primer pR1 is used as the downstream primer, and the polynucleotide containing the DNA to be mutated is used as the template to perform a polymerase chain reaction to obtain a second amplicon;

[0018] The third reaction is to use the diluted first amplicon and the diluted second amplicon as templates, use the second upstream universal primer pF2 as an upstream primer, and the second downstream universal primer pR2 as a downstream primer, to perform a polymerase chain reaction to obtain a DNA for site-directed mutagenesis;

[0019] Wherein, the downstream of the first amplicon and the upstream of the second amplicon contain the site to be mutated, and there is an overlapping part;

[0020] The first upstream universal primer pF1 includes an upstream complementary binding portion and a first non-complementary binding portion located upstream of the upstream complementary binding portion; the first downstream universal primer pR1 includes a downstream complementary binding portion and a second non-complementary binding portion located upstream of the downstream complementary binding portion; the first non-complementary binding portion and the second non-complementary binding portion do not contain a sequence that is complementary to the template;

[0021] The second upstream universal primer pF2 includes a polynucleotide identical to at least a portion of consecutive nucleotides of the first non-complementary binding portion; the second downstream universal primer pR2 includes a polynucleotide identical to at least a portion of consecutive nucleotides of the second non-complementary binding portion.

[0022] [2]. The method for site-directed DNA mutagenesis according to [1], wherein the downstream mutation primer pMut-R and the upstream mutation primer pMut-F contain mutation site nucleotides; and in addition to the mutation site nucleotides, the downstream mutation primer pMut-R and the upstream mutation primer pMut-F respectively complementarily bind to the antisense strand and the sense strand of the DNA to be mutated containing the site to be mutated; and / or, the region of the DNA to be mutated that complementarily binds to the downstream mutation primer pMut-R and the region of the DNA to be mutated that complementarily binds to the upstream mutation primer pMut-F overlap with each other.

[0023] [3] The method for site-directed DNA mutagenesis according to [1] or [2], wherein the upstream complementary binding portion complementary binds to the 5' end of the sense strand of the DNA to be mutated; and the downstream complementary binding portion complementary binds to the 5' end of the antisense strand of the DNA to be mutated.

[0024] [4] The method for site-directed DNA mutagenesis according to any one of [1] to [3], wherein, in the third reaction, the first amplicon and the second amplicon are diluted at least 15 times respectively; and / or, in every 20 μL of the reaction system of the third reaction, the amount of the diluted first amplicon and the diluted second amplicon is 0.5~3 μL respectively.

[0025] [5] The DNA site-directed mutagenesis method according to any one of [1] to [4], wherein in the reaction system of the third reaction, the concentrations of the second upstream universal primer pF2 and the second downstream universal primer pR2 are at least 0.2 pM, respectively.

[0026] [6] The method for site-directed DNA mutagenesis according to any one of [1] to [5], wherein the amount of template used in the reaction system of the first reaction and the reaction system of the second reaction is 0.5 to 5 ng respectively; and / or, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are 0.01 to 0.5 pM respectively; and / or, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the first upstream universal primer pF1 and the first downstream universal primer pR1 are 0.01 to 0.3 pM respectively; and / or, in the first reaction and the second reaction, the number of polymerase chain reaction cycles is 20 to 30 times respectively.

[0027] [7]. A method for high-throughput screening of protein mutant phenotypes, which uses the DNA site-directed mutagenesis method described in any one of [1]-[6] to perform site-directed mutagenesis on a polynucleotide encoding a protein.

[0028] [8] The method according to [7], wherein the method comprises:

[0029] The step of designing primers, using an automated primer design script to obtain primers used in the DNA site-directed mutagenesis method;

[0030] a step of obtaining a DNA encoding a protein mutant, using the primers obtained in the step of designing primers to obtain a DNA encoding a protein mutant containing a mutation site by the DNA site-directed mutagenesis method; and

[0031] The step of phenotypic detection and screening of protein mutants is to perform phenotypic detection and screening on the DNA encoding the protein mutants obtained in the step of obtaining the DNA encoding the protein mutants.

[0032] [9] The method according to [7] or [8], wherein in the step of designing primers, an automated primer design script is used to design primer sequences used in the DNA site-directed mutagenesis method.

[0033]

[10] The method according to any one of [7] to [9], wherein in the step of detecting and screening the protein mutant phenotype, the DNA encoding the protein mutant is transfected into cells and imaged using a microscope to obtain an image of the phenotype of the protein mutant, and the image of the phenotype of the protein mutant is analyzed based on a deep learning model of a convolutional neural network to screen and classify the phenotype of the protein mutant.

[0034] Effects of the Invention

[0035] The DNA site-directed mutagenesis method provided by the present invention optimizes and improves the experimental process of the PCR part, through a simple three-round PCR cycle (see Figure 1 ), the construction of DNA site-directed mutagenesis can be achieved with a success rate of about 99.9% and an accuracy rate of 100%.

[0036] Based on the DNA site-directed mutagenesis method provided by the present invention, a protein mutant phenotype screening method (DEEplus framework) is constructed, which can be matched with an automated primer design script to achieve saturation scanning and batch primer design of the full coding sequence of the target protein, and can complete the primer construction work of thousands or even tens of thousands of mutants in a short time, and then through the DNA site-directed mutagenesis method of the present invention, a large number of site-directed mutants can be constructed in batches. The above-mentioned DNA mutants can be directly transfected into cell lines in batches, and the precise, high-throughput analysis and screening of mutant protein phenotypes can be completed through high-content automated imaging and automated classification models based on deep learning. Therefore, the cost of using the DNA site-directed mutagenesis method provided by the present invention or the protein mutant phenotype screening method based thereon is relatively low, which makes up for the problem of high sequencing costs of mutation construction methods such as full sequence synthesis or monoclonal sequencing, while retaining accuracy.

[0037] The DNA site-directed mutagenesis method or the protein mutant phenotype screening method based thereon provided by the present invention is also independent of steps such as DNA purification or restriction enzyme digestion, and thus can ensure the automation and high throughput of the entire experimental process, thereby greatly improving the experimental rate.

[0038] In addition, compared with random mutation (such as error-prone PCR method), the mutant sequence constructed by the DNA site-directed mutagenesis method of the present invention or the protein mutant phenotype screening method based thereon is accurate and directed, and the mutation type is uniform. Therefore, it is suitable for precise research on protein phenotypes, ensuring the reliability and repeatability of the experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 :Flowchart of the DNA site-directed mutagenesis method (i.e., improved high-throughput SOEing-PCR) provided by the present invention. Using the target protein (Protein of interest, POI) coding region as the DNA to be mutated, such as the circular plasmid containing the coding gene tuba1a of human α-tubulin TUBA1A (i.e., the polynucleotide containing the DNA to be mutated) as a template, two rounds of PCR reactions (PCR cycle 1 (cycle1) and PCR cycle 2 (cycle2), corresponding to the first reaction and the second reaction, respectively) are used to obtain the first half sequence (i.e., the first amplicon) and the second half sequence (i.e., the second amplicon) containing the target mutation, and these two sequences contain partial overlap near the mutation site. Further, through the third round of PCR reaction (PCR cycle 3 (cycle3), corresponding to the third reaction), the sequences obtained in the first two rounds of PCR are used as templates to amplify the final full-length target fragment, which contains the target mutation and can be directly used for subsequent transfection and other operations.

[0040] Figure 2 : Framework diagram for high-throughput screening of DEEplus protein mutant phenotypes. For the coding region of a given protein (for example, most of the corresponding cDNA sequences of humans), an automated primer design script is used to design primer pair sequences for all single nucleotide variations (SNVs), which can be directly used in a high-throughput improved SOEing-PCR experiment (referred to as high-throughput SOEing-PCR, i.e., the DNA site-directed mutagenesis method provided by the present invention; the cycle is about 1 day); then, the mutation information is linearly matched to the reaction wells one by one, and the machine is used to perform automated sample loading and PCR reactions to achieve a high-throughput improved SOEing-PCR to quickly construct the target product (about 1 week); then, each target fragment is directly transfected into the cell line, and the phenotypic images of all mutation sites are obtained through high-content microscopy imaging (about 1-3 weeks), and finally, a convolutional neural network is used to train a classification model to screen, classify and identify the phenotypes of all mutations (about 1 week).

[0041] Figure 3: Schematic diagram of the principle of designing forward (reverse) primers for mutation sites. First, select the 25 bases upstream and 25 bases downstream of the mutation site as the starting forward (reverse) primers. This pair of primers contains the target mutation site, and then shorten the length of the overlapping region with the template (fragment 1) so that its Tm=55~60℃ and the 3' end is G or C. Finally, delete the 5' end of the primer so that the overlapping region of pMut-F and pMut-R is 24 bases.

[0042] Figure 4 :Sanger sequencing results of constructed tuba1a mutants (partial). After the tuba1a mutants were constructed using the high-throughput improved version of SOEing-PCR, the target mutation sites (48 are listed in the figure) were identified using first-generation Sanger sequencing. The positions of the target bases, the original bases, and the mutated bases are listed above each sequencing peak graph, and the amino acid mutations caused by the base mutations are in brackets. The sequencing results are all correct and there are no impurity peaks.

[0043] Figure 5 :SNV map display of tuba1a (partial). The cytological phenotypes of all SNV mutants of tuba1a (a total of 2683 missense mutations) were obtained using the DEEplus screening framework and annotated according to the score (0-1). The horizontal axis is the amino acid position of tuba1a, and the vertical axis is the type of mutation to other amino acids. The circle represents the missense mutation, and the diamond represents the wild-type amino acid type at the site. This figure shows the phenotypic distribution or scoring of missense mutations of tuba1a: amino acids 2-82. DETAILED DESCRIPTION

[0044] Various exemplary embodiments, features and aspects of the present invention will be described in detail below. The word "exemplary" used here means "used as an example, embodiment or illustrative". Any embodiment described here as "exemplary" is not necessarily interpreted as being superior or better than other embodiments.

[0045] In addition, in order to better illustrate the present invention, numerous specific details are provided in the following specific embodiments. It should be understood by those skilled in the art that the present invention can be implemented without certain specific details. In other examples, methods, means, equipment and steps well known to those skilled in the art are not described in detail in order to highlight the subject matter of the present invention.

[0046] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include the inevitable systematic errors in industrial production.

[0047] In this specification, the word "may" means both performing a certain process and not performing a certain process.

[0048] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", etc., mean that the specific elements (e.g., features, structures, properties and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0049] In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoint numerical values ​​A and B.

[0050] In this specification, the terms "polynucleotide" and "nucleic acid" used interchangeably refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, this term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine bases and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0051] In the art, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine and uracil, respectively, but it is also generally known in the art that "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively, which is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences, so in the context of the present invention, the meanings represented by "G", "C", "A", "T", "U" include the above-mentioned various possible situations. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide or an alternative replacement part. Those skilled in the art can appreciate that guanine, cytosine, adenine and uracil can be replaced by other parts without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement part).

[0052] In the present specification, "hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence that enables the nucleic acid to non-covalently bind (i.e., form Watson-Crick base pairs and / or G / U base pairs), "anneal" or "hybridize" with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid) under appropriate in vitro and / or in vivo temperature and solution ionic strength conditions. Standard Watson-Crick base pairing includes: adenine (A) pairs with thymidine (T), adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C). In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization between a DNA molecule and an RNA molecule: guanine (G) can also pair with uracil (U). For example, in the case of tRNA anticodons base pairing with codons in mRNA, G / U base pairing is at least partially responsible for the degeneracy of the genetic code.

[0053] Hybridization and washing conditions are well known and are exemplified in Sambrook, J., Fritsch, EF and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 of this reference; and Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). Conditions of temperature and ionic strength determine the "stringency" of hybridization.

[0054] In the present invention, "moderate stringency conditions", "moderate-high stringency conditions", "high stringency conditions" or "very high stringency conditions" describe conditions for nucleic acid hybridization and washing. Guidance for conducting hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6, which is incorporated herein by reference. Aqueous and non-aqueous methods are described in this document, and either can be used. For example, specific hybridization conditions are as follows: (1) low stringency hybridization conditions are in 6× sodium chloride / sodium citrate (SSC) at about 45°C, followed by two washes in 0.2×SSC, 0.1% SDS at at least 50°C (for low stringency conditions, the washing temperature can be increased to 55°C); (2) moderate stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 60°C; (3) high stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 65°C and preferably; (4) very high stringency hybridization conditions are 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2×SSC, 1% SDS at 65°C.

[0055] Hybridization requires that the two nucleic acids contain complementary sequences, but mismatches between bases are possible. Conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art.

[0056] According to the present invention, the terms "upstream" and "downstream" are relative terms defining the linear position of at least two elements located in a nucleic acid molecule (whether single-stranded or double-stranded) oriented in the 5' to 3' direction.

[0057] "Amplicon" refers to a segment of DNA or RNA that is the source and / or product of a natural or artificial amplification or replication event. In the context of this report, "amplification" refers to the generation of one or more copies of a genetic fragment, DNA to be mutated, or a template, specifically the generation of an amplicon. As the product of an amplification reaction, an amplicon can be used interchangeably with common laboratory terms such as PCR product.

[0058] DNA site-directed mutagenesis

[0059] In some aspects of the present invention, a method for site-directed DNA mutagenesis is provided, the method comprising:

[0060] A first reaction, in which a first upstream universal primer pF1 is used as an upstream primer, a downstream mutation primer pMut-R is used as a downstream primer, and a polynucleotide containing a DNA to be mutated is used as a template to perform a polymerase chain reaction to obtain a first amplicon;

[0061] a second reaction, in which the upstream mutation primer pMut-F is used as an upstream primer, the first downstream universal primer pR1 is used as a downstream primer, and a polynucleotide containing the DNA to be mutated is used as a template to perform a polymerase chain reaction to obtain a second amplicon;

[0062] a third reaction, in which the diluted first amplicon and the diluted second amplicon are used as templates, the second upstream universal primer pF2 is used as an upstream primer, and the second downstream universal primer pR2 is used as a downstream primer, and a polymerase chain reaction is performed to obtain a DNA for site-directed mutation;

[0063] Wherein, the downstream of the first amplicon and the upstream of the second amplicon contain the site to be mutated, and there is an overlapping part;

[0064] The first upstream universal primer pF1 includes an upstream complementary binding portion and a first non-complementary binding portion located upstream of the upstream complementary binding portion; the first downstream universal primer pR1 includes a downstream complementary binding portion and a second non-complementary binding portion located upstream of the downstream complementary binding portion; the first non-complementary binding portion and the second non-complementary binding portion do not contain a sequence that is complementary to the template;

[0065] The second upstream universal primer pF2 includes a polynucleotide identical to at least a portion of consecutive nucleotides of the first non-complementary binding portion; the second downstream universal primer pR2 includes a polynucleotide identical to at least a portion of consecutive nucleotides of the second non-complementary binding portion.

[0066] The DNA site-directed mutagenesis method provided by the present invention does not rely on DNA purification, monoclonal sequencing, full sequence synthesis or restriction enzyme digestion, which reduces physical costs and has a wider and more universal application prospect. In addition, the DNA site-directed mutagenesis method provided by the present invention can achieve rapid, automated and high-throughput completion of the reaction.

[0067] Downstream mutation primer pMut-R and upstream mutation primer pMut-F

[0068] In some embodiments, the downstream mutation primer pMut-R and the upstream mutation primer pMut-F contain mutation site nucleotides (i.e., the nucleotides after mutation at the site to be mutated in the DNA to be mutated, also called mutant bases). Through the mutation site nucleotides, after three rounds of PCR, the DNA to be mutated is subjected to site-directed mutation to obtain the mutation site nucleotides, and then the corresponding site-directed mutated DNA is obtained.

[0069] In some embodiments, the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are DNA-specific primers (i.e., complementary to the DNA to be mutated), which, in addition to the mutation site nucleotides contained therein, complementarily bind to the region near the site to be mutated in the DNA to be mutated, i.e., complementarily bind to the region of the DNA to be mutated containing the site to be mutated.

[0070] In some specific embodiments, the upstream mutation primer pMut-F is complementary to the sense strand of the DNA to be mutated. In some specific embodiments, the downstream mutation primer pMut-R is complementary to the antisense strand of the DNA to be mutated.

[0071] like Figure 3 As shown, the downstream mutation primer pMut-R and the upstream mutation primer pMut-F can be obtained by the following exemplary method: first, about 25 bases upstream and about 25 bases downstream of the site to be mutated are selected as the starting forward (reverse) primers, and the primer pair contains the target mutation site, and then the length of the overlapping region with the template (fragment 1) is shortened so that its Tm=55~60℃ and the 3' end is G or C, and finally the 5' end of the primer is deleted so that the overlapping region between pMut-F and pMut-R is about 24 bases.

[0072] In this specification, the Tm value (Melting Temperature) of a primer refers to the temperature required for the double-stranded DNA formed by the primer and its complementary DNA sequence to melt (separate into single strands) under specific conditions.

[0073] In some embodiments, the region of the DNA to be mutated that is complementary to the downstream mutation primer pMut-R and the region of the DNA to be mutated that is complementary to the upstream mutation primer pMut-F overlap with each other, for example, overlapping by at least 20 nucleotides, for example, overlapping by 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides.

[0074] In some embodiments, the region of the DNA to be mutated that is complementary to the downstream mutation primer pMut-R and the region of the DNA to be mutated that is complementary to the upstream mutation primer pMut-F completely overlap, that is, the region of the DNA to be mutated that is complementary to the downstream mutation primer pMut-R and the region of the DNA to be mutated that is complementary to the upstream mutation primer pMut-F are the same region in the DNA to be mutated.

[0075] In some embodiments, the lengths of the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are both between 25 and 45 nucleotides.

[0076] In some embodiments, the Tm values ​​of the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are both between 55 and 60°C.

[0077] In some embodiments, the 3' ends of the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are both G or C.

[0078] The first upstream universal primer pF1 and the first downstream universal primer pR1

[0079] In some embodiments, the first upstream universal primer pF1 includes an upstream complementary binding portion and a first non-complementary binding portion located upstream of the upstream complementary binding portion, wherein the upstream complementary binding portion complementarily binds to the 5' end of the DNA to be mutated (sense strand).

[0080] In some embodiments, the upstream complementary binding portion is 15-25 nucleotides in length.

[0081] In some embodiments, the length of the first non-complementary binding portion is between 25 and 35 nucleotides, for example, about 30 nucleotides.

[0082] In some embodiments, the first downstream universal primer pR1 includes a downstream complementary binding portion and a second non-complementary binding portion located upstream of the downstream complementary binding portion, wherein the downstream complementary binding portion complementarily binds to the 5' end of the DNA to be mutated (antisense strand).

[0083] In some embodiments, the downstream complementary binding portion is 15-25 nucleotides in length.

[0084] In some embodiments, the second non-complementary binding portion is between 25 and 35 nucleotides in length, eg, about 30 nucleotides in length.

[0085] In some embodiments, neither the first non-complementary binding portion nor the second non-complementary binding portion contains a sequence that binds complementarily to the template, so that the second upstream universal primer pF2 and the second downstream universal primer pR2 containing partially consecutive nucleotides thereof cannot bind to the template either.

[0086] The second upstream universal primer pF2 and the second downstream universal primer pR2

[0087] In some embodiments, the second upstream universal primer pF2 includes a polynucleotide identical to at least a portion of the consecutive nucleotides of the first non-complementary binding portion, so that during the annealing process in the polymerase chain reaction (third reaction), the second upstream universal primer pF2 can complementarily bind to the portion of the first amplicon corresponding to the first non-complementary binding portion, and cannot complementarily bind to the template.

[0088] In some embodiments, the second upstream universal primer pF2 is 20-25 nucleotides in length.

[0089] In some embodiments, the second downstream universal primer pR2 includes a polynucleotide identical to at least a portion of the consecutive nucleotides of the second non-complementary binding portion, so that during the annealing process in the polymerase chain reaction (third reaction), the second downstream universal primer pR2 can complementarily bind to the portion of the second amplicon corresponding to the second non-complementary binding portion, and cannot complementarily bind to the template.

[0090] In some embodiments, the second downstream universal primer pR2 is 20-25 nucleotides in length.

[0091] It can be seen that the second upstream universal primer pF2 and the second downstream universal primer pR2 are partially identical to the sequence of the first upstream universal primer pF1 and the first downstream universal primer pR1, respectively, but cannot be complementary to the sequence of the starting template. Therefore, they can specifically bind to the template used for the third round of PCR but not to the starting template, ensuring that only the full-length fragment carrying the target mutation can be amplified, while the starting template will not be amplified at all, thereby achieving specificity of amplification.

[0092] First and second reactions

[0093] The first reaction may also be referred to as the first round of amplification, the first round of PCR, the first round of PCR reaction or PCR cycle 1. Similarly, the second reaction may also be referred to as the second round of amplification, the second round of PCR, the second round of PCR reaction or PCR cycle 2.

[0094] In some embodiments, in the reaction system of the first reaction and the reaction system of the second reaction, the amount of the template used is 0.5-5 ng, preferably 1-3 ng, for example, 1 ng, 2 ng, 3 ng, respectively.

[0095] In some embodiments, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the downstream mutation primer pMut-R and the upstream mutation primer pMut-F are 0.01-0.5 pM, preferably 0.1-0.4 pM, for example 0.2 pM, 0.25 pM, 0.3 pM, respectively.

[0096] In some embodiments, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the first upstream universal primer pF1 and the first downstream universal primer pR1 are 0.01-0.3 pM, preferably 0.05-0.2 pM, for example 0.05 pM, 0.1 pM, 0.15 pM, 0.2 pM, respectively.

[0097] In some embodiments, in the first reaction and the second reaction, the number of cycles of the polymerase chain reaction (denaturation, annealing, extension, the above three steps constitute one cycle) is 20 to 30 times, preferably 25 times.

[0098] Those skilled in the art can determine the annealing temperature and extension time according to the Tm values ​​of specific primers (eg, downstream mutation primer pMut-R and upstream mutation primer pMut-F) in the first reaction and the second reaction and the length of the amplicon.

[0099] In some embodiments, excessively increasing the amount of template, increasing the final concentration of primers, or increasing the number of amplification cycles in the first reaction and the second reaction may interfere with subsequent experiments, thereby increasing the experimental failure rate or increasing the nonspecificity of amplification.

[0100] It can be understood that in the reaction system of the first reaction and the second reaction, in addition to the above-mentioned template and primer, it also contains DNA polymerase, dNTP, and PCR buffer. Those skilled in the art can select suitable DNA polymerase, dNTP, and PCR buffer as long as they can complete the present invention.

[0101] In some embodiments, in some exemplary embodiments, a high-fidelity enzyme premix is ​​used, the final amplification system is 10 μL, the template amount is 2 ng / reaction, the final concentration of pF1 / pR1 primers is 0.1 pM, the final concentration of pMut-R / pMut-F primers is 0.25 pM, the annealing temperature and extension time are determined by the Tm value of pMut-F / R and the length of the amplified fragment, and the number of amplification cycles is 25.

[0102] In some embodiments, the first amplicon and the second amplicon are both generally less than 10 kb in length.

[0103] The third reaction

[0104] The third reaction may also be referred to as the third round of amplification, the third round of PCR or PCR cycle 3.

[0105] In some embodiments, in the reaction system of the third reaction, the diluted first amplicon and the diluted second amplicon are used as templates. For example, the template can be a mixture obtained by uniformly mixing the diluted first amplicon and the diluted second amplicon, or the diluted first amplicon and the diluted second amplicon are added to the reaction system respectively. In some embodiments, the first amplicon and the second amplicon are diluted at least 15 times, preferably at least 20 times, and more preferably at least 100 times. In some embodiments, the first amplicon and the second amplicon are diluted less than 150 times, preferably less than 120 times.

[0106] In some embodiments, in each 20 μL reaction system of the third reaction, the amount of the diluted first amplicon and the diluted second amplicon is 0.5-3 μL, preferably 0.5-2.5 μL, for example 0.5 μL, 1 μL, 2 μL, 2.5 μL.

[0107] In some embodiments, in the reaction system of the third reaction, the concentrations of the second upstream universal primer pF2 and the second downstream universal primer pR2 are at least 0.2 pM, preferably at least 0.3 pM, and more preferably at least 0.4 pM, respectively.

[0108] Insufficient dilution multiples of the first two rounds of PCR products (the first amplicon and the second amplicon) or too low final concentrations of the second upstream universal primer pF2 and the second downstream universal primer pR2 may lead to amplification failure or increase in nonspecific fragments.

[0109] In some embodiments, in the third reaction, the number of cycles of the polymerase chain reaction (denaturation, annealing, extension, the above three steps are one cycle) is at least 25 times, preferably at least 30 times. In some embodiments, the number of cycles of the polymerase chain reaction is less than 33 times.

[0110] Those skilled in the art can determine the annealing temperature and extension time according to the Tm values ​​of specific primers (eg, the second upstream universal primer pF2 and the second downstream universal primer pR2) in the third reaction and the length of the amplicon.

[0111] A polynucleotide comprising the DNA to be mutated

[0112] In some embodiments, the DNA to be mutated can be any DNA.

[0113] In some specific embodiments, the DNA to be mutated comprises a DNA encoding a target protein (Protein of Interest, POI) to be mutated.

[0114] In some specific embodiments, the DNA to be mutated comprises the DNA encoding the target protein to be mutated, and at least one of an enhancer, a promoter, a fluorescent tag, and a terminator operably linked thereto. That is, the DNA to be mutated comprises an expression cassette encoding the target protein.

[0115] In some embodiments, the length of the DNA to be mutated is generally less than 10 kb.

[0116] In some specific embodiments, the polynucleotide comprising the DNA to be mutated is an expression vector, such as a plasmid, which contains the DNA to be mutated, such as the DNA encoding the target protein or the expression cassette encoding the target protein.

[0117] Exemplary embodiments

[0118] See also Figure 1The present invention optimizes and improves the experimental process of overlap extension PCR, so that it does not rely on the DNA purification step, and amplifies the target fragment with high efficiency and specificity (the success rate is about 99.9%). In this exemplary embodiment, a circular plasmid containing the target protein coding region (here, human α-tubulin tuba1a is used as an example) is used as the starting template, and a reverse primer pair that can complement each other is designed near the target mutation site, and the primer pair contains the mutation site (respectively referred to as pMut-R and pMut-F). pMut-R and the universal primer pF1 upstream of the promoter or enhancer were used as forward and reverse primers for the first round of PCR (cycle 1), and pMut-F and the universal primer pR1 downstream of the terminator were used as forward and reverse primers for the second round of PCR (cycle 2). The starting template was amplified separately, using a high-fidelity enzyme premix, the final amplification system was 10 μL, the template amount was 2 ng / reaction, the final concentration of pF1 / pR1 primers was 0.1 pM, the final concentration of pMut-R / pMut-F primers was 0.25 pM, the annealing temperature and extension time were determined by the Tm value of pMut-F / R and the length of the amplified fragment, and the number of amplification cycles was 25. Excessive increase in the amount of template, increase in the final concentration of primers, or increase in the number of amplification cycles may interfere with subsequent experiments, resulting in an increase in the failure rate of the experiment or an increase in the nonspecificity of amplification. Then, the products of the first two rounds of PCR were used as templates, diluted 20 times (up to 100 times) with double distilled water (ddH2O), mixed, and 1 μL was added to a total of 20 μL of the third round of amplification system. The third round of amplification (cycle 3) used a high-fidelity enzyme premix, added universal forward and reverse primers pF2 and pR2 to a final concentration of 0.4 pM (or higher), and specific amplification of the full-length target fragment was performed. The annealing temperature was 53-56°C (the Tm value of pF2 / pR2 was 56°C), the extension time was determined by the length of the full-length fragment, and the number of amplification cycles was 30 or more. Insufficient dilution of the first two rounds of PCR products or too low a final concentration of pF2 / pR2 may lead to amplification failure or an increase in nonspecific fragments. In addition, pF2 / pR2 has the same sequence as pF1 / pR1, but is completely different from the sequence of the starting template. Therefore, it can specifically bind to the template used in the third round of PCR, but not to the starting template, ensuring that only the full-length fragment carrying the target mutation can be amplified, while the starting template will not be amplified at all, thus achieving the specificity of amplification. The inventors performed random Sanger sequencing on the mutant sequences obtained in the previous experiments, proving that the target full-length sequence obtained using this method is completely correct (N>100); and through subsequent cell transfection experiments and phenotypic analysis, it was proved that the ratio of successfully amplifying the target full-length sequence using this method is 99.9% (2680 / 2683).

[0119] High-throughput screening method for protein mutant phenotypes

[0120] In some aspects of the present invention, a method for high-throughput screening of protein mutant phenotypes is provided, which uses the DNA site-directed mutagenesis method described above to perform site-directed mutagenesis on a polynucleotide encoding a protein.

[0121] In order to achieve high-throughput, automated phenotypic screening of protein mutants, the present invention combines automated primer design, the DNA site-directed mutagenesis method provided by the present invention, high-content imaging and deep learning to design a high-throughput screening framework (DEEplus) for protein mutant phenotypes with a wide range of application scenarios. Compared with the currently commonly used mutant construction and phenotypic screening strategies, the time efficiency of this framework is improved by about 10 times ( Figure 2 ).

[0122] In some specific embodiments, the protein mutant phenotype high-throughput screening method comprises the following steps:

[0123] The step of designing primers, using an automated primer design script to obtain primers used in the DNA site-directed mutagenesis method;

[0124] a step of obtaining a DNA encoding a protein mutant, using the primers obtained in the step of designing primers to obtain a DNA encoding a protein mutant containing a mutation site by the DNA site-directed mutagenesis method; and

[0125] The step of phenotypic detection and screening of protein mutants is to perform phenotypic detection and screening on the DNA encoding the protein mutants obtained in the step of obtaining the DNA encoding the protein mutants.

[0126] All steps of the high-throughput screening method for protein mutant phenotypes provided by the present invention can be completed by instruments (such as multi-channel automated workstations, PCR instruments), thus achieving automation and high throughput, and significantly improving the experimental speed in the construction of large quantities of mutants.

[0127] Steps in primer design

[0128] For a given target protein (POI), an automated primer design script was used to quickly obtain the reverse primer pairs corresponding to all mutation sites (downstream mutation primer pMut-R and upstream mutation primer pMut-F), as well as the first upstream universal primer pF1 and the first downstream universal primer pR1, the second upstream universal primer pF2 and the second downstream universal primer pR2, which can be directly used in the subsequent DNA site-directed mutagenesis method (performed by automated PCR reaction).

[0129] The automated primer design script can directly design all primer sequences suitable for the DNA site-directed mutagenesis method provided by the present invention.

[0130] In some embodiments, in the automated primer design script, the parameters of the primer design script can be fine-tuned, such as increasing the length of the primer overlap region, or directly increasing the primer length, etc., so that the designed primers are different but can also be used in the DNA site-directed mutagenesis method provided by the present invention.

[0131] Steps for obtaining DNA encoding protein mutants

[0132] The DNA site-directed mutagenesis method of the present invention, i.e., the optimized SOEing-PCR, is used in an automated instrument (such as Biomek ® NXp automated workstation), high-throughput synthesis of mutant DNA products (site-directed mutagenesis DNA).

[0133] In some specific embodiments, the reaction products of the DNA site-directed mutagenesis method can be operated in a well plate and can be directly connected with subsequent protein mutant phenotype detection and screening steps, such as batch cell transfection and high-content imaging, greatly shortening the time cost.

[0134] Steps for phenotypic detection and screening of protein mutants

[0135] In the step of phenotypic detection and screening of protein mutants, the DNA encoding the protein mutant obtained in the step of obtaining the DNA encoding the protein mutant is subjected to phenotypic detection and screening.

[0136] In some embodiments, the DNA encoding the protein mutant obtained in the step of obtaining the DNA encoding the protein mutant can be directly used for batch cell transfection; subsequently, a high-content microscope is used to automatically image all reaction wells (each well specifically corresponding to a mutant) and collect original images.

[0137] It is understandable that those skilled in the art may also use other confocal microscopes (including super-resolution microscopes, etc.) as long as they can also achieve phenotypic imaging of mutants.

[0138] It is understandable that there is no particular limitation on the cell line, transfection reagent, transfection ratio, etc. used in transfection, as long as it can complete the transient transfection operation of the reaction product of the DNA site-directed mutagenesis method.

[0139] In some optional embodiments, the reaction product of the DNA site-directed mutagenesis method may be purified before transfection, for example, using a DNA purification method known to those skilled in the art.

[0140] In some embodiments, a deep learning model based on a convolutional neural network (CNN) is first trained using a small sample size to screen and classify the phenotypes of all protein mutants, thereby achieving an automated phenotypic identification process (see Figure 2 ).

[0141] It can be seen that in the high-throughput screening method for protein mutant phenotypes provided by the present invention, the DNA site-directed mutagenesis method provided by the present invention can be combined with automated primer design, high-content imaging, and an automated image recognition and classification model based on deep learning, so as to complete the design, construction, and high-throughput phenotypic identification of protein mutants from scratch, and is suitable for the construction of human single nucleotide variation (SNV) maps, human protein missense mutation maps, saturation screening of protein mutants, and phenotypic screening and identification in directed protein evolution.

[0142] In some exemplary embodiments, for a protein with a length of 500 amino acids (cDNA length of 1500 bases), using an automated primer design script, all primer sequences corresponding to about 3000 single nucleotide variations (SNVs) can be obtained within one minute (due to the degeneracy of codons, only SNV sites that cause amino acid missense mutations are retained here), and the forward and reverse sequences corresponding to each mutation (see Figure 1 ) primers are synthesized in the well plate and correspond one to one in space, and then the construction of thousands of mutant DNAs can be completed within a few days (up to a week) through the reaction of the DNA site-directed mutagenesis method provided by the present invention by the automated instrument loading; then, the SNV mutants are batch-transfected into the corresponding cell lines, and the high-content microscope is used for automated image acquisition, and the phenotypic acquisition process of all mutants can be completed within a few weeks (on average, the acquisition rate is about 200-500 mutants / day). Finally, the small-scale image samples obtained by the early acquisition are used for model training and optimization, and used for automated analysis of all samples, including distinguishing different phenotypes of single cells (such as functional, intermediate or pathogenic), and then scoring and evaluating the biological functions of different mutants. This process takes about several days. Therefore, the DEEplus protein mutant phenotypic screening framework can realize the automated, batch, and saturated identification and analysis of mutants. Its physical and time costs are much lower than traditional deep mutational scanning, and it is more suitable for the construction of human single nucleotide variation (SNV) maps, large-scale mutant screening, or mutation-based directed protein evolution processes.

[0143] Exemplary embodiments

[0144] For the target protein (POI), first obtain its human cDNA sequence (such as from the National Center for Biotechnology Information - NCBI website), and clone it into a mammalian cell transient transfection plasmid vector (such as pCDNA3.0 vector), with an enhancer and promoter upstream and a terminator downstream). If necessary, insert a fluorescent tag into the protein coding region (such as Figure 1 ). Input the sequence (enhancer-promoter-protein coding region-fluorescent tag-terminator) into the automated primer design script (python3 environment needs to be installed), design the corresponding primer sequences for all single nucleotide variations (SNVs), and return them to the user in a table. The table lists all SNV sites, the corresponding amino acid variations, and the forward and reverse primer sequences suitable for SOEing-PCR. Subsequently, each forward primer is synthesized in a well plate, with each well corresponding to a mutation, and the reverse primer is synthesized in another well plate, so that the mutation in each well corresponds to the well plate of the forward primer. Then, use an automated pipetting workstation (such as Biomek ® NXp workstation) batch configuration of the reaction system in the DNA site-directed mutagenesis method ( Figure 1 ), use a common PCR instrument to complete the reaction in the DNA site-directed mutagenesis method. Since the products obtained in the first two rounds of PCR have a one-to-one corresponding position relationship in the forward and reverse primer wells, the configuration of the third round of PCR system can be directly completed by an automated pipetting workstation, which greatly improves the experimental efficiency. After the third round of PCR, a linear DNA fragment containing the mutation site can be obtained, with a concentration of about 100ng / μL (the actual concentration depends on the number of amplification cycles in the third round and the high-fidelity enzyme premix used. There may be slight deviations between different mutant samples, but generally there is no significant effect on the cytological phenotype). It can be directly used for transient transfection of cells without purification. Polyethyleneimine (PEI) can be used as a large-scale transfection reagent for transfection. The volume ratio of mutant PCR product: PEI is 5:1, that is, for every 1 μL of mutant PCR product, 0.2 μL PEI solution (1mg / mL) is used, and transient transfection is performed according to the standard transfection process, so that the cells in each well are transfected with a specific mutant protein. Furthermore, according to actual needs, live cell imaging or immunostaining is used to automatically image cells in culture plates (such as P96-1.5-HN, CellVis) using a high-content microscope. The shooting conditions (such as the number of channels, magnification, number of images collected per well, etc.) can be optimized and adjusted according to actual conditions to obtain high-quality images at a high rate and high resolution for subsequent analysis and other processes. Finally, a small number of samples (such as 100 mutants) are used to train and optimize the convolutional neural network model, so that it can automatically identify transfected positive cells in the original image and classify or score the protein phenotype, thereby completing the screening and identification of mutant phenotypes in batches in a short period of time.

[0145] Example

[0146] The embodiments of the present invention will be described in detail below in conjunction with the examples, but those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific conditions are specified in the examples, they are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0147] Tubulin is a basic component of cytoskeletal microtubules and is essential for the behavior and function of eukaryotic organisms. Various mutations in tubulin can cause a variety of human diseases. Establishing a human single nucleotide variation (SNV) map of tubulin is of great significance for understanding the function of microtubules and treating human genetic diseases. To this end, this example uses human α-tubulin TUBA1A as a representative and uses DEEplus to systematically and comprehensively explore the cytological phenotypes produced by all mutations.

[0148] Step 1: Obtaining the starting template sequence in the first reaction and the second reaction

[0149] For the human α-tubulin TUBA1A as the target protein (POI), first obtain its human cDNA sequence (such as from the National Center for Biotechnology Information (NCBI) website, the gene number is NM_006009.4), and clone it into a mammalian cell transient transfection plasmid vector (such as pCDNA3.0 vector, Addgene: #12452), with an enhancer and promoter upstream and a terminator downstream), and insert a fluorescent tag into the protein coding region (such as Figure 1 ).

[0150] Specifically, in this example, a circular plasmid (i.e., a polynucleotide containing a DNA to be mutated) containing a target protein coding region (i.e., a DNA to be mutated, specifically human α-tubulin tuba1a in this example) is used as a starting template (pCDNA3.0 vector, full length 6882 bp), and its enhancer-promoter-protein coding region (including a fluorescent tag)-terminator sequence is as follows (SEQ ID NO: 1):

[0151]

[0152] Among them, the single underlined part is the CMV enhancer / promoter sequence; the lowercase part is the cDNA sequence of tuba1a (including gfp11), and the base to be mutated in the subsequent examples (the fourth c) is bold and underlined; the double underlined part is the bGH terminator sequence.

[0153] Step 2: Design primers

[0154] Using an automated primer design script, a total of 2683 SNV sites and primer sequences that caused different missense mutations were obtained ( Figure 2 ), including downstream mutation primers pMut-R and upstream mutation primers pMut-F for each site, as well as a first upstream universal primer pF1, a first downstream universal primer pR1, a second upstream universal primer pF2, and a second downstream universal primer pR2.

[0155] Specifically, a partial sequence (enhancer-promoter-protein coding region (including fluorescent label)-terminator) of the starting template sequence obtained in step 1 above is input into the automated primer design script (python3 environment needs to be installed), and the corresponding primer sequences of all single nucleotide variations (SNVs) are designed and returned to the user in a table form. The table lists all SNV sites, corresponding amino acid variations, and forward and reverse primer sequences suitable for the DNA site-directed mutagenesis method of the present invention. Subsequently, each forward primer is synthesized in a well plate, each well corresponding to a mutation, and the reverse primer is synthesized in another well plate, so that the mutation in each well corresponds to the well plate of the forward primer.

[0156] Among them, the primer design script (for specific design principles, see Figure 3 ) According to the input DNA sequence, the forward and reverse primers required for all coding region base mutations are designed in order. The starting length of each pair of primers is 50 nucleotides. First, shorten the overlapping region with the template (i.e., fragment 1) so that its Tm=55-60℃ and the 3' terminal base is G or C; then shorten the 5' end of the forward and reverse primers (i.e., fragment 2) so that the overlapping bases of pMut-R and pMut-F are 24 nucleotides, and you can get a pair of primers required to mutate the base.

[0157] Step 3: Obtain DNA encoding protein mutants

[0158] In this embodiment, the inventors optimized and improved the experimental process of overlap extension PCR, so that it does not rely on the DNA purification step and can amplify the target fragment with high efficiency and specificity (the success rate is about 99.9%) ( Figure 1 ).

[0159] In this embodiment, each primer obtained in step 2 is synthesized into a corresponding well plate, and an automated liquid transfer workstation (such as Biomek ® The reaction system of the first to third reactions of the DNA site-directed mutagenesis method was configured using an NXp automated liquid handling workstation. A common PCR instrument was used for amplification reactions. The construction of all 2683 mutants was completed within one week. The mutant PCR products were frozen at -20°C and could be stored for several months without significantly reducing the transfection efficiency.

[0160] Specifically, using Biomek ® The NXp automated liquid transfer workstation batch configures the reaction system of the first to third reactions of the DNA site-directed mutagenesis method, and uses a PCR instrument (such as Eppendorf, Mastercycler Nexus) to complete the reaction of the DNA site-directed mutagenesis method of the present invention. Since the products obtained in the first two rounds of PCR have a one-to-one corresponding positional relationship in the forward and reverse primer well plates, the configuration of the third round of SOEing-PCR system can be directly completed by the automated liquid transfer workstation, which greatly improves the experimental efficiency. After the third round of SOEing-PCR is completed, a linear DNA fragment containing the mutation site can be obtained, with a concentration of about 100 ng / μL (the actual concentration depends on the number of amplification cycles in the third round and the high-fidelity enzyme premix used, and there may be slight deviations between different mutant samples, but generally no significant effect on the cytological phenotype), which can be directly used for transient transfection of cells without purification.

[0161] Taking one of the sites as an example, the DNA site-directed mutagenesis method of the present invention is described:

[0162] For example, the fourth nucleotide c in the target protein coding region of the starting template sequence in step one is mutated to a, and a reverse primer pair capable of complementary pairing is designed near the target mutation site, and the primer pair includes the mutation site (referred to as the downstream mutation primer pMut-R and the upstream mutation primer pMut-F, respectively). pMut-R and the first upstream universal primer pF1 upstream of the promoter or enhancer were used as forward and reverse primers for the first reaction (PCR cycle 1), and pMut-F and the first downstream universal primer pR1 downstream of the terminator were used as forward and reverse primers for the second reaction (PCR cycle 2). The starting template was amplified respectively, using a high-fidelity enzyme premix (Vazyme, #P525-01), the final amplification system was 10 μL, the template amount was 2 ng / reaction, the final concentration of pF1 / pR1 primers was 0.1 pM, the final concentration of pMut-R / pMut-F primers was 0.25 pM, the annealing temperature and extension time were determined by the Tm value of pMut-F / R and the length of the amplified fragment (the specific annealing temperature in this embodiment was: 58°C), and the number of amplification cycles was 25.

[0163] The primers and PCR conditions used in the first and second reactions are as follows:

[0164] pF1 (SEQ ID NO:2):

[0165]

[0166] Among them, the bold part is the pF2 binding sequence, that is, the first non-complementary binding part; the underlined part is the part that binds to the template, that is, the upstream complementary binding part.

[0167] pR1 (SEQ ID NO:3):

[0168]

[0169] Among them, the bold part is the pR2 binding sequence, that is, the second non-complementary binding part; the underlined part is the part that binds to the template, that is, the downstream complementary binding part.

[0170] pMut-F (SEQ ID NO:4):

[0171] GCCACCATG A GTGAGTGCATCTCCATCCACGTTG

[0172] The underlined part is the mutated base.

[0173] pMut-R (SEQ ID NO:5):

[0174] GGAGATGCACTCAC T CATGGTGGCGGATCCGAGC

[0175] The underlined part is the mutated base.

[0176] PCR reaction conditions are:

[0177] Pre-denaturation: 95℃, 3 minutes (min)

[0178] Denaturation: 95℃, 15 seconds (sec)

[0179] Annealing: 58℃, 15 sec

[0180] Extension: 72℃, 30 sec (first reaction); 72℃, 90 sec (second reaction)

[0181] The number of amplification cycles was 25

[0182] Final extension: 72°C, 5 min

[0183] In the study of this example, it was found that excessive increase in the amount of template, increase in the final concentration of primers or increase in the number of amplification cycles may interfere with subsequent experiments, thereby increasing the failure rate of the experiment or increasing the non-specificity of amplification. Furthermore, the products of the first two rounds of PCR (first reaction and second reaction) were used as templates, diluted 20 times with double distilled water (ddH2O), mixed, and 1 μL was taken and added to the third round amplification system of the third reaction with a total of 20 μL.

[0184] The third reaction (PCR cycle 3) uses a high-fidelity enzyme premix (Vazyme, #P525-01) and adds the second upstream universal primer pF2 and the second downstream universal primer pR2 to a final concentration of 0.4 pM, respectively, for specific amplification of the full-length target fragment. The annealing temperature is 53-56°C (the Tm value of pF2 / pR2 is 56°C), the extension time is determined by the length of the full-length fragment, and the number of amplification cycles is 30 or more.

[0185] The primers used in the third reaction of this example are as follows:

[0186] pF2 (SEQ ID NO:6):CCATGGAGCTCCAAATAATG

[0187] pR2 (SEQ ID NO:7):GATTTGACGTCATGAGAGGC

[0188] In the research of the present invention, it was found that insufficient dilution multiples of the first two rounds of PCR products or too low final concentrations of pF2 / pR2 may lead to amplification failure or increase of nonspecific fragments.

[0189] PCR reaction conditions (third reaction):

[0190] Pre-denaturation: 95℃, 3 min

[0191] Denaturation: 95℃, 15 sec

[0192] Annealing: 53℃, 15 sec

[0193] Extension: 72℃, 2 min

[0194] The number of amplification cycles was 33

[0195] Final extension: 72°C, 5 min

[0196] In this embodiment, pF2 / pR2 are partially identical to the sequences of pF1 / pR1, respectively, but are completely different from the sequence of the starting template. Therefore, they can specifically bind to the template used for the third round of PCR but not to the starting template, ensuring that only the full-length fragment carrying the target mutation can be amplified, while the starting template will not be amplified at all, thereby achieving specificity of amplification.

[0197] As confirmed by subsequent experiments, this example performed random Sanger sequencing on the mutant sequences obtained in the previous experiments, proving that the target full-length sequence obtained using this method was completely correct (N>100); and through subsequent cell transfection experiments and phenotypic analysis, it was proved that the rate of successfully amplifying the target full-length sequence using this method was 99.9% (2680 / 2683).

[0198] Step 4. Phenotypic detection and screening of protein mutants

[0199] As mentioned above, the product obtained by the DNA site-directed mutagenesis method provided by the present invention can be directly used for transient transfection of cells and subsequent phenotype detection and screening of protein mutants without purification.

[0200] Polyethylenimine (PEI) can be used as a large-scale transfection reagent for transfection. The volume ratio of different mutant PCR products obtained in step 3 to PEI is 5:1, that is, for every 1 μL mutant PCR product transfected, 0.2 μL PEI solution (1 mg / mL) is used. Transient transfection is performed according to the standard transfection process, that is, 5 μL opti-MEM medium is used to dilute the PCR product, and 5 μL opti-MEM medium is used to dilute the PEI solution. The two components are then mixed and allowed to stand for 15 min, and then added to a single well of a 96-well cell culture plate (CellVis, #P96-1.5HN) so that the cells in each well are transfected with a specific mutant protein. Then, according to actual needs, live cell imaging or immunostaining is adopted, and the cells in the culture plate are automatically imaged using a high-content microscope. The shooting conditions (such as the number of channels, magnification, number of images collected per well, etc.) can be optimized and adjusted according to actual conditions to obtain high-quality images at a high rate and high resolution, so as to be used for subsequent analysis and other processes. Afterwards, a small number of samples (such as 100 mutants) are used to train and optimize the convolutional neural network model, enabling it to automatically identify transfection-positive cells in the original image and classify or score the protein phenotype, thereby completing the screening and identification of mutant phenotypes in batches in a short period of time.

[0201] In this example, 100 mutant PCR products were randomly selected for first-generation Sanger sequencing to verify that the full length of the target sequence was completely correct, the target mutations were correctly introduced, and there were no spurious peaks ( Figure 4 ).

[0202] Then, appropriate amount of HeLa cells (ATCC source) were plated in 96-well cell culture plates for imaging, so that the density during transfection was 50-70%. Each mutant was transfected into each well of cells by PEI, and cultured for one day. At this time, the cell density was about 80-90%, which was suitable for high-content imaging. Each cell culture plate was placed in a high-content microscope (AI dual-disc high-content imaging microscope, MetaXpress) for automated imaging, with a magnification of 60X (water mirror), using autofocus mode, red / green dual-channel shooting (green channel is GFP-labeled tubulin, red channel is microtubule dye), 36 pictures were taken per well, and a total of 190,000-200,000 original pictures were obtained. This process took 2-3 weeks, and the transfection and shooting process of about 200 mutants was completed every day, with a success rate of 99.9% (2680 / 2683).

[0203] Afterwards, based on an artificial intelligence deep learning model (see Redmon J et al. You Only LookOnce: Unified, Real-Time Object Detection. 2016 IEEE Conference on Computer Vision and Pattern Recognition. 2016.), the inventors identified and classified the phenotypes of all 2,683 mutants, and scored each mutant according to its similarity to the wild-type protein (i.e., whether it can be assembled into microtubules). The lower the score, the smaller the effect of the mutation on the protein function, while the higher the score, the greater the effect of the mutation on the protein, and therefore may cause human diseases ( Figure 5 ), these results are also completely consistent with the cytological phenotype of tuba1a mutations previously reported in the literature, indicating that the results obtained using this method are highly accurate and reliable, and therefore have important reference significance for disease research. In contrast, the physical cost (mainly from: high-fidelity enzymes for PCR, cell culture plates for imaging, and microscope usage costs) and time costs used in this method are much lower than traditional molecular cloning and saturation mutant screening, so it is more suitable for large-scale, batch, and high-throughput protein mutant research. The comparison between the method provided by the present invention and the existing method is specifically shown in Table 1 below.

[0204] Table 1

[0205]

[0206] “×” means that this method is not applicable to the statistics of this parameter.

[0207] It should be noted that, although the technical solution of the present invention is introduced with specific examples, those skilled in the art will appreciate that the present invention should not be limited thereto.

[0208] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A DNA site-directed mutagenesis method, comprising: In a first reaction, a first upstream universal primer (pF1) is used as an upstream primer, a downstream mutation primer (pMut-R) is used as a downstream primer, and a polynucleotide containing the DNA to be mutated is used as a template to perform a polymerase chain reaction to obtain a first amplicon; In the second reaction, the upstream mutation primer (pMut-F) is used as the upstream primer, the first downstream universal primer (pR1) is used as the downstream primer, and the polynucleotide containing the DNA to be mutated is used as the template to perform a polymerase chain reaction to obtain a second amplicon; The third reaction is to use the diluted first amplicon and the diluted second amplicon as templates, use the second upstream universal primer (pF2) as an upstream primer, and the second downstream universal primer (pR2) as a downstream primer to perform a polymerase chain reaction to obtain a DNA for site-directed mutation; Wherein, the downstream of the first amplicon and the upstream of the second amplicon contain the site to be mutated, and there is an overlapping part; The first upstream universal primer (pF1) comprises an upstream complementary binding portion and a first non-complementary binding portion located upstream of the upstream complementary binding portion; the first downstream universal primer (pR1) comprises a downstream complementary binding portion and a second non-complementary binding portion located upstream of the downstream complementary binding portion; neither the first non-complementary binding portion nor the second non-complementary binding portion contains a sequence that is complementary to the template; The second upstream universal primer (pF2) includes a polynucleotide identical to at least a portion of consecutive nucleotides of the first non-complementary binding portion; the second downstream universal primer (pR2) includes a polynucleotide identical to at least a portion of consecutive nucleotides of the second non-complementary binding portion.

2. The DNA site-directed mutagenesis method according to claim 1, wherein: The downstream mutation primer (pMut-R) and the upstream mutation primer (pMut-F) contain mutation site nucleotides; and in addition to the mutation site nucleotides, the downstream mutation primer (pMut-R) and the upstream mutation primer (pMut-F) respectively complementarily bind to the antisense strand and the sense strand of the DNA to be mutated that contain the site to be mutated; and / or, The region of the DNA to be mutated that complementarily binds to the downstream mutation primer (pMut-R) and the region of the DNA to be mutated that complementarily binds to the upstream mutation primer (pMut-F) overlap with each other.

3. The DNA site-directed mutagenesis method according to claim 1 or 2, wherein: The upstream complementary binding part is complementary to the 5' end of the sense strand of the DNA to be mutated; the downstream complementary binding part is complementary to the 5' end of the antisense strand of the DNA to be mutated.

4. The DNA site-directed mutagenesis method according to claim 1 or 2, wherein: In the third reaction, the first amplicon and the second amplicon are diluted at least 15 times respectively; and / or, In every 20 μL of the reaction system of the third reaction, the amount of the diluted first amplicon and the diluted second amplicon is 0.5-3 μL respectively.

5. The DNA site-directed mutagenesis method according to claim 1 or 2, wherein: In the reaction system of the third reaction, the concentrations of the second upstream universal primer (pF2) and the second downstream universal primer (pR2) are at least 0.2 pM, respectively.

6. The DNA site-directed mutagenesis method according to claim 1 or 2, wherein: In the reaction system of the first reaction and the reaction system of the second reaction, the amount of the template is 0.5-5 ng respectively; and / or, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the downstream mutation primer (pMut-R) and the upstream mutation primer (pMut-F) are 0.01-0.5 pM, respectively; and / or, in the reaction system of the first reaction and the reaction system of the second reaction, the concentrations of the first upstream universal primer (pF1) and the first downstream universal primer (pR1) are 0.01-0.3 pM, respectively; And / or, in the first reaction and the second reaction, the number of polymerase chain reaction cycles is 20 to 30 times respectively.

7. A method for high-throughput screening of protein mutant phenotypes, comprising performing site-directed mutagenesis on a polynucleotide encoding a protein using the DNA site-directed mutagenesis method according to any one of claims 1 to 6.

8. The method according to claim 7, wherein: The method comprises: The step of designing primers, using an automated primer design script to obtain primers used in the DNA site-directed mutagenesis method; a step of obtaining a DNA encoding a protein mutant, using the primers obtained in the step of designing primers to obtain a DNA encoding a protein mutant containing a mutation site by the DNA site-directed mutagenesis method; and The step of phenotypic detection and screening of protein mutants is to perform phenotypic detection and screening on the DNA encoding the protein mutants obtained in the step of obtaining the DNA encoding the protein mutants.

9. The method according to claim 8, wherein: In the step of designing primers, an automated primer design script is used to design primer sequences used in the DNA site-directed mutagenesis method.

10. The method according to claim 8, wherein: In the step of detecting and screening the phenotype of the protein mutant, the DNA encoding the protein mutant is transfected into cells, and an image of the phenotype of the protein mutant is obtained by imaging with a microscope. as well as, Based on a deep learning model of a convolutional neural network, the images of the phenotypes of the protein mutants are analyzed, and the phenotypes of the protein mutants are screened and classified.

Images