Shellfish gene editing method taking sperm as delivery carrier
By using CRISPR/Cas9 recombinant plasmids as sperm delivery vectors in shellfish, the problems of low delivery efficiency and complex operation in shellfish gene editing have been solved, achieving efficient and stable gene editing and screening of mutant individuals, adapting to the biological characteristics of shellfish and meeting breeding needs.
Patent Information
- Application Number
- CN202610029482.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies for gene editing in shellfish suffer from low delivery efficiency, complex operation, difficulty in achieving heritable editing, and inability to meet the breeding needs for mass creation of edited individuals, especially in the application of CRISPR/Cas systems where there are technical obstacles.
Using CRISPR/Cas9 recombinant plasmids as delivery vectors, exogenous nucleic acid fragments were introduced into shellfish zygotes using sperm. By designing targeting sgRNAs and constructing recombinant plasmids suitable for shellfish, efficient gene editing was achieved.
It achieves efficient and stable editing of shellfish genes, with high fertilization and hatching rates, and a plasmid introduction rate of 35%-45%. It also successfully screens adult individuals carrying the target mutant phenotype, adapting to the biological characteristics of high egg production in shellfish, simplifying operations and reducing costs.
Smart Images

Figure CN121874264A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of marine biotechnology and genetic breeding, and specifically relates to a method for gene editing in shellfish using sperm as a delivery carrier. Background Technology
[0002] Shellfish are an important aquaculture resource and a key ecological group in my country, with their industrial economic value and scientific research significance becoming increasingly prominent. With the successive decoding of the genomes of various economically important shellfish such as oysters, scallops, and clams, research has entered the era of functional genomics, aiming to elucidate the genetic basis of important traits such as growth, stress resistance, development, and immunity. However, the development of this field has long been limited by the lack of efficient and stable heritable gene-editing technologies, severely restricting in-depth analysis of trait formation mechanisms and the establishment of precision breeding techniques. Although gene-editing tools, represented by the CRISPR / Cas system, have been successfully applied in aquatic animals such as fish, they still face severe technical challenges in shellfish. This is mainly due to the unique reproductive and developmental biological characteristics of shellfish: small egg diameter, soft egg membrane, long developmental cycle and high mortality rate in the embryonic and larval stages, and a lack of mature cell lines and cell culture techniques. Therefore, conventional delivery methods such as microinjection and electroporation are inefficient and have poor reproducibility in shellfish, making it difficult to achieve stable heritable editing effects, and even more difficult to meet the breeding needs of creating edited individuals in batches. Furthermore, the long generation cycle of shellfish, from selecting and breeding edited individuals to assessing genetic stability, is time-consuming, further increasing the difficulty of technology development and application. Therefore, establishing a novel delivery technology suitable for shellfish that can efficiently produce heritable gene-editing has become a core technological bottleneck that urgently needs to be overcome in this field.
[0003] Sperm delivery utilizes the ability of sperm to spontaneously bind and internalize exogenous nucleic acids, introducing exogenous genetic material into oocytes during fertilization. Since Lavitrano et al. (1989) first successfully delivered a reporter gene using mouse sperm, this technology has been proven effective in transgenic research in mammals such as sheep, cattle, and pigs, and various sperm processing strategies have been developed, including co-incubation, electroporation, liposome-mediated delivery, and antibody binding. The size of the exogenous DNA fragments that can be transported can even reach 500kb. However, this technology has previously been mainly applied to mammals. Due to fundamental differences between mollusks and mammals in sperm structure, fertilization mechanisms, and early embryonic development, directly applying existing mammalian sperm delivery methods to mollusks is not feasible. Its applicability, efficiency, and feasibility for use in gene editing systems such as CRISPR / Cas in aquatic animals such as mollusks have not been systematically studied and verified. Many unknown technical obstacles remain in key aspects such as the binding conditions between sperm and editing tools, the maintenance of fertilization capacity, and the effective release and functional realization of editing tools in the embryo.
[0004] Therefore, in order to address the long-standing technical challenges in shellfish gene editing, such as low delivery efficiency, high operational difficulty, and difficulty in heritability, developing a shellfish gene editing method that uses sperm as a delivery vector, is specifically suitable for the characteristics of shellfish sperm, is highly compatible with the CRISPR / Cas system, and enables heritable editing, has significant technological innovation value and promising industrial application prospects. Summary of the Invention
[0005] The purpose of this invention is to provide a method for gene editing in shellfish using sperm as a delivery carrier, which overcomes the shortcomings of existing technologies such as low delivery efficiency, complex operation, and difficulty in achieving heritable editing, and provides a new, efficient, stable, and batch-operable approach for gene function research and molecular breeding in shellfish.
[0006] The present invention first provides a CRISPR / Cas9 recombinant plasmid for expressing exogenous nucleic acid fragments in shellfish, wherein the recombinant plasmid contains an exogenous nucleic acid fragment for editing shellfish genes, and its promoter is the promoter with the sequence SEQ ID NO:1;
[0007] Furthermore, the aforementioned shellfish genes, as specifically described in this embodiment, are genes related to the early ciliary development phenotype of the dwarf clam. Cfp206 (SEQ ID NO:2) or BCO2 gene (SEQ ID NO:3) ;
[0008] The aforementioned exogenous nucleic acid fragment is for editing Cfp206 gene sgRNA, the sequence of which is SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6; The sgRNA used to edit the BCO2 gene has the sequence of SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:9; The CRISPR / Cas9 recombinant plasmid provided by this invention can be introduced into mollusc zygotes using sperm as a delivery vector; In another aspect, the present invention also provides a method for editing shellfish genes, which uses the above-mentioned CRISPR / Cas9 recombinant plasmid and sperm as a delivery vector to introduce exogenous nucleic acid fragments into shellfish fertilized eggs for editing; Furthermore, the method includes the following steps: 1) Preparation and pretreatment of sperm vectors: Sperm cells from *Clam pygmy* were collected, centrifuged, washed, and then resuspended in pre-cooled (0°C) 2.25× PBS solution containing 0.01% CaCl2 to obtain a sperm suspension. 2) Recombinant plasmid attachment and transformation: The constructed recombinant plasmid was added to the sperm suspension prepared in step 1) and placed in an ice-water bath (0℃) for 35 min; then the mixture was placed in a 42℃ water bath for 75 s heat shock and immediately transferred back to an ice-water bath (0℃) for 2 min. 3) Artificial insemination and embryo hatching: The sperm that has undergone plasmid transformation in step 2) are artificially inseminated at a ratio of 1500:1. Then, the fertilized eggs are placed in filtered seawater at 21-22℃ for embryo hatching.
[0009] The method of this invention can successfully introduce CRISPR / Cas9 recombinant expression plasmids into mollusks. After artificial insemination at a sperm-to-egg ratio of 1500:1, the fertilization rate and hatching rate remained high, reaching 95% and 80%, respectively. In the D-type larval stage of *Meretrix meretrix*, the plasmid introduction rate reached 35%-45%, and adult individuals carrying the target mutant phenotype have been successfully screened. Compared with existing technologies, the sperm-based delivery method provided by this invention has advantages such as simple operation, low cost, and short time consumption. It is also easily scalable and well-suited to the high egg production characteristics of mollusks, meeting the needs of practical breeding and production. Attached Figure Description
[0010] Figure 1 This invention describes the process of constructing recombinant plasmids and a map of the CRISPR / Cas9 recombinant expression plasmid of the mCherry fluorescent protein gene. Figure 2 The dwarf clam provided in Embodiment 1 of this invention Cfp206 A diagram illustrating the results of gene editing.
[0011] Figure 3 The dwarf clam provided in Embodiment 2 of the present invention BCO2 A diagram illustrating the results of gene editing. Detailed Implementation
[0012] This invention constructs a CRISPR / Cas9 recombinant plasmid suitable for expression in shellfish, designs target-specific sgRNAs for the target gene, and uses sperm as a delivery vector to introduce the CRISPR / Cas9 / sgRNAs editing system into fertilized eggs, thereby achieving targeted gene editing in shellfish and obtaining corresponding gene-edited individuals.
[0013] Specifically, the steps include the following: 1) Construction of recombinant expression plasmid: Based on the CRISPR / Cas9 backbone plasmid (Plasmid #99154) expressing LentiCRISPRv2-mCherry fluorescent protein, its original ef1a promoter was replaced with a viral promoter with the sequence SEQ ID No:1, and the sgRNA expression cassette designed for the target gene was integrated into the plasmid, thereby constructing a recombinant expression plasmid that can simultaneously express Cas9 protein and target sgRNA, suitable for shellfish gene editing; 2) Preparation and pretreatment of sperm carriers: Collect sperm from *Clam of Pleistocene*, centrifuge at 3000 r / min for 3 min, discard the supernatant; resuspend the sperm pellet in 2.25× PBS solution, centrifuge again at 3000 r / min for 3 min, discard the supernatant; add pre-cooled (0℃) 2.25× PBS solution containing 0.01% CaCl2, gently mix by pipetting, centrifuge at 0℃, 3000 r / min for 3 min, discard the supernatant; repeat the above washing steps once; finally, carefully remove excess supernatant, retain about 100 μL of liquid and mix thoroughly with the sperm pellet to obtain the pretreated sperm suspension; 3) Plasmid attachment and transformation: Add 20 μg of the gene editing plasmid constructed in step (1) to the sperm suspension prepared in step (2), and let it stand in an ice-water bath (0℃) for 35 min; then place the mixture in a 42℃ water bath for 75 s heat shock, and immediately transfer it back to an ice-water bath (0℃) and let it stand for 2 min; the whole operation process should be kept stable and avoid violent shaking or collision. 4) Artificial insemination and embryo hatching: The sperm that has completed plasmid transformation in step (3) is artificially inseminated at a ratio of 1500:1, and then the fertilized eggs are placed in filtered seawater at 21-22℃ for embryo hatching. 5) Detection of editing efficiency and screening of mutants: For the embryos that were successfully hatched in step (4), the mCherry fluorescence signal was first observed under a fluorescence microscope to preliminarily assess the introduction and expression of the recombinant plasmid; then, the editing efficiency and mutation type of the target gene were verified at the genomic level by PCR amplification and sequencing; finally, the edited individuals were subjected to corresponding phenotypic analysis and screening based on the function of the target gene and its expression period.
[0014] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are for illustrative purposes only and do not constitute a limitation thereof. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.
[0015] Unless otherwise stated, the terms used in this invention generally have the meanings commonly understood by those skilled in the art.
[0016] Example 1: Editing in *Meretrix meretrix* based on CRISPR / Cas9 recombinant plasmids Cfp206 Gene and its expression verification This embodiment was conducted from April to May 2025 at the Key Laboratory of Marine Biological Genetics and Breeding of the Ministry of Education, Ocean University of China.
[0017] 1) Construction of recombinant expression plasmid: Based on the CRISPR / Cas9 backbone plasmid (Plasmid #99154) expressing LentiCRISPRv2-mCherry fluorescent protein, the original ef1a promoter was replaced with the promoter with the sequence SEQ ID No:1, as follows: Figure 1 As shown, the specific construction steps are as follows: a) Vector preparation: Using LentiCRISPRv2-mCherry plasmid as a template, primers were designed on both sides of its EF-1α core promoter region. PCR amplification was performed using a high-fidelity enzyme (Vazyme #P525) to obtain a linearized plasmid backbone while simultaneously removing the original promoter.
[0018] b) Preparation of promoter insert fragment: A linearized DNA fragment of the promoter with the insert sequence SEQ ID No:1 was prepared by PCR amplification. A sequence completely homologous to the ends of the linearized vector in 1) was introduced at the 5' end of its forward and reverse amplification primers, so that the amplified insert fragment has homologous arms at both ends that match the ends of the vector.
[0019] c) Purification of recombinant plasmids: The linearized vector and the PCR-amplified insert were purified by gel electrophoresis to ensure that there were no obvious impurities. Subsequently, the purified linearized vector and the insert were mixed at a certain molar ratio and reacted at 50°C for 30 minutes under the catalysis of recombinase (Vazyme #C117) to complete the directional homologous recombination cloning.
[0020] d) Sequencing verification: Sanger sequencing was performed on the homologous recombination linker region in the recombinant plasmid to verify that the sequence was completely correct and without mismatches or abnormalities. Sequencing results confirmed that the EF-1α core promoter on the LentiCRISPRv2-mCherry plasmid had been successfully replaced by the Oshv117 promoter. Figure 1 ).
[0021] Genes related to early ciliary development phenotype in dwarf clam Cfp206 (SEQ ID NO:2), three specific sgRNAs were designed and synthesized, with the following sequences: sgRNA site 1: 5'—TTGATTGAGAAGATTCAGTC—3' (SEQ ID NO:4) sgRNA site 2: 5'—GCGCAAGAATGTGCCAGCAA—3' (SEQ ID NO: 5), sgRNA site 3: 5'—ATTCATGTCACTAACAAAGA—3' (SEQ ID NO:6); The sgRNA expression cassette was integrated into the plasmid described above to construct a plasmid that can simultaneously express Cas9 protein and target RNA. Cfp206 Recombinant expression plasmid of gene sgRNA.
[0022] 2) Preparation of sperm pretreatment solution: Measure 20× PBS stock solution and dilute with ultrapure water to prepare 2.25× PBS working solution. Weigh a certain amount of CaCl2 and add it to the 2.25× PBS solution to prepare the sperm pretreatment solution, wherein the concentration of CaCl2 is 0.01%. 3) Sperm Acquisition and Enrichment: The surface of the dwarf clam was washed with filtered seawater, and artificial spawning was induced using the air-drying and warming method. Sufficient high-quality sperm were collected and pretreated. The sperm was centrifuged at 3000 rpm for 3 minutes, and the supernatant was discarded. The precipitate was immediately resuspended in 1 mL of 2.25× PBS solution, centrifuged at 3000 rpm at room temperature for 3 minutes, and the supernatant was discarded. 4) Sperm pretreatment: Add 1 mL of pre-cooled (0℃) sperm pretreatment solution to the precipitate obtained in step (3) and gently mix by pipetting. Centrifuge the resulting solution at 3000 rpm at 0℃ for 3 minutes and discard the supernatant. Repeat this washing step once. Finally, carefully aspirate the excess supernatant, retaining about 100 μL of liquid and thoroughly mix it with the sperm precipitate. At this point, the sperm concentration is 10. 8 10 cells / mL, meaning 10 cells / mL of suspension. 7 One sperm; 5) Plasmid attachment and transformation: Add 20 μg of plasmid to the sperm suspension prepared in step (4). Cfp206 Gene-editing plasmids were incubated in an ice-water bath (0°C) for 35 min. The mixture was then heat-shocked in a 42°C water bath for 75 s, and immediately transferred back to the ice-water bath (0°C) for 2 min. The entire process must be carried out smoothly, avoiding violent shaking or impact. 6) Artificial insemination and embryo hatching: The sperm that have completed plasmid transformation in step (5) are immediately subjected to artificial insemination (fertilization ratio of 3×10). 7 Each sperm corresponds to 2 × 10 4 (The number of fertilized eggs is 1500:1, meaning the sperm-to-egg ratio is 1500:1). The fertilized eggs are then placed in filtered seawater at 21-22℃ for embryo incubation, with the filtered seawater being changed periodically.
[0023] 7) Detection of editing efficiency and observation of mutation phenotype: Observe under a fluorescence microscope after the embryo develops to the D-type larval stage. For example... Figure 2 As shown in Figure A, obvious mCherry red fluorescence signals were observed in the larvae of the sg1, sg2, and sg3 experimental groups, with approximately 40% of the larvae exhibiting red fluorescence. PCR amplification was performed using genomic DNA and cDNA of type D larvae as templates, and clear target bands were observed by electrophoresis in both cases. Figure 2 B), further confirming the successful expression of the recombinant plasmid. Further observation revealed that some larvae exhibiting red fluorescent signals displayed a phenotype of ciliary absence. Figure 2 C) indicates that genes related to ciliary development were successfully knocked down in these pygmy clam larvae. Cfp206 Among them, the proportion of larvae without cilia in the sg1 group was 42.03% (29 / 69), the proportion in the sg2 group was 31.51% (23 / 73), and the proportion in the sg3 group was 30.77% (24 / 78). Therefore, sg1 can also be used as a key sgRNA for subsequent research on the early ciliary development phenotype of Pleurotus pygmysus.
[0024] Example 2: Editing in *Meretrix meretrix* based on CRISPR / Cas9 recombinant plasmids BCO2 Gene and its expression verification This embodiment was conducted from June to August 2025 at the Key Laboratory of Marine Biological Genetics and Breeding of the Ministry of Education, Ocean University of China.
[0025] 1) Construction of recombinant expression plasmids: Based on the CRISPR / Cas9 backbone plasmid (Plasmid #99154) expressing LentiCRISPRv2-mCherry fluorescent protein, its original ef1a promoter was replaced with the promoter with the sequence SEQ ID No:1 (as in Example 1). Three specific sgRNAs were designed and synthesized targeting the BCO2 gene (SEQ ID NO:3) related to carotenoid metabolism in *Clams pygmys*, with the following sequences: sgRNA site 1: 5'—CCTCAGCTTCTGGTGAAGTT—3' (SEQ ID NO:7) sgRNA site 2: 5'—GTGATGCTGGTGTACCAAAC—3' (SEQ ID NO: 8), sgRNA site 3: 5'-CCAGCATTGGTTTGATGGTC-3' (SEQ ID NO: 9).
[0026] The sgRNA expression cassette was integrated into the above plasmid to construct a targeted expression cassette. BCO2 CRISPR / Cas9 recombinant expression plasmids for genes; Steps 2) to 6) are performed in the same manner as steps 2) to 6) in Example 1, except that the edit plasmid is replaced with the one constructed in this example. BCO2 Gene editing plasmids; 7) Detection of editing efficiency and observation of mutant phenotypes: Fluorescence observation was performed when the embryo developed to the D-type larval stage. For example... Figure 3 As shown in Figure A, mCherry red fluorescence signal was detected in the larvae of all experimental groups, with approximately 36% of the larvae showing a positive signal. PCR amplification detection ( Figure 3 B) Confirmed the successful introduction and expression of the plasmid. After culturing the experimental group larvae for another 80 days, 12 (12 / 72) successfully edited adult individuals were detected in the sg1 group, whose visceral mass was significantly orange-yellow compared to the control group. Figure 3 C), two individuals (2 / 80) were successfully edited in the sg2 group, while no individuals (0 / 75) were successfully edited in the sg3 group. Sanger sequencing of the target regions of the successfully edited individuals in the sg1 group revealed different types of mutations at the target sites in all 12 edited individuals. Figure 3 D). In addition, such as Figure 3As shown in E, ELISA detection confirmed significant differences in carotenoid content in the mantle, gill filaments, and digestive gland tissues between the edited group and the control group. p < 0.05).
[0027] In summary, the method provided by this invention has successfully achieved efficient editing of target genes in shellfish. This method is simple to operate, low in cost, and quick, and is easily scaled up for large-scale production, making it suitable for the high egg production of shellfish. More importantly, this invention can not only detect the editing effect and phenotypic changes in the larval stage, but also obtain and identify adult individuals carrying stable genetic mutations. This overcomes the bottleneck of existing shellfish gene editing technologies, which are mostly limited to the embryonic or larval stages, and provides a reliable new technological system for creating new gene-edited germplasm in shellfish.
[0028] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any person skilled in the art can make possible variations or modifications based on the disclosed technical content without departing from the technical principles and spirit of the present invention, and these equivalent variations and modifications also fall within the scope defined by the claims of the present invention.
Claims
1. A CRISPR / Cas9 recombinant plasmid, characterized in that, The recombinant plasmid contains an exogenous nucleic acid fragment for editing shellfish genes, and its promoter sequence is SEQ ID NO:
1.
2. The recombinant plasmid as described in claim 1, characterized in that, The gene of the shellfish is a gene related to early cilia development phenotype of M. lenticulata Cfp20 6 or BCO2 gene.
3. The recombinant plasmid as described in claim 1, characterized in that, The exogenous nucleic acid fragment is an sgRNA used to encode a gene.
4. The recombinant plasmid as described in claim 1, characterized in that, The sgRNA mentioned is used for gene editing. Cfp206 The sgRNA of the gene has the sequence SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:
6.
5. The recombinant plasmid as described in claim 1, characterized in that, The sgRNA mentioned is an sgRNA used for gene editing of the BCO2 gene, and its sequence is SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:
9.
6. The application of the recombinant plasmid according to claim 1 in shellfish gene editing.
7. A method for gene editing in shellfish, characterized in that, The method described herein involves using the recombinant plasmid as described in claim 1, with sperm as the delivery vector, to introduce exogenous nucleic acid fragments into mollusc fertilized eggs for editing.
8. The method as described in claim 7, characterized in that, The method includes the following steps: 1) Preparation and pretreatment of sperm vectors: Sperm cells from *Clam of Pygmy Clam* were collected, centrifuged, washed, and then resuspended in pre-cooled 2.25× PBS solution containing 0.01% CaCl2 to obtain a sperm suspension. 2) Recombinant plasmid attachment and transformation: The constructed recombinant plasmid was added to the sperm suspension prepared in step 1) and allowed to stand in an ice-water bath for 35 min; then the mixture was placed in a 42℃ water bath for 75 s for heat shock, and immediately transferred back to the ice-water bath and allowed to stand for 2 min. 3) Artificial insemination and embryo hatching: The sperm that has undergone plasmid transformation in step 2) are artificially inseminated at a ratio of 1500:
1. Then, the fertilized eggs are placed in filtered seawater at 21-22℃ for embryo hatching.
Citation Information
Patent Citations
A METHOD FOR TRANSFECTION AND EXPRESSION OF EXOGENOUS GENES IN SPERM CELLS OF NON-MAMMALIAN ANIMALS
BR102019002514A2
Electroporation gene editing method of crassostrea gigas beta-tubulin gene and application
CN114703231A
Function verification method of bivalve growth regulation gene
CN115976103A
Method for introducing exogenous nucleic acid fragment into bivalve sperm
CN118064501A