A promoter element and methods for genetically editing plants

Abstract

The present disclosure relates to a promoter element and a method for gene editing of plants. Specifically, it relates to a promoter element, an RNA coding element, an esgRNA, an sgRNA bidirectional enhanced expression sequence, a vector capable of efficient gene editing in plants and a method for gene editing of plants. The promoter element and the vector can improve the gene editing efficiency and targeting specificity of plants, and the sgRNA bidirectional enhanced expression sequence can further improve the gene editing efficiency and targeting specificity of plants.

Description

Technical Field

[0001] This disclosure relates to the field of genetic engineering, specifically to a promoter element, an RNA coding element, an esgRNA, a bidirectional enhanced expression sequence of sgRNA, a vector capable of efficient gene editing in plants, and a method for gene editing in plants. Background Technology

[0002] CRISPR-Cas9 gene editing technology is a precise and efficient method for modifying gene editing domains, and it has significant application value for the genetic improvement of crops and the study of functional genes. Using artificially designed single guide RNA (sgRNA), this technology can identify target genes and guide the Cas9 protease to cleave them, thereby achieving gene insertion or knockout. This plays a crucial role in plant germplasm innovation and the development of high-yield new varieties.

[0003] However, traditional strong promoters such as 2X35S, although commonly used in plant gene editing, have relatively limited driving efficiency, resulting in insufficient editing efficiency, especially in complex genomes or higher plants. Exogenous gRNA sequences may trigger the plant's immune response, leading to RNA degradation, which further reduces editing efficiency and stability. Thus, current CRISPR-Cas9 gene editing technology has the following two main problems: (1) Current promoters (such as the 35S strong promoter) have low transcriptional activity, and the gene editing efficiency is correspondingly low; this means that a lot of screening work is required to find gene-editing positive plants during gene editing, making the whole process very laborious. (2) Efforts to improve gene editing efficiency are limited due to the lack of methods to simultaneously increase the expression levels of Cas9 gene and sgRNA. Therefore, finding promoters with higher transcriptional activity and developing methods to simultaneously increase the expression levels of Cas9 gene and sgRNA are undoubtedly crucial for improving gene editing technology.

[0004] In summary, existing CRISPR-Cas9 gene editing technologies still face challenges in polyploid genetic improvement and functional gene research, including low purification or biseleural editing efficiency and difficulty in simultaneously increasing the expression levels of Cas9 gene and sgRNA. Summary of the Invention

[0005] The purpose of this disclosure is to provide a promoter element and vector that can improve gene editing efficiency and target specificity in plants. This disclosure also provides a bidirectional sgRNA expression enhancement sequence, further improving gene editing efficiency and target specificity in plants.

[0006] To achieve the above objectives, a first aspect of this disclosure provides a promoter element whose nucleotide sequence is the full length of the nucleotide sequence shown in SEQ ID NO.1 or a fragment of the nucleotide sequence shown in SEQ ID NO.1; the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 987-1709 of the nucleotide sequence shown in SEQ ID NO.1; preferably, the fragment of the nucleotide sequence shown in SEQ ID NO.1 includes positions 653-1709 of the nucleotide sequence shown in SEQ ID NO.1.

[0007] A second aspect of this disclosure provides an RNA coding element, the nucleotide sequence of which is the nucleotide sequence shown in SEQ ID NO. 2.

[0008] A third aspect of this disclosure provides a bidirectional enhancement expression sequence for sgRNA, the bidirectional enhancement expression sequence for sgRNA comprising the RNA coding element and esgRNA described in the second aspect;

[0009] The bidirectional enhanced expression sequence of the sgRNA is the nucleotide sequence shown in SEQ ID NO.4.

[0010] Optionally, the esgRNA is a sequence obtained by adding, deleting, or replacing some nucleotides on the original sgRNA; the nucleotide sequence of the esgRNA is shown in SEQ ID NO.3.

[0011] The fourth aspect of this disclosure provides a vector capable of efficient gene editing in plants, the vector having inserted the promoter element described in the first aspect, and preferably, also having inserted the RNA coding element described in the second aspect.

[0012] Optionally, the vector further includes a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator inserted upstream of the promoter element described in the first aspect; the sgRNA insertion region contains the sgRNA bidirectional enhancement expression sequence or esgRNA described in the third aspect.

[0013] Optionally, the vector may further contain an spCas9 protein expression element, a UBP terminator, and a hygromycin selection marker inserted downstream of the promoter element described in the first aspect.

[0014] The fifth aspect of this disclosure provides a method for gene editing in plants, the method comprising the following steps:

[0015] S1. Insert a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector described in the fourth aspect to obtain a gene editing vector;

[0016] S2. Transform Agrobacterium using the gene editing vector to obtain transformants;

[0017] S3. Infect the plant culture with the transformant to obtain the infected plant culture;

[0018] S4. The infected plant culture is cultured in a medium containing hygromycin to obtain the gene-edited plant.

[0019] Optionally, the nucleotide sequence of the gRNA targeting the gene to be edited is SEQ ID NO.5.

[0020] Optionally, the plant is selected from at least one of the following: tobacco, tomato, soybean, cotton, chili pepper, rapeseed, eggplant, Chinese cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis thaliana, sesame, quinoa, sesame, grape, apple, pear, kiwi, chrysanthemum, dandelion, orchid, and wintergreen, as well as rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana, and lily.

[0021] Tobacco is preferred.

[0022] Through the above technical solutions, the promoter element disclosed herein can improve the gene editing efficiency of plants, increasing homozygous editing efficiency by 3 times. The editing vector prepared from the bidirectional enhanced expression sequence of sgRNA and the promoter element disclosed herein further improves the gene editing efficiency of plants, increasing homozygous editing efficiency by 5.3 times. Editing vectors containing the promoter element and / or the bidirectional enhanced expression sequence of sgRNA disclosed herein can significantly improve sgRNA expression levels and the acquisition of homozygous gene-edited lines, providing support for achieving whole-genome editing and gene function analysis in plants.

[0023] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0024] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0025] Figure 1 This shows the expression of the tobacco NtHTB gene in different tissues.

[0026] Figure 2 This is a schematic diagram of the carrier involved in this disclosure.

[0027] Figure 3 This refers to the homozygous or biallelic editing efficiency of the vectors involved in this disclosure in the plant genome.

[0028] Figure 4 This is a schematic diagram of the structure of the RNA coding element disclosed herein.

[0029] Figure 5 This is a schematic diagram of the pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors disclosed herein.

[0030] Figure 6 This discloses the homo- and biallelic editing efficiencies of the pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors.

[0031] Figure 7 This is a comparative analysis diagram of homozygous or biallelic materials generated by editing plant genomes using 35S::Cas9, HTBp1.7::Cas9, PDC55A, and PDC55B. Detailed Implementation

[0032] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0033] The first aspect of this disclosure provides a promoter element, the nucleotide sequence of which is the full length of the nucleotide sequence shown in SEQ ID NO. 1 or a fragment of the nucleotide sequence shown in SEQ ID NO. 1; the fragment of the nucleotide sequence shown in SEQ ID NO. 1 includes positions 987-1709 of the nucleotide sequence shown in SEQ ID NO. 1; preferably, the fragment of the nucleotide sequence shown in SEQ ID NO. 1 includes positions 653-1709 of the nucleotide sequence shown in SEQ ID NO. 1.

[0034] In this disclosure, histone H2B is a core histone. In plants, post-translational modifications of histone H2B affect stem cell growth and development, regulate flowering time and yield, and participate in plant defense against pathogens and non-host resistance. Therefore, we identified the tobacco homolog mRNA_149991 of Arabidopsis thaliana HTB2, as follows... Figure 1 As shown, the inventors of this disclosure were surprised to find that this gene also exhibited extremely high transcription levels in somatic embryonic tissues during tobacco regeneration. Because this gene is highly expressed in tobacco regenerated callus and flower buds, we speculate that, given the tobacco... HTB Gene promoters can efficiently drive high gene expression in callus tissue and may be applied to genome editing, hence this disclosure.

[0035] A second aspect of this disclosure provides an RNA coding element, the nucleotide sequence of which is the nucleotide sequence shown in SEQ ID NO. 2.

[0036] In this disclosure, the inventors have surprisingly discovered that RNA-coding elements can enhance the homozygous or biallelic editing efficiency of editing vectors. Exogenous sgRNA sequences readily induce an immune response in plants, thereby promoting the further degradation of exogenous RNA by endogenous 5'-3' exonucleases. To prevent the decrease in editing efficiency caused by RNA degradation during viral infection of plants, the RNA-coding elements of this disclosure are introduced, such as... Figure 4 As shown, this RNA coding element is 64 bp long and has three stable stem-loop structures. Using RNA structure prediction software, the first core stem-loop nucleotide sequence was found to be: TGTAGC at positions 8-13, with the paired sequence GTTGCA at positions 24-29; the second core stem-loop nucleotide sequence was GGGG at positions 33-36, with the paired sequence TCTC at positions 46-49, where the circular structure between positions 37-45 consists of nucleotides that do not form a pair; the third core stem-loop nucleotide sequence was GCCGAC at positions 50-55, with the paired sequence GTTGGC at positions 59-64, and the circular sequence CCT.

[0037] A third aspect of this disclosure provides a bidirectional enhancement expression sequence for sgRNA, the bidirectional enhancement expression sequence for sgRNA comprising the RNA coding element and esgRNA described in the second aspect;

[0038] The bidirectional enhanced expression sequence of the sgRNA is the nucleotide sequence shown in SEQ ID NO.4.

[0039] In this disclosure, the nucleotide sequence of the RNA coding element is the nucleotide sequence shown in SEQ ID NO.2. The combination of the RNA coding element and esgRNA forms a bidirectionally enhanced sequence, which can further improve editing efficiency. The esgRNA is a sequence obtained by adding, removing, or replacing some nucleotides on the original sgRNA; the original sgRNA is the sgRNA used in the pDC45 vector in ZL202110786304.5, and its sequence is as shown in SEQ ID NO.6, specifically: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0040] Specifically, to avoid premature termination of transcription of sgRNAs using U6 and other Pol-III type promoters due to four consecutive Ts in the target sequence, this disclosure replaces the T at position 5 with A and the A at position 26 with T in the original sgRNA sequence. Furthermore, to enhance the stem-loop structure of the original sgRNA, positions 6 through 15 are replaced with AGAGCTATGCTGGAAACAGC. The nucleotide sequence of the resulting esgRNA is shown in SEQ ID NO. 3.

[0041] like Figure 2 As shown, the fourth aspect of this disclosure provides a vector capable of efficient gene editing in plants, the vector having inserted the promoter element described in the first aspect, and preferably, also having inserted the RNA coding element described in the second aspect.

[0042] like Figure 2 As shown, in one specific embodiment of this disclosure, a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator are further inserted upstream of the promoter element described in the first aspect in the vector; the sgRNA insertion region contains the sgRNA bidirectional enhancement expression sequence or esgRNA described in the third aspect. Preferably, the sgRNA insertion region contains the sgRNA bidirectional enhancement expression sequence.

[0043] like Figure 2 As shown, in one specific embodiment of this disclosure, the vector further includes an spCas9 protein expression element, a UBP terminator, and a hygromycin selection marker inserted downstream of the promoter element described in the first aspect.

[0044] The fifth aspect of this disclosure provides a method for gene editing in plants, the method comprising the following steps:

[0045] S1. Insert a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector described in the fourth aspect to obtain a gene editing vector;

[0046] S2. Transform Agrobacterium using the gene editing vector to obtain transformants;

[0047] S3. Infect the plant culture with the transformant to obtain the infected plant culture;

[0048] S4. The infected plant culture is cultured in a medium containing hygromycin to obtain the gene-edited plant.

[0049] According to this disclosure, the nucleotide sequence of the gRNA targeting the gene to be edited is SEQ ID NO.5. The gRNA targeting the gene to be edited is a gRNA that simultaneously targets the PDS gene in the subgenomes of both forest tobacco and tobacco villous in cultivated tobacco.

[0050] According to this disclosure, the plant is selected from at least one of the following: tobacco, tomato, soybean, cotton, chili pepper, rapeseed, eggplant, Chinese cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis thaliana, sesame, quinoa, sesame, grape, apple, pear, kiwi, chrysanthemum, dandelion, orchid and wintergreen, as well as rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana and lily;

[0051] Tobacco is preferred.

[0052] The present invention will be further described in detail below with reference to the embodiments, but the scope of the present invention is not limited to the following embodiments.

[0053] Unless otherwise specified, all materials used in this embodiment are commercially available products.

[0054] Example 1

[0055] This embodiment illustrates how to obtain the promoter element.

[0056] This disclosure uses molecular cloning techniques known to those skilled in the art, and operates as described in the following literature: Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989.

[0057] The specific method includes the following steps:

[0058] Genomic DNA from tetraploid tobacco was amplified using the forward primer sequence (5'-3'): TCGGCTTCCCCTAACTCAGA and the reverse primer sequence (5'-3'): GCCTTGGTGCCATTTGAGG. A tobacco HTB promoter (NtHTBpro) of approximately 1.7 kb in length and a fragment of the coding region sequence were obtained. Then, the above fragment was amplified using primers (5'-3') AACACCTGCTATGACTGG and (5'-3') TTGAGGAGAGAAAAATGGAGATTTT to obtain a promoter element (HTB promoter) of 1.7 kb in length, named NtHTBpro (SEQ ID NO.1).

[0059] Example 2

[0060] This example illustrates the construction of a gene-editing vector.

[0061] like Figure 2 As shown, the pDC45 vector (whose sequence is the same as that in ZL202110786304.5) was used as the backbone vector, and the pDC45 vector was obtained by double digestion with SbfI and NcoI restriction endonucleases (NEB Beijing).

[0062] Design primers with connectors:

[0063] TTCTACAGTTATGACCCTGCAGGAACACCTGCTATGACTGG; and

[0064] CGTGGTCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT;

[0065] The NtHTBpro fragment was amplified, recovered from the gel, and ligated with the pDC45 linearized fragment using a homologous recombinase (ClonExpress II One Step Cloning Kit, Novizan, C112-01). This ligation was then performed on *E. coli* to obtain the vector HTBp1.7::Cas9. Figure 2 B);

[0066] Simultaneously, primers with connectors are used:

[0067] TTCTACAGTTATGACCCTGCAGGTACGGAGGTCAAACATGGTG; and CGTGGTCCTTATAGTCCATGGCGTCCTCTCCAAATGAAATGA; amplified the pDC45 vector to obtain a 2X35S promoter, which was then cloned into the pDC45 linear vector using the same method described above to obtain 35S::Cas9 ( Figure 2 A).

[0068] Example 3

[0069] This embodiment illustrates the application of the gene editing vector of the promoter element (HTB promoter) of this disclosure in plants.

[0070] To test the editing activity of the constructed editing vectors (35S::Cas9, HTBp1.7::Cas9, PDC55, PDC55A, PDC55B) in plants, allotetraploid common tobacco was selected as the editing recipient, and the phytopene dehydrogenase gene (NtPDS) was selected as the target gene. The target gene gRNA, GCTGCATGGAAAGATGATGA, can simultaneously target two PDS copies from both forest tobacco and pubescent tobacco. Homozygous or biallelic edited tobacco plants appear pure white. To obtain the gRNA sequence of double-stranded PDS, 5 μL and 10 μmol / L of the forward primer TGCAGCTGCATGGAAAGATGATGA and the reverse primer AAACTCATCATCTTTCCATGCAGC were added with TE buffer, mixed, and placed in a PCR instrument. The mixture was heated at 98°C for 4 min, then removed and cooled to room temperature to obtain the double-stranded DNA at the sticky ends of the target site.

[0071] Linearized backbone vectors were obtained by digesting 35S::Cas9 and HTBp1.7::Cas9 with BsaI enzymes. The linearized vectors were ligated with double-stranded PDS-gRNA at T4. The ligation product was transformed into DH5α, and plasmid DNA was extracted and transformed into Agrobacterium EH105. The DNA was stored at -80℃ for later use. The pre-cultured leaf discs were placed in Agrobacterium infection solution for infection for 5 min with intermittent gentle shaking. The infected tobacco leaves were subcultured in a medium containing hygromycin. After 30 days, the number of albino buds obtained from the explants was counted. The higher the number of albino buds, the higher the homozygous or biallelic editing efficiency of the vector.

[0072] like Figure 3 As shown, statistical analysis revealed that the homozygous editing efficiency of the tobacco genome driven by the 1.7kb-long HTB promoter vector was about three times that of the traditional strong promoter 2X35S, indicating that the HTB promoter can significantly improve the genome editing efficiency of tetraploid tobacco.

[0073] Example 4

[0074] To test whether this RNA secondary structure can improve the editing efficiency of homozygous and biallelic genomes in tobacco genome editing, such as... Figure 5 As shown, a 64bp nucleic acid sequence was introduced into the pDC45 vector (the sequence of which is the same as that in ZL202110786304.5). Figure 4The specific operation is as follows: Modify the original sgRNA to esgRNA (SEQ ID NO.3), wherein the sequence of sgRNA is GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO.6). Specifically, replace T at position 5 with A, A at position 26 with T, and positions 6 to 15 with AGAGCTATGCTGGAAACAGC. The sequence of the 64bp RNA coding element was combined with esgRNA to form a bidirectionally enhanced sequence (i.e., the bidirectionally enhanced sgRNA expression sequence, as shown in SEQ ID NO.4). The bidirectionally enhanced sgRNA expression sequence was amplified using the primer pair: forward primer (5'-3'): TCATTTGGAGAGGACGTCGACGTGTAGCCTCCACCCG and reverse primer (5'-3'): CTCAGCATTCTGCTTTTCTAGATGCACCAGCCGGGAATCGAA. The PCR product was recovered using an agarose gel DNA recovery kit (Kangwei Century, CW2302M). The recovered product was ligated with the linearized pDC45 digested with SalI using the Novizan homologous recombinase kit (Novizan, C112). The specific procedure was performed according to the kit instructions. The ligation product was transformed into E. coli DH5α (Qingke Biotechnology, TSC-C01). The correctly sequenced plasmid was named pDC45-64bp. The target PDS gene PDSg5 in tobacco was designed with the forward sequence (5'-3') as: TGCAGAGGCAAGAGATGTCCTAGG and the reverse sequence (5'-3') as: AAACCCTAGGACATCTCTTGCCTC. 5 μL of each primer was added to 40 μL of TE buffer, and the mixture was incubated at 98°C for 3 minutes, then allowed to cool naturally. 1 μL of each primer was inserted into the BsaI-linearized pDC45 and pDC45-64bp vectors, respectively, to construct pDC45-PDSg5 and pDC45-64bp-PDSg5 vectors. These vectors were then transformed into Agrobacterium EH105 and used to infect cultivated tobacco. Figure 6 As shown, the proportion of albino seedlings indicates that, compared to the control, 32.3% of the seedlings transformed with the pDC45-PDSg5 vector were pure white regenerated seedlings. Approximately one-third of the regenerated plants had both copies of PDS knocked out, and 35.4% of the seedlings were partially knocked out. For the pDC45-64bp-PDSg5 vector, this proportion of pure white seedlings increased to 46.2%, and the total pure white and mixed white proportions were also significantly higher than with pDC45-PDSg5, indicating that the 64bp sequence can further enhance the knockout efficiency and homozygous / biallelic mutation efficiency of the editing vector.

[0075] To further verify the effect of bidirectional enhancement of sgRNA expression sequence on tobacco gene editing efficiency, homologous recombination was used to insert the amplified PCR product into a SalI endonuclease-linearized HTBp1.7::Cas9 vector, which was then transformed into E. coli. The editing vector with the correct sequenced positive clone was named pDC55. Figure 2 C). Simultaneously, in order to identify the strongest core driving region of the HTB promoter, truncation activity analysis was performed on the HTB promoter;

[0076] The 1KB-long HTB promoter (nucleotide sequence 653-1709 of SEQ ID NO.1) was amplified using the following primers:

[0077] TTCTACAGTTATGACCCTGCAGGCTAGACTGATTTCTCAAGTTTTTACCCA; and

[0078] CGTGGTCCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT.

[0079] The 0.7 kb HTB promoter (nucleotide sequence 987-1709 of SEQ ID NO.1) was amplified using the following primers:

[0080] TTCTACAGTTATGACCCTGCAGGACAATAGATAGCTTGGGCCGG; and

[0081] CGTGGTCCTTATAGTCCATGGTTGAGGAGAGAAAAATGGAGATTTT.

[0082] The corresponding fragments were inserted into the linearized HTBp1.7::Cas9 vector using homologous recombination, resulting in the pDC55A vector. Figure 2 D, sequence as shown in SEQ ID NO.7) and pDC55B vector ( Figure 2E). The NtPDS target site GCTGCATGGAAAGATGATGA of tobacco was directionally cloned into pDC55 and pDC55B vectors to obtain corresponding editing vectors containing the PDS target site. These vectors were then introduced into Agrobacterium EH105 and introduced into tetraploid tobacco using the leaf disc method. The statistical methods for homozygous or bis-allelic edited seedlings, i.e., white regenerated shoots, were as described above. The results showed that the editing efficiency of the pDC55, i.e., the 1.7kb HTB promoter, was 3.8 times higher than that of the 2X35S promoter for homozygous and bis-allelic editing. pDC55A and pDC55B increased the editing efficiency by 5.3 times and 4.2 times, respectively. This indicates that the 1kb HTB promoter is the most core element region of HTB. The combination of this sequence and RNA secondary structure, i.e., pDC55A, has the strongest fit and exhibits the strongest homozygous or bis-allelic editing efficiency of the plant genome. Tobacco explants can produce the most white regenerated shoots. Figure 7 ).

[0083] The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings. However, the present disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0084] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0085] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A promoter element, characterized in that, The nucleotide sequence of the promoter element is the full length of the nucleotide sequence shown in SEQ ID NO.

1.

2. A vector capable of efficient gene editing in plants, characterized in that, The carrier is inserted with the promoter element as described in claim 1.

3. The carrier according to claim 2, wherein, The vector further includes a 2X35Sp promoter, an sgRNA insertion region, and an eu terminator inserted upstream of the promoter element described in claim 1.

4. The carrier according to claim 2, wherein, The vector further includes an spCas9 protein expression element, a UBP terminator, and a hygromycin selection marker inserted downstream of the promoter element described in claim 1.

5. A method for gene editing in plants, characterized in that, The method includes the following steps: S1. Insert a gRNA coding sequence targeting the gene to be edited into the sgRNA insertion region of the vector according to any one of claims 2-4 to obtain a gene editing vector; S2. Transform Agrobacterium using the gene editing vector to obtain transformants; S3. Infect the plant culture with the transformant to obtain the infected plant culture; S4. The infected plant culture is cultured in a medium containing hygromycin to obtain the gene-edited plant.

6. The method according to claim 5, wherein, The nucleotide sequence of the gRNA targeting the gene to be edited is SEQ ID NO.

5.

7. The method according to claim 5, wherein, The plants are selected from at least one of the following: tobacco, tomato, soybean, cotton, chili pepper, rapeseed, eggplant, Chinese cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis thaliana, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, orchid, and wintergreen, as well as rice, wheat, corn, sorghum, wild rice and millet, sugarcane, bamboo, onion, leek, ginger, banana, and lily.

8. The method according to claim 7, wherein, The plant in question is tobacco.

Images