SgRNA for efficient cytosine base editing of sheep SOCS2 gene and application of sgRNA

Abstract

The invention relates to the field of genetic engineering and animal husbandry genetic breeding, in particular to sgRNA for efficient cytosine base editing (CBE) of a sheep SOCS2 gene and application of the sgRNA. When the sgRNA-S1 cytosine base provided by the invention is used for editing the SOCS2 gene of the sheep fibroblast, the efficiency is up to 85%; when the sgRNA-S1 cytosine base provided by the invention is used for editing a sheep embryo, the SOCS2 gene editing sheep is obtained, and the editing efficiency is as high as 80%. According to the invention, C-to-T mutation is generated at the second exon of the SOCS2 gene by adopting cytosine base editing, a termination codon is introduced, SOCS2 protein translation is terminated in advance, efficient knockout of the SOCS2 gene is realized, SOCS2 gene base editing sheep is created, technical support is provided for new germplasm creation of fast-growing mutton sheep, and a new way is provided for new sheep variety creation.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and animal husbandry genetic breeding, and in particular to an sgRNA for efficient cytosine base editing of sheep SOCS2 gene and an application thereof. Background Art

[0002] Suppressor of cytokine signaling 2 (SOCS2) is a member of the suppressor of cytokine signaling (SOCS) family and is involved in regulating a variety of physiological and pathological processes, including individual growth, metabolism, bone formation, and immunity. SOCS proteins all have similar structures, including an N-terminal extended SH2 domain (ESS), followed by a phosphotyrosine (pY) central Src homology 2 (SH2) domain that recognizes target sequences, and a C-terminal SOCS box that interacts with the adapter ElonginB and ElonginC complex (EloB / C). All SOCS proteins can bind to EloBC and recruit Cullin5 with high specificity to form different SOCS EloB / C-Cullin5-Rbx2 (CRL5SOCS) E3 ligases, catalyzing ubiquitin transfer and proteasomal degradation of specific substrates, thereby participating in the regulation of a variety of biological processes. Studies have found that the SH2 domain and SOCS box in the SOCS2 gene are necessary for SOCS2 protein to act as an E3 ligase to catalyze ubiquitin transfer and proteasomal degradation of specific substrates. If the leucine at position 163 of the SOCS box in the SOCS2 gene is mutated to proline, the cysteine ​​at position 167 is mutated to phenylalanine, or the SOCS box is knocked out, the SOCS2 protein cannot interact with ElonginB / C, and thus loses the function of regulating GHR through ubiquitination. Chen et al. found that the SH2 domain in the SOCS2 protein specifically recognizes the N-terminal domain of SLC7A11, and the SOCS box forms a complex with EloB / C to recruit ubiquitin molecules and then specifically induces the ubiquitination of the SLC7A11 protein, ultimately leading to the occurrence of HCC ferroptosis and radiosensitization (Chen et al., 2022).

[0003] In mice, SOCS2-deficient mice grew 30-40% faster, and the size of various organs (including muscle and skeletal muscle length) increased proportionally. The femur, tibia and humerus of SOCS2-deficient mice were longer, and the bone mass increased. Studies on sheep found that the C / T mutation of the SOCS2 gene caused the arginine at position 96 of the SOCS2 protein to mutate to cysteine, which changed the three-dimensional structure of the protein and affected the growth performance of sheep. Weaned lambs carrying the T mutation weighed more than wild-type lambs, and had significantly increased height, width and tibia length (Rupp et al., 2015).

[0004] Cytosine base editing (CBE) editing can produce C→T or G→A conversion, so CAG, CAA, and CGA can be converted to stop codons to achieve early termination of the gene during translation, achieving the purpose of knocking out the gene. Yao Xudong et al. (Yao Xudong et al., 2021) used AncBE4max to edit the MSTN gene in Kazakh sheep fetal fibroblasts, with an editing efficiency of up to 26.7%. Xu et al. (Xu et al., 2022) used BE4-Gam to induce FecGH (p.S395F) editing of the GDF9 gene to increase the lamb performance of sheep, with an editing efficiency of 16.3%. The above results prove that base editing can improve the growth and reproductive traits of sheep and improve economic benefits.

[0005] At present, in the research on base editing of SOCS2 gene, only Zhou et al. used the BE3 system to produce the p.R96C mutation of SOCS2 gene in Tan sheep. The mutant sheep gained weight significantly faster than the wild type, but the editing efficiency was low, only 25.0%. Summary of the invention

[0006] The purpose of the present invention is to provide an sgRNA for efficient cytosine base editing of the sheep SOCS2 gene and its application to solve the problems existing in the above-mentioned prior art. The sgRNA provided by the present invention can improve the base editing efficiency of the sheep SOCS2 gene, realize the efficient knockout of the SOCS2 gene, and the prepared edited sheep weighs more than the wild-type sheep, providing technical support for the efficient creation of fast-growing mutton sheep germplasm by SOCS2 gene editing.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an sgRNA-S1 for efficiently editing the sheep SOCS2 gene, and the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.5.

[0009] The present invention provides a DNA encoding the above-mentioned sgRNA1-S1, and the DNA and nucleotide sequence are shown in SEQ ID NO.7.

[0010] The present invention provides a biological material containing the above DNA.

[0011] Preferably, the biological material comprises a recombinant expression vector or an expression cassette.

[0012] The present invention provides a composition for efficiently editing a sheep SOCS2 gene, the composition comprising an sgRNA-S1 system and a CBE system, the sgRNA system comprising the above-mentioned sgRNA-S1 or the above-mentioned biological material, the CBE system comprising a fusion protein consisting of a Cas9 protein, a cytosine deaminase, a uracil glycosidase inhibitor and a nuclear import signal, a biological material expressing the fusion protein of the Cas9 protein, the cytosine deaminase, the uracil glycosidase inhibitor and the nuclear import signal, or an mRNA expressing the fusion protein of the Cas9 protein, the cytosine deaminase, the uracil glycosidase inhibitor and the nuclear import signal; the biological material comprises a recombinant expression vector or an expression cassette.

[0013] The present invention provides the use of the above-mentioned sgRNA-S1, the above-mentioned DNA, the above-mentioned biological material or the above-mentioned composition in any of the following:

[0014] (1) Preparation of products for sheep SOCS2 gene editing;

[0015] (2) Preparation of SOCS2 gene-edited sheep;

[0016] (3) Molecular breeding of sheep.

[0017] The present invention provides a method for efficiently editing the sheep SOCS2 gene, the method comprising any one of method (a), method (b) and method (c);

[0018] The method (a) comprises the following steps: introducing a biological material expressing sgRNA-S1 and a biological material expressing a fusion protein into sheep cells to edit the sheep SOCS2 gene; the biological material comprises a recombinant expression vector or an expression cassette;

[0019] The method (b) comprises the following steps: introducing sgRNA-S1 and the fusion protein into sheep cells to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into sheep cells to edit the sheep SOCS2 gene;

[0020] The method (c) comprises the following steps: introducing sgRNA-S1 and the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into a sheep embryo to edit the sheep SOCS2 gene;

[0021] The fusion protein consists of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal; the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.5.

[0022] Preferably, in the method (b) and the method (c), the mass ratio of the sgRNA-S1 to the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal is 1:2, and the mass ratio of the sgRNA-S1 to the mRNA expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal is 1:2.

[0023] The present invention discloses the following technical effects:

[0024] 1. The sgRNA-S1 cytosine base editing of the SOCS2 gene of sheep fibroblasts provided by the present invention has an efficiency of up to 85%. The recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and the CBE vector were co-transfected into sheep fibroblasts. After 1 week of puromycin screening, monoclones were selected. It was found that the monoclonal cell lines with edited target sites accounted for 85% of the total detected cell lines, that is, the editing efficiency was 85%, which greatly improved the editing efficiency.

[0025] 2. Using the sgRNA-S1 cytosine base editing embryos provided by the present invention, SOCS2 gene-edited sheep with increased weight were obtained, and the editing efficiency was as high as 80%. The editing efficiency of edited sheep prepared using sgRNA-S1 was as high as 80%, and the weight of edited sheep was higher than that of wild-type sheep, which is of great significance for reducing the preparation cost of SOCS2 gene-edited sheep and quickly cultivating new germplasm of fast-growing meat sheep.

[0026] 3. The present invention can also be used to study the function of sheep SOCS2 gene.

[0027] In summary, the present invention uses cytosine base editing to produce a C to T mutation in the second exon of the SOCS2 gene, introduces a stop codon, terminates the SOCS2 protein translation prematurely, achieves efficient knockout of the SOCS2 gene, creates SOCS2 gene base-edited sheep, provides technical support for the creation of new germplasm of fast-growing meat sheep, and provides a new approach for the creation of new sheep breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 The sequencing peak diagram of the SOCS2 gene editing type in the monoclonal cell line; the bases indicated by the arrows represent the edited bases; SOCS2 - / - Represents a cell line homozygous for editing of the SOCS2 gene; SOCS2 + / - Represents a cell line heterozygous for editing of the SOCS2 gene; SOCS2 + / + represents the wild-type cell line of SOCS2 gene;

[0030] Figure 2 This is the sequencing peak diagram of the editing type of the SOCS2 gene-edited lamb born; the bases indicated by the arrows represent the edited bases; SOCS2 - / - Hu sheep with homozygous editing of SOCS2 gene; SOCS2 + / - Hu sheep with heterozygous editing of SOCS2 gene; SOCS2 + / + represents wild-type Hu sheep with SOCS2 gene;

[0031] Figure 3 The results of the detection of SOCS2 protein expression levels in the gluteal muscle of Hu sheep with different editing types of SOCS2 gene; WT represents the gluteal muscle sample of Hu sheep with wild-type SOCS2 gene; SOCS2 - / - and SOCS2 + / - Represents the gluteal muscle samples of SOCS2 homozygous and heterozygous edited Hu sheep, respectively;

[0032] Figure 4 Comparison of growth performance between the SOCS2 gene-edited Hu sheep group and the control Hu sheep group. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Example 1 Preparation of sgRNA-S1 and mRNA in the CBE system for editing the SOCS2 gene in sheep cells and embryos

[0039] 1. Construction of sgRNA expression vector

[0040] The sheep SOCS2 gene (Gene ID: 101115017) sequence was used as the target sequence to design the oligonucleotide DNA sequence and send it to a commercial primer synthesis company for synthesis (about 1OD per synthesis, and PAGE was selected as the purification method). The specific sequence is as follows:

[0041] Sg-S1 F: accgAGAGCCAGTGGGGGACCGCG, SEQ ID NO.1;

[0042] Sg-S1 R: aaacCGCGGTCCCCCACTGGCTCT, SEQ ID NO.2;

[0043] The above two oligo DNAs were dissolved in ultrapure water, mixed and annealed to form a double-stranded DNA fragment sg-S1-F / R with a sticky end of the BsaI restriction site;

[0044] The double-stranded DNA fragment sg-S1-F / R and the pGL3-U6-sgRNA-PGK-puromycin (provided by Addgene) linear plasmid after BsaI digestion were ligated and transformed to obtain the recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1, and the inserted fragment was fused with the fragment on the vector to express sgRNA-S1.

[0045] 2. In vitro transcription of sgRNA-S1 and mRNA in CBE system

[0046] Using the recombinant vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 as a template, the primer sg-S1-TF (sequence: TAATACGACTCACTATAGAGAGCCAGTGGGGGACCGCG, SEQ ID NO.3) with a T7 promoter at the 5' end and the sgRNA-R primer (sequence: AAAAGCACCGACTCGGTGCCA, SEQ ID NO.4) were designed and synthesized for PCR amplification and gel recovery and purification to obtain the sgRNA-S1 in vitro transcription template containing the T7 promoter; 200 ng of the recovered in vitro transcription template was taken and transcribed according to the in vitro transcription kit (Ambion, MEGAshortscript TM T7 Transcription Kit) instructions to perform in vitro transcription of sgRNA-S1 to obtain sgRNA-S1. The nucleotide sequence of sgRNA-S1 is: 5'- agagccagugggggaccgcg guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3' (SEQ ID NO.5), and its target sequence is: 5'-agagccagtgggggaccgcg-3' (SEQ ID NO.6), and the target sequence is the sequence of 1938-1957 nt of sheep SOCS2 gene (Gene ID: 101115017). The nucleotide sequence of the DNA encoding the sgRNA is shown in SEQ ID NO.7, specifically: 5'- agagccagtgggggaccgcg gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3'. The underlined sequence is the target fragment recognized by the above sg-S1, which is the sequence of 1938-1957 nt of the sheep SOCS2 gene (Gene ID: 101115017).

[0047] Using the AncBE4max (provided by addgene) plasmid as a template, the primers AncBE4max-F (sequence: 5'-TAATACGACTCACTATAGGGAGAG-3', SEQ ID NO.8) and AncBE4max-R (sequence: 5'-CGGTTAGACTTTCCTCTTCTT-3', SEQ ID NO.9) containing a T7 promoter at the 5' end were designed and synthesized for PCR amplification and gel recovery and purification to obtain an in vitro transcription template of the multi-gene fusion of Cas9, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal in AncBE4max; 1000 ng of the recovered and purified in vitro transcription template was taken and PCR amplification was performed according to the in vitro transcription kit (Ambion, mMESSAGEmMACHINE TM In vitro transcription was performed according to the instructions of the T7 ULTRA Transcription Kit to obtain mRNA of the multi-gene fusion of Cas9, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal in the AncBE4max plasmid.

[0048] Example 2 Application of sgRNA-S1 in editing the SOCS2 gene of sheep fibroblast cell line

[0049] 1. Sheep Fibroblast Transfection

[0050] The sgRNA-S1 expression vector pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and AncBE4max plasmid were co-transfected into sheep fibroblasts by electrofection. The electrotransfected cells were inoculated into a 6-well cell culture plate. The medium was changed after 6 hours. When the cell density reached about 80%, puromycin was added for drug screening. After 3 days of drug screening, the cells were digested with trypsin, some of them were collected to extract DNA, and the remaining cells continued to be screened.

[0051] 2. DNA extraction and PCR detection of fibroblasts after transfection

[0052] DNA was extracted from some cells obtained in step 1 using the traditional phenol / chloroform method. PCR was performed using primers (SOCS2-F: GTAACTGGATGCTCGGGGTT, SEQ ID NO.10; SOCS2-R: GGAGTCCCTCAGGAACCACT, SEQ ID NO.11) to amplify a partial region (1523-2203nt) of the SOCS2 gene (Gene ID: 101115017) in sheep fibroblasts, with an expected amplification length of 681bp. The PCR amplified bands were cut and recovered and subjected to Sanger sequencing. The results showed that pGL3-U6-sgRNA-PGK-puromycin-sg-S1 and AncBE4max could achieve base editing of the sheep SOCS2 gene in sheep fibroblasts.

[0053] 3. Monoclonal cell line screening

[0054] The mixed cell population identified as editing-positive in step 2 was further screened with puromycin for 4 days, and digested and counted after the screening. 100 cells / well were evenly inoculated into a 6-well cell culture plate. After growing into clones, monoclonal cell clusters were separated by cloning ring trypsin digestion and transferred to a 96-well cell culture plate. When the cell confluence reached about 90%, they were gradually transferred to 48-well and 12-well cell culture plates for expansion culture until they were transferred to a 6-well cell culture plate that was full of growth. A portion of the cells was frozen and a small portion of the cells was used for DNA extraction and identification of the editing type.

[0055] 4. Identification of editing types in monoclonal cell lines

[0056] The DNA of the monoclonal cell cluster was extracted using the method in step 2, and PCR amplification was performed using the above-mentioned SOCS2-F and SOCS2-R primer pairs to identify the editing type of the monoclonal cell cluster. A total of 20 monoclonal cell lines were obtained, and it was found that 4 were SOCS2 gene homozygous edited cell lines, 13 were SOCS2 gene heterozygous edited cell lines, and the other 3 were not edited ( Figure 1 ), with an editing efficiency of 85%, of which the homozygous editing efficiency was 20%.

[0057] Example 3 Application of sgRNA-S1 in editing the SOCS2 gene of Hu sheep

[0058] 1. Superovulation and microinjection of Hu sheep

[0059] Superovulation and estrus synchronization were performed according to the method of Guo et al. (Guo et al., 2023), and three donor ewes were subjected to oviduct surgery. The fertilized eggs were injected with sgRNA-S1 (SEQ ID NO.5) and a mixture of Cas9, cytosine deaminase, uracil glycosidase inhibitor and nuclear entry signal multi-gene fusion mRNA in AncBE4max (the final concentration of each substance in the mixed system was 50ng / μL sgRNA-S1 and 100ng / μL AncBE4max mRNA (i.e., Cas9, cytosine deaminase, uracil glycosidase inhibitor and nuclear entry signal multi-gene fusion mRNA in AncBE4max)), and the amount of the mixture injected into each embryo was about 5pL. After the injection, the embryos were cultured in G-1plus medium for 1h, and 26 well-developed embryos were selected and transplanted into the oviducts of 6 recipient ewes in estrus synchronization. The lambs born were identified 5 months later.

[0060] 2. Genome extraction of newborn lambs

[0061] Four recipient ewes were successfully pregnant and gave birth to five lambs. Ear tissues were obtained from the lambs two weeks after birth and DNA was extracted using the conventional phenol / chloroform method.

[0062] 3. PCR testing

[0063] Using DNA from five lambs as templates, PCR reactions were performed using primers for detecting monoclonal cell lines of sheep fibroblasts (SOCS2-F and SOCS2-R primers) to identify the editing efficiency of the target site.

[0064] Sequencing of PCR amplification products revealed that 4 of the 5 lambs were edited at the target site, and 1 was not edited, with an editing efficiency of 80%. Among the 4 edited lambs, 1 had heterozygous editing, and 3 had homozygous editing at the target site ( Figure 2 ).

[0065] 4. Detection of protein expression in SOCS2 gene-edited sheep

[0066] In order to study the protein expression of SOCS2 gene-edited Hu sheep, the hind gluteal muscle tissues of SOCS2 gene-edited Hu sheep and wild-type Hu sheep were collected by surgery and identified by western blotting. The results are as follows: Figure 3 The results show that SOCS2 - / - The SOCS2 protein of Hu sheep was knocked out. + / - The expression level of SOCS2 protein in Hu sheep is reduced.

[0067] 5. Body weight analysis of SOCS2 gene-edited sheep

[0068] In order to analyze the weight of SOCS2 gene-edited sheep, the birth weight, 2-month-old, 4-month-old and 6-month-old weights of all SOCS2 gene-edited Hu sheep (recorded as SOCS2 gene-edited Hu sheep group) and wild-type Hu sheep (recorded as control Hu sheep group) were statistically analyzed. The results are as follows: Figure 4 The results showed that the birth weight, 2-month-old, 4-month-old and 6-month-old weights of SOCS2 gene-edited sheep were higher than those of wild-type sheep.

[0069] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An sgRNA-S1 for efficiently editing the sheep SOCS2 gene, characterized in that: The nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.

5.

2. The DNA encoding the sgRNA1-S1 according to claim 1, characterized in that The DNA and nucleotide sequence are shown as SEQ ID NO.

7.

3. A biological material containing the DNA according to claim 2.

4. The biomaterial according to claim 3, characterized in that The biological material includes a recombinant expression vector or an expression cassette.

5. A composition for efficiently editing the sheep SOCS2 gene, characterized in that: The composition comprises an sgRNA-S1 system and a CBE system, wherein the sgRNA system comprises the sgRNA-S1 according to claim 1 or the biomaterial according to claim 3, and the CBE system comprises a fusion protein consisting of a Cas9 protein, a cytosine deaminase, a uracil glycosidase inhibitor and a nuclear import signal, a biomaterial expressing a fusion protein of the Cas9 protein, the cytosine deaminase, the uracil glycosidase inhibitor and the nuclear import signal, or an mRNA expressing a fusion protein of the Cas9 protein, the cytosine deaminase, the uracil glycosidase inhibitor and the nuclear import signal; and the biomaterial comprises a recombinant expression vector or an expression cassette.

6. Use of the sgRNA-S1 according to claim 1, the DNA according to claim 2, the biological material according to claim 3 or the composition according to claim 5 in any of the following: (1) Preparation of products for sheep SOCS2 gene editing; (2) Preparation of SOCS2 gene-edited sheep; (3) Molecular breeding of sheep.

7. A method for efficiently editing the sheep SOCS2 gene, characterized in that: The method comprises any one of method (a), method (b) and method (c); The method (a) comprises the following steps: introducing a biological material expressing sgRNA-S1 and a biological material expressing a fusion protein into sheep cells to edit the sheep SOCS2 gene; the biological material comprises a recombinant expression vector or an expression cassette; The method (b) comprises the following steps: introducing sgRNA-S1 and the fusion protein into sheep cells to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into sheep cells to edit the sheep SOCS2 gene; The method (c) comprises the following steps: introducing sgRNA-S1 and the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; or, introducing sgRNA-S1 and mRNA expressing the fusion protein into a sheep embryo to edit the sheep SOCS2 gene; The fusion protein consists of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal; the nucleotide sequence of the sgRNA-S1 is shown in SEQ ID NO.

5.

8. The method according to claim 7, characterized in that In the method (b) and the method (c), the mass ratio of the sgRNA-S1 to the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal is 1:2, and the mass ratio of the sgRNA-S1 to the mRNA expressing the fusion protein of Cas9 protein, cytosine deaminase, uracil glycosidase inhibitor and nuclear import signal is 1:2.

Images