Nucleic acid aptamer specifically binding to GBX2 protein and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer specifically binding to GBX2 protein and application of the nucleic acid aptamer, and relates to the technical field of biology. A random single-stranded DNA library and a corresponding primer are designed and synthesized on the basis of an SELEX (systematic evolution of ligands by exponential enrichment) technology, a nucleic acid aptamer which is small in molecular weight, stable in chemical property, easy to store and mark and capable of being combined with GBX2 protein with high affinity is obtained through screening by improving screening conditions, the nucleic acid aptamer is named as GBX2-08, and a nucleotide sequence of the GBX2-08 is shown as SEQ ID NO.1. The nucleic acid aptamer can be used in the aspects of detection, diagnosis, imaging, treatment and the like, such as purification or high-sensitivity detection of the GBX2 protein, preparation of drugs targeting the GBX2 protein, preparation of reagents or drugs for diagnosing or treating abnormal expression of the GBX2 and the like, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer specifically binding to GBX2 protein and an application thereof. Background Art

[0002] Gastrulation brain homeobox 2 (GBX2) is a member of the homeobox gene family. It encodes a helix-turn-helix structure, is part of chromatin, is active in the cell nucleus, and can serve as a transcription factor for cell pluripotency and differentiation in the embryo. It is composed of 348 amino acids.

[0003] GBX2 is a transcription factor with sequence-specific double-stranded DNA binding activity, which regulates gene transcription and participates in the regulation of nervous system development and transcriptional regulation of RNA polymerase II. During the development of an organism, the expression of GBX2 protein shows a specific temporal pattern and acts upstream or within multiple processes. In the early stages of embryonic development, GBX2 protein plays an important role in the formation of the midbrain and hindbrain, and is involved in regulating the differentiation of the neural plate and the formation of the neural tube. During the development of the nervous system, GBX2 protein can regulate the proliferation, differentiation and migration of neural precursor cells, which is essential for the normal development of the brain and spinal cord.

[0004] Studies have found that GBX2 protein plays an important role in the occurrence and development of some cancers. For example, GBX2 is continuously overexpressed in prostate cancer cell lines (TSU-pr1, PC3, DU145 and LNCaP), and downregulating GBX2 expression inhibits the cloning ability of prostate cancer cells. In addition, GBX2 promotes the proliferation of prostate cancer cells through the IL-6 / JAK / STAT3 signaling pathway by upregulating the expression of IL-6. At the same time, GBX2 may promote the proliferation of lung cancer cells by regulating the AKT / ERK signaling pathway. AKT and ERK are important signal transduction molecules in cells, which are involved in regulating cell growth, survival and proliferation. The expression of GBX2 may enhance the phosphorylation levels of AKT and ERK, thereby activating these signaling pathways and enabling lung cancer cells to acquire stronger proliferation ability.

[0005] Aptamers are DNA or RNA molecules separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells with high affinity and specificity, thus showing broad application prospects. Compared with antibodies, aptamers have advantages such as small molecular weight, high stability, easy modification, non-immunogenicity, and artificial synthesis, eliminating a series of processes such as animal immunization, protein extraction, and purification. Therefore, if aptamers with high affinity and high specificity for GBX2 protein can be found, it will help to achieve high-sensitivity and high-specificity detection of GBX2 protein, and help the development of drugs targeting GBX2 protein. Summary of the invention

[0006] The purpose of the present invention is to provide a nucleic acid aptamer that specifically binds to GBX2 protein. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to GBX2 protein with high affinity and high specificity, is obtained. The aptamer can be used in detection, diagnosis, imaging and treatment, and has broad application prospects.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0008] The first object of the present invention is to provide a nucleic acid aptamer that specifically binds to GBX2 protein, and the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.

[0009] The second object of the present invention is to provide a conjugate of a nucleic acid aptamer that specifically binds to a GBX2 protein, wherein the conjugate of the nucleic acid aptamer is obtained by linking a labeling substance to the nucleotide sequence of the nucleic acid aptamer that specifically binds to a GBX2 protein as described above.

[0010] As a further optimization scheme of the present invention, the labeling substance includes at least one of a radioactive substance, a therapeutic substance, a biotin label, an enzyme label, a fluorescein label, a nucleic acid probe, a nanoluminescent material, a small peptide or a siRNA, so that the nucleic acid aptamer sequence obtained after modification has desirable properties, for example, it can have an affinity for binding to GBX2 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0011] In other words, the above aptamers, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to the GBX2 protein.

[0012] The third object of the present invention is to provide a method for screening nucleic acid aptamers that specifically bind to GBX2 protein, comprising the following steps:

[0013] (1) synthesizing a random single-stranded DNA library and providing primers, wherein the sequence of the random single-stranded DNA library is "TTCAGCACTCCACGCATAGC-36N-CCTATGCGTGCTACCGTGAA", wherein "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases;

[0014] (2) Microplate screening: first, the target protein GBX2 and the anti-screening protein are coupled to the microplate and then blocked. Then, the random single-stranded DNA library is dissolved, renatured, and added to the blocked microplate coupled with the anti-screening protein for anti-screening to obtain the anti-screening supernatant. Then, the random single-stranded DNA library after anti-screening is added to the blocked microplate coupled with the target protein GBX2 for positive screening to obtain the positive screening supernatant. Then, the nucleic acid molecule in the positive screening supernatant is used as a template, "FAM-TTCAGCACTCCACGCATAGC" is used as the forward primer, and "Biotin-TTCACGGTAGCACGCATAGG" is used as the reverse primer to perform PCR amplification to obtain the amplified product. The amplified product is purified and used to prepare the secondary library for the next round of screening.

[0015] (3) Repeat step (2) for at least 6 rounds of screening, and add additional serum from the fifth round of screening to the microplate coupled with the target protein GBX2 and the counter-screening protein for blocking, and obtain the enriched library product after the screening is completed;

[0016] (4) The enriched library products are subjected to high-throughput sequencing analysis and the affinity with the target protein GBX2 is detected to obtain the nucleic acid aptamer that specifically binds to the GBX2 protein.

[0017] As a further optimization scheme of the present invention, in step (2), the specific process of adding serum is as follows: in the fifth round of screening, an additional 2% volume ratio of serum is added for blocking; in the sixth round of screening, an additional 5% volume ratio of serum is added for blocking, and the serum is human serum.

[0018] The method for screening nucleic acid aptamers that specifically bind to GBX2 protein provided by the present invention is based on the SELEX screening method. In the step of microplate screening, serum is added from the 5th round for blocking and the serum concentration is increased round by round to further improve the specificity and stability of nucleic acid aptamers. The conventional conditions for nucleic acid aptamer screening are carried out in an ion buffer, and a certain concentration of serum is gradually added under the screening conditions. On the one hand, because the serum contains rich proteins, it can compete with the proteins on the surface of the microplate to bind to the library, thereby removing those sequences that have weak binding ability to the target GBX2 protein or are only adsorbed. On the other hand, nucleic acid aptamers bind to the target protein in a serum environment, which can better meet the actual detection environment of applications developed based on nucleic acid aptamers in the later stage. Studies have shown that in the last few rounds of screening, using a higher concentration of serum can screen nucleic acid aptamers with higher affinity and better specificity.

[0019] As a further optimization scheme of the present invention, the screening method also includes using real-time fluorescence quantitative PCR to monitor the screening process. The specific steps are: using the nucleic acid molecules in the reverse screening supernatant and the positive screening supernatant obtained in each round of screening as templates, using "TTCAGCACTCCACGCATAGC" as a forward primer and "TTCACGGTAGCACGCATAGG" as a reverse primer, performing real-time fluorescence quantitative PCR analysis to obtain q-PCR results, and using the Cq value of the q-PCR results to calculate the retention rate of the nucleic acid molecules after each round of screening. If the retention rate exceeds 1%, it is determined that the screening process can be terminated.

[0020] The fourth object of the present invention is to provide a product for detecting GBX2 protein, comprising the nucleic acid aptamer as described above or a conjugate of any of the nucleic acid aptamers as described above.

[0021] As a further optimization scheme of the present invention, the product includes one or more of a kit, a detection chip or a chromatography detection device.

[0022] The fifth object of the present invention is to provide a use of the nucleic acid aptamer as described above or the conjugate of any of the nucleic acid aptamers as described above in any of the following items:

[0023] (1) Quantitative or qualitative detection of GBX2 protein;

[0024] (2) Purification of GBX2 protein;

[0025] (3) Imaging of GBX2 protein;

[0026] (4) as an inhibitor of GBX2 protein;

[0027] (5) preparing drugs targeting GBX2 protein;

[0028] (6) Prepare drugs for diagnosing or treating abnormal GBX2 protein expression.

[0029] The present invention has the following beneficial effects:

[0030] The present invention designs and synthesizes a random single-stranded DNA library and corresponding primers based on SELEX technology, and obtains a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind GBX2 protein with high affinity, named GBX2-08 by improving the screening conditions. The nucleic acid aptamer can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity detection of GBX2 protein, preparation of drugs targeting GBX2 protein, preparation of reagents or drugs for diagnosis or treatment of abnormal GBX2 expression, etc., and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The standard curve (A) with Cq value as the horizontal axis and Log initial concentration as the vertical axis drawn by real-time fluorescence quantitative PCR (q-PCR) in Example 1 and the molecular retention rate after positive and negative screening in each round of screening calculated by the standard curve (B);

[0032] Figure 2 This is a schematic diagram of the affinity test results between the nucleic acid aptamer GBX2-08 and the GBX2 protein in Example 2;

[0033] Figure 3 This is a schematic diagram of the specificity research results of the nucleic acid aptamer GBX2-08 in Example 3;

[0034] Figure 4 , Figure 5 , Figure 6 This is a schematic diagram of the results of the dot hybridization experiment using the nucleic acid aptamer GBX2-08 to detect GBX2 protein in Example 4. DETAILED DESCRIPTION

[0035] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0036] In the following examples, if no specific experimental methods are specified, all experimental methods can be carried out according to conventional methods. The materials and reagents used can be obtained through commercial channels unless otherwise specified.

[0037] Example 1 Screening of ssDNA nucleic acid aptamers that specifically bind to GBX2 protein

[0038] The method for screening a ssDNA nucleic acid aptamer that specifically binds to the GBX2 protein in this embodiment comprises the following steps:

[0039] 1. Synthesize random single-stranded DNA library and primers

[0040] The sequence of the random single-stranded DNA library (Lib13) is: 5'-TTCAGCACTCCACGCATAGC-36N-CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 2), in which "36N" represents a sequence formed by connecting 36 random nucleotide bases. The library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0041] The primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0042] Table 1. Primers and their sequence information

[0043]

[0044] In the table, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0045] 2. Microplate screening

[0046] The microplate method was used for screening, and a total of 6 rounds of screening were conducted. The screening process for each round is shown in Table 2:

[0047] Table 2. Screening process of GBX2 protein aptamers

[0048]

[0049] The specific screening process for each round is as follows:

[0050] 1) Coupling of target protein (GBX2) and anti-screening protein (His peptide)

[0051] A polystyrene 96-well ELISA microplate (Belanbo Biotechnology (Hangzhou) Co., Ltd., catalog number: PT06-96S) was used as a carrier to couple the target protein to its surface. The specific steps were as follows: 5 μL of GBX2 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., P03034PA, concentration of 1 mg / mL) was taken, 95 μL of 100 mM sodium phosphate buffer at pH 8.5 was added and mixed, and the mixed GBX2 protein was added dropwise to the 96-well ELISA microplate, incubated overnight at 4°C, and recorded as GBX2-Plate.

[0052] Similarly, a polystyrene 96-well ELISA microplate was used to immobilize the His peptide, which was synthesized by Nanjing GenScript Biotechnology Co., Ltd. and consisted of 9 consecutive histidines. The steps for coupling the His protein were the same as those for coupling the GBX2 protein, and the concentration of the His peptide was 1 mg / mL. The specific steps were as follows: 10 μL of the His peptide was taken, 90 μL of 100 mM sodium phosphate buffer at pH 8.5 was added, and the mixed His peptide was added dropwise to the 96-well ELISA microplate, and incubated overnight at 4°C, which was recorded as His-Plate.

[0053] 2) Screening

[0054] ① Library dissolution and denaturation treatment: Take 1OD of random single-stranded nucleotide library, centrifuge at 14000rpm for 5min, centrifuge the library to the bottom of the tube, dissolve it to 10μM with DPBS buffer, mix well and dispense it into PCR tubes for denaturation treatment. The treatment process is as follows: Set the PCR instrument program to 95℃ for 10min. The purpose of this step is to unwind the folded chain, then keep it at 4℃ for 5min, and then balance it to room temperature.

[0055] ② Microplate blocking: Remove the supernatant from the His-Plate, wash the microplate twice with 120μL DPBS-T (containing 0.02% volume ratio of Tween 20), and tap it clean. Add 100μL BSA with a final concentration of 1mg / mL and keep it at room temperature to block the microplate for 1h. After blocking, remove the supernatant, wash the microplate twice with 120μL DPBS-T, and tap it clean. The blocking operation of GBX2-Plate is the same as above.

[0056] ③ Counter-screening: Add the processed library to the blocked His-Plate, mix well and incubate on a horizontal shaker at room temperature for 1 hour. Collect the supernatant and mark it as Pool-. Wash the microplate 4 times with 200μL DPBS buffer, and finally add 100μL ultrapure water to the washed microplate, boil it in a boiling water bath for 10 minutes, collect the supernatant (i.e., the counter-screening supernatant), and mark it as Elution-His.

[0057] ④ Positive screening: Add the library Pool- after the reverse screening to the blocked GBX2-Plate, mix well and incubate on a horizontal shaker at room temperature for 1 hour. Aspirate the supernatant and wash the microplate 4 times with 200μL DPBS buffer. Finally, add 100μL ultrapure water to the washed microplate, boil it in a boiling water bath for 10 minutes, collect the supernatant (i.e., the positive screening supernatant), and mark it as Elution-GBX2.

[0058] ⑤PCR: Using the nucleic acid molecules in Elution-GBX2 as templates, amplify using ordinary PCR. The method is as follows: add all template Elution-GBX2 to 900μL PCR mix premix and mix well, divide the template and PCR mix premix into 100μL / tube and add them to the PCR tube. The amplification conditions are as follows: 95℃ pre-denaturation for 3min, 95℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, a total of 25 cycles, and store at 4℃. The PCR raw materials are prepared with dNTPs (P031-02) purchased from Novozymes and rtaq enzyme (R500Z) purchased from Bao Bio, and the formula is shown in Table 3.

[0059] Table 3. PCR mix premix formula

[0060]

[0061]

[0062] ⑦ Preparation of secondary library: The amplified product was purified using commercially purchased Tiandirenhe streptavidin (SA) magnetic beads (SM017100) to prepare the secondary library for the next round of screening. The preparation process of the secondary library for the next round of screening is as follows: add 1 / 5 volume of 4M sodium chloride to 1mL of PCR product, then add 80μL of SA magnetic beads that have been washed with DPBS and the supernatant removed, incubate on a shaker at room temperature for 30min, and remove the supernatant of the PCR product. Then use DPBS-T to wash the magnetic beads 3 times, add 100μL of 40mM sodium hydroxide solution after removing the supernatant, incubate for 3min, and remove the magnetic beads by magnetic absorption. Then add 4μL of 1M hydrochloric acid to the supernatant to neutralize the single strand, and then add 104μL of 2*DPBS to dilute and neutralize the salt concentration, and finally obtain 208μL of the secondary library dissolved in 1*DPBS, which can be used as the library for the next round of screening.

[0063] 3. Real-time fluorescence quantitative PCR (q-PCR) monitoring of screening process

[0064] 1) q-PCR: Using the nucleic acid molecules in Elution-His and Elution-GBX2 as templates, q-PCR was used to monitor the screening process. The method is as follows: 2 μL of Elution-His and Elution-GBX2 were added to 18 μL of q-PCR mix premix and mixed. The amplification conditions are as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; the melting curve determination conditions are as follows: 95℃ for 10 s, 37℃ for 10 s, 95℃ for 10 s, and finally 37℃ cooling for 30 s. The formula of q-PCR mix premix is ​​shown in Table 4.

[0065] Table 4. q-PCR mix premix formula

[0066]

[0067] 2) Retention rate calculation: The Cq value in the q-PCR result can reflect the number of nucleic acid molecules in the sample from the side. The smaller the Cq value, the more molecules there are in the sample. The Lib13 library is used as a standard and a gradient dilution is performed at 5 concentrations (10000pM, 1000pM, 100pM, 10pM, 1pM) for q-PCR. The Cq value obtained at each concentration is used as the horizontal axis, and the logarithm of the initial concentration (pM) of the sample (Log initial concentration) is used as the vertical axis to obtain a standard curve, as shown in the figure below: Figure 1 As shown in A, the equation of the standard curve is:

[0068] Y=-0.2107X+5.0351,R 2 =0.9995;

[0069] The Cq value obtained by q-PCR of Elution-His and Elution-GBX2 in each round of screening was taken as X, and further substituted into the standard curve to obtain the logarithmic value of the elution sample concentration, which was recorded as Y. The elution volume was 100 μL each time, so the amount of substance in each round of eluate was calculated according to the following formula:

[0070] n 洗脱 =C 洗脱浓度 ×V 洗脱体积 =10 Y ×100;

[0071] The initial input concentration of each round of screening library is C 投入浓度 (nM), input volume is V 投入体积 (μL), so the amount of material input in each round is calculated according to the following formula:

[0072] n 投入 =C 投入浓度 ×V 投入体积 ×10 3 ;

[0073] Therefore, the retention rate after each round of screening is calculated according to the following formula:

[0074] Retention rate = n 洗脱 / n 投入 ×100%={10 Y / (C 投入浓度 ×V 投入体积 ×10)}×100%;

[0075] like Figure 1As shown in B, by calculating the retention rate of molecules in each round, it is shown that the retention rate of the positive screen gradually increases, and in the sixth round the retention rate exceeds 1%, indicating that the library is effectively enriched. Therefore, it is judged that the screening can be terminated and library construction and sequencing can be carried out.

[0076] 3) Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewise Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.

[0077] In subsequent tests, a sequence was identified as having strong binding ability, a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1, and it was named GBX2-08.

[0078] Example 2 Surface Plasmon Resonance (SPR) Detection of the Affinity of GBX2 Protein Aptamer GBX2-08 and GBX2 Protein

[0079] Suzhou Genewise Biotech Co., Ltd. was commissioned to synthesize the nucleic acid aptamer GBX2-08 (SEQ ID NO.1), which was diluted with DPBS buffer to 15.63nM, 31.25nM, 62.5nM, 125nM, 250nM, and 500nM for standby use. Then, the affinity of the GBX2 protein nucleic acid aptamer GBX2-08 to the GBX2 protein was detected by surface plasmon resonance (SPR). The specific process is as follows:

[0080] 1. GBX2 protein was coupled to the second channel on the surface of CM5 chip (purchased from Cytiva, catalog number: 29104988). The specific method was as follows: Equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) were mixed and injected with 50 μL to activate the chip at a flow rate of 5 μL / min. GBX2 protein was diluted with 10 mM sodium acetate at pH 5.5 to a final concentration of 50 μg / mL and then injected with an injection volume of 50 μL and a flow rate of 5 μL / min. The amount of GBX2 protein coupled was 3900.3Ru. After the injection was completed, ethanolamine was injected to block the chip at a flow rate of 10 μL / min and 100 μL was injected. Channel 1 was treated as above, and the steps of coupling His small peptide, activation and blocking were exactly the same, as the control channel.

[0081] 2. Detection: Surface plasmon resonance (GE Healthcare, model: Biacore 8K) was used to set the detection parameters. The diluted GBX2-08 aptamer sample was passed through channels 1 and 2 in sequence. The procedure for each aptamer was as follows: injection 30 μL / min, time 2 min, dissociation 30 μL / min, time 2 min, regeneration 1.5 M NaCl 30 μL / min, time 30 s. The affinity detection data of nucleic acid aptamer GBX2-08 and GBX2 protein are shown in Figure 2 , the KD values ​​are shown in Table 5 below.

[0082] Table 5. Affinity of nucleic acid aptamers to GBX2 protein

[0083]

[0084] Example 3 Study on the specificity of nucleic acid aptamer GBX2-08

[0085] In this embodiment, MSL3 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., item number: P03574PA), ZNF653 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., item number: P03733PA), and RFWD3 protein (purchased from Suzhou Younuozhen Biotechnology Co., Ltd., item number: P65831PC) were used to replace GBX2 protein. The method of fixing GBX2 protein to CM5 chip for testing was the same as that in Example 2. MSL3 protein, ZNF653 protein, and RFWD3 protein were coupled to the second channel of four Channals on the surface of CM5 chip, and the coupling amounts were 2474.2RU, 6325.8RU, and 5487.3RU, respectively. The diluted GBX2-08 nucleic acid aptamer was injected in sequence.

[0086] The affinity test data of nucleic acid aptamer GBX2-08 and MSL3 protein, ZNF653 protein and RFWD3 protein are shown in Figure 3 .Depend on Figure 3 It can be seen that the nucleic acid aptamer GBX2-08 cannot bind to the MSL3 protein, the ZNF653 protein, and the RFWD3 protein, which shows that the nucleic acid aptamer GBX2-08 has very good specificity.

[0087] Example 4 Detection of GBX2 protein by dot blot hybridization based on nucleic acid aptamer GBX2-08

[0088] The dot hybridization experiment steps performed in this example are as follows:

[0089] 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), dilute GBX2 protein, control protein His peptide, BSA protein (purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number: A600332), IL-6 protein (purchased from Aibosheng (Beijing) Science and Technology Co., Ltd., catalog number: PP-496) with DPBS to 0.5mg / mL, spot 2μL of each sample on the nitrocellulose membrane, and air dry for 30min. At the same time, dilute GBX2 protein with DPBS to 0.5mg / mL, 0.25mg / mL, 0.125mg / mL, 0.0625mg / mL, 0.03125mg / mL, spot 2μL of each sample on the nitrocellulose membrane, and air dry for 30min.

[0090] 2. After drying, block with 1% human serum (normal human serum, purchased from Beijing Solebow Technology Co., Ltd., item number: SL010) at room temperature for 1 h. After blocking, wash with DPBS-T for 3 times and aspirate clean.

[0091] 3. Suzhou Genewiz Biotech Co., Ltd. was commissioned to synthesize the biotin-modified GBX2-08 nucleic acid aptamer. The biotin-modified GBX2-08 nucleic acid aptamer was used to 2+ The diluted aptamer was diluted to 200 nM with DPBS, and then the diluted aptamer was incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30 min.

[0092] 4. After incubation, use 5mM Mg 2+ Wash three times with DPBS-T on a shaker for 5 min each time.

[0093] 5. Add 5 mM Mg 2+ HRP-Streptavidin (purchased from Biotime, catalog number A0303) was diluted 1:2000 in DPBS-T and incubated on a shaker at room temperature for 30 minutes.

[0094] 6. Contains 5mM Mg 2+ The cells were washed three times with DPBS-T on a shaker for 2 min each time.

[0095] 7. Add color developing solution (BeyoECL Star ultra-sensitive ECL chemiluminescence kit, purchased from Beyotime, item number P0018A, solution A and solution B are the solutions provided by the kit) at a ratio of solution A: solution B = 1:1 (v / v), and develop the color for 5 minutes at room temperature in the dark.

[0096] 8. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life SciencesTM LAS 4000 digital imaging system.

[0097] The results are as follows Figure 4 As shown, 1 is GBX2 protein, 2 is His small peptide, 3 is BSA protein, 4 is IL-6 protein, and 5 is DPBS; compared with the spots of the control proteins His small peptide, BSA protein, IL-6 protein, and DPBS, the GBX2 protein has obvious color development, which shows that biotin-modified GBX2-08 can be used for the detection of membrane hybridization GBX2 protein, and does not bind to the control proteins His small peptide, BSA protein, IL-6 protein, and DPBS, and has high specificity.

[0098] The results are as follows Figure 5 As shown, after the GBX2 protein was diluted to 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, and 0.03125 mg / mL, the GBX2 protein showed obvious color, which indicates that biotin-modified GBX2-08 can be used for the detection of membrane hybridization GBX2 protein.

[0099] The results are as follows Figure 6 As shown, the grayscale values ​​of the blots obtained at different concentrations of GBX2 protein were quantified using ImageJ software. The results showed that the concentration of GBX2 protein was linearly related to the grayscale value. As the concentration of GBX2 protein increased, the grayscale value increased. The linear equation is:

[0100] Y=126170X-161761,R 2 =0.9559;

[0101] Detection limit LOD:

[0102] LOD = 3σ / κ;

[0103] Where κ is the slope distance of the linear equation, σ is the standard deviation of the blank signal, and the LOD is 1.18 μg / mL.

[0104] In summary, the GBX2-08 aptamer can detect GBX2 protein at a minimum concentration of 1.18 μg / mL.

[0105] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to GBX2 protein, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.

1.

2. A conjugate of a nucleic acid aptamer that specifically binds to GBX2 protein, characterized in that: The aptamer conjugate is obtained by connecting a labeling substance to the nucleotide sequence of the aptamer that specifically binds to the GBX2 protein as claimed in claim 1.

3. The conjugate of a nucleic acid aptamer that specifically binds to GBX2 protein according to claim 2, characterized in that: The labeling substance includes at least one of a radioactive substance, a therapeutic substance, a biotin label, an enzyme label, a fluorescent label, a nucleic acid probe, a nanoluminescent material, a small peptide or a siRNA.

4. A method for screening a nucleic acid aptamer that specifically binds to GBX2 protein according to claim 1, characterized in that: The following steps are involved: (1) synthesizing a random single-stranded DNA library and providing primers, wherein the sequence of the random single-stranded DNA library is "TTCAGCACTCCACGCATAGC-36N-CCTATGCGTGCTACCGTGAA', wherein "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases; (2) Microplate screening: first, the target protein GBX2 and the anti-screening protein are coupled to the microplate and then blocked. Then, the random single-stranded DNA library is dissolved, renatured, and added to the blocked microplate coupled with the anti-screening protein for anti-screening to obtain the anti-screening supernatant. Then, the random single-stranded DNA library after anti-screening is added to the blocked microplate coupled with the target protein GBX2 for positive screening to obtain the positive screening supernatant. Then, the nucleic acid molecule in the positive screening supernatant is used as a template, "FAM-TTCAGCACTCCACGCATAGC" is used as a forward primer, and "Biotin-TTCACGGTAGCACGCATAGG" is used as a reverse primer to perform PCR amplification to obtain the amplified product. The amplified product is purified and used to prepare the secondary library for the next round of screening. (3) Repeat step (2) for at least 6 rounds of screening, and add additional serum from the fifth round of screening to the microplate coupled with the target protein GBX2 and the counter-screening protein for blocking, and obtain the enriched library product after the screening is completed; (4) The enriched library products are subjected to high-throughput sequencing analysis and the affinity with the target protein GBX2 is detected to obtain the nucleic acid aptamer that specifically binds to the GBX2 protein.

5. The method for screening a nucleic acid aptamer that specifically binds to GBX2 protein according to claim 4, characterized in that: In step (2), the specific process of adding serum is as follows: in the fifth round of screening, an additional 2% volume ratio of serum is added for blocking; in the sixth round of screening, an additional 5% volume ratio of serum is added for blocking, and the serum is human serum.

6. The method for screening a nucleic acid aptamer that specifically binds to GBX2 protein according to claim 4, characterized in that: The screening method also includes using real-time fluorescence quantitative PCR to monitor the screening process, and the specific steps are: using the nucleic acid molecules in the reverse screening supernatant and the positive screening supernatant obtained in each round of screening as templates, using "TTCAGCACTCCACGCATAGC" as a forward primer, and "TTCACGGTAGCACGCATAGG" as a reverse primer, real-time fluorescence quantitative PCR analysis is performed to obtain q-PCR results, and the Cq value in the q-PCR results is used to calculate the retention rate of the nucleic acid molecules after each round of screening. If the retention rate exceeds 1%, it is determined that the screening process can be terminated.

7. A product for detecting GBX2 protein, characterized in that: The method comprises the nucleic acid aptamer according to claim 1 or a conjugate of the nucleic acid aptamer according to any one of claims 2 to 3.

8. A product for detecting GBX2 protein according to claim 7, characterized in that: The product includes one or more of a test kit, a detection chip or a chromatography detection device.

9. Use of the nucleic acid aptamer according to claim 1 or the conjugate of the nucleic acid aptamer according to any one of claims 2 to 3 in any of the following: (1) Quantitative or qualitative detection of GBX2 protein; (2) Purification of GBX2 protein; (3) Imaging of GBX2 protein; (4) as an inhibitor of GBX2 protein; (5) preparing drugs targeting GBX2 protein; (6) Prepare drugs for diagnosing or treating abnormal GBX2 protein expression.

Images