Cloning primers, method and application of Abelmoschus esculentus AeC4H gene

Abstract

The present invention belongs to the field of biotechnology and relates to a pair of cloning primers for the AeC4H gene of okra, a cloning method and its application. The primer pair can efficiently amplify the full-length CDS sequence of the AeC4H gene. The cloning method includes steps such as extracting total RNA from okra tissues, reverse transcription, PCR amplification, product recovery, vector ligation, and positive clone screening. The recombinant expression vector contains the coding sequence of the AeC4H gene and is inserted into the vector through specific restriction enzyme sites. The present invention also provides a method for transforming plants using this vector, as well as a method for increasing the flavonoid content in plants, which is achieved by overexpressing the AeC4H gene. The present invention also provides the application of the AeC4H gene or its encoded protein in regulating the biosynthesis of plant flavonoids. The present invention realizes the overexpression of the AeC4H gene in plants, thereby increasing the flavonoid content in plants, and reveals the application of the AeC4H gene in regulating the biosynthesis of plant flavonoids.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a primer pair for cloning the AeC4H gene of okra, a cloning method thereof, and an application thereof in increasing the flavonoid content of okra and other crops. Background Art

[0002] Okra (Abelmoschus esculentus) is an important vegetable crop. Its capsules are rich in nutritional components such as flavonoid compounds, amino acids, and proteins, and have high nutritional value and various health care effects. Flavonoid compounds play important roles in the growth and development of plants, disease and pest resistance, and adaptation to environmental stresses, and also have medicinal values such as antibacterial, antioxidant, anti-tumor, anti-allergic, and promoting the recovery of cardiovascular and cerebrovascular diseases. Therefore, increasing the flavonoid content in okra is of great significance for improving its nutritional value and market competitiveness.

[0003] Cinnamic acid-4-hydroxylase (C4H) is one of the key enzymes in the flavonoid biosynthesis pathway, and the expression level of its encoding gene (AeC4H) directly affects the synthesis and accumulation of flavonoids. Although certain progress has been made in the research on the C4H gene in other plants, there has been no report on the research of the AeC4H gene of okra. In the prior art, there is a lack of research on the cloning method, expression regulation mechanism of the AeC4H gene of okra, and its application in increasing the flavonoid content, which limits the research progress of increasing the flavonoid content of okra by genetic engineering means.

[0004] Therefore, developing an effective cloning method for the AeC4H gene of okra, revealing its expression regulation mechanism, and exploring its application in increasing the flavonoid content of okra and other crops have important theoretical significance and practical application value. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a primer pair, a cloning method, and an application thereof for cloning the AeC4H gene of okra to fill the gaps in the prior art and provide technical support for increasing the flavonoid content of okra and other crops.

[0006] Through long-term exploration and attempts, as well as multiple experiments and efforts, and continuous reform and innovation, the inventors provide the following technical solution to solve the above technical problems: providing a primer pair for cloning the AeC4H gene of okra, and the nucleotide sequences of the primer pair are as follows:

[0007] Forward primer C4H-F: 5’-TAATCCCAATCTCCACCCT-3’;

[0008] Forward primer C4H-R: 5’-AATCAGAACATACGAGGCTTG-3’

[0009] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0010] Compared with the prior art, the present invention provides a primer pair for cloning the AeC4H gene of okra with strong specificity and high amplification efficiency, and its nucleotide sequence is as described above. This primer pair can efficiently and accurately amplify the full-length CDS sequence of the AeC4H gene of okra, laying a foundation for subsequent gene function research and application. By using the primer pair of the present invention and combining with optimized PCR amplification conditions, the success rate and accuracy of gene cloning can be significantly improved, providing an effective technical means for cloning and functional research of related genes in okra and other plants. In addition, the primer pair of the present invention also has good specificity and stability, can effectively avoid non-specific amplification and the formation of primer dimers, and further improves the reliability and repeatability of gene cloning.

[0011] On the basis of the above technical solution, the present invention can be further improved as follows:

[0012] Further: The primer pair is used to amplify the full-length CDS sequence of the AeC4H gene of okra, and the CDS sequence is shown as SEQ ID NO:1, encoding the amino acid sequence shown as SEQ ID NO:2.

[0013] Compared with the prior art, the beneficial effects of adopting the above further technical solution are as follows:

[0014] The present invention further provides a primer pair for amplifying the full-length CDS sequence of the AeC4H gene of okra, and this sequence encodes a specific amino acid sequence, providing an accurate molecular basis for the functional research and application of the AeC4H gene of okra.

[0015] The present invention also provides a method for cloning the AeC4H gene of okra, comprising the following steps:

[0016] (a) Extract the total RNA of okra tissue and reverse transcribe it into cDNA;

[0017] (b) Perform PCR amplification with the primer pair C4H-F / C4H-R, and the reaction system is: 12.5 μL of Max enzyme, 0.6 μL of each 10 μmol / L primer, 1 μL of cDNA template, and make up to 25 μL with ddH2O;

[0018] (c) The amplification program is: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 54°C for 15 s, extension at 72°C for 20 s, for 32 cycles; final extension at 72°C for 10 min;

[0019] (d) Recover the PCR product and ligate it to the pMD19-T vector, transform competent Escherichia coli DH5α cells, screen for positive clones and verify by sequencing.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] The present invention provides a method for cloning the AeC4H gene of Abelmoschus esculentus. By extracting the total RNA from Abelmoschus esculentus tissues and reverse transcribing it into cDNA, using specific primer pairs for PCR amplification, and combining with an optimized reaction system and amplification program, the full-length CDS sequence of the target gene can be efficiently and accurately amplified. The reliability of the results is ensured through subsequent cloning and sequencing verification. Compared with the prior art, the method of the present invention has the advantages of simple operation, strong specificity, high amplification efficiency, and accurate results, providing an effective technical means for the cloning and functional research of the AeC4H gene of Abelmoschus esculentus.

[0022] Furthermore, the PCR amplification product is a nucleotide fragment of 1506 bp, containing the complete coding sequence of the AeC4H gene.

[0023] The present invention also provides a recombinant expression vector pBA-C4H-YFP, which contains the AeC4H gene coding sequence shown in SEQ ID NO:1, and the gene is inserted into the pBA-YFP vector through Xho I and BamH I restriction enzyme sites.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] Compared with the prior art, this vector not only provides a powerful tool for the functional research of the AeC4H gene, but also provides a new approach for the research on the regulation mechanism of the plant flavonoid biosynthesis pathway, which helps to deeply explore the role of the AeC4H gene in plants and its influence on the flavonoid content, and further provides technical support for improving the flavonoid content and quality of plants.

[0026] The present invention also provides a method for transforming plants using the recombinant expression vector, which includes the following steps:

[0027] (a) Transform the recombinant vector into competent Agrobacterium tumefaciens EHA105 cells;

[0028] (b) Infect Arabidopsis thaliana inflorescences by the floral dip method and screen to obtain T1 generation transgenic seeds;

[0029] (c) Continuously screen for two generations in 1 / 2MS medium containing Basta to obtain homozygous T3 generation plants

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] Compared with the prior art, the method of the present invention is easy to operate, has a high transformation efficiency, and can obtain homozygous T3 generation plants by continuously screening for two generations in 1 / 2MS medium containing Basta, providing strong technical support for studying the function of the AeC4H gene in plants and its effect on flavonoid content.

[0032] Furthermore, the expression level of the AeC4H gene in the transgenic plant is significantly higher than that in the wild-type plant, and the total flavonoid content is 2.83 times that of the wild-type.

[0033] The present invention also provides a method for increasing the flavonoid content in plants, including overexpressing the AeC4H gene shown in SEQ ID NO:1 in a target plant.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] Compared with the prior art, the method of the present invention provides an effective genetic improvement strategy for increasing the flavonoid content in plants and has broad application prospects.

[0036] Furthermore, the plant is Arabidopsis thaliana, okra or cash crop.

[0037] The present invention also provides the application of the AeC4H gene shown in SEQ ID NO:1 or its encoded protein in regulating flavonoid biosynthesis in plants.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] The present invention provides the application of the AeC4H gene or its encoded protein in regulating flavonoid biosynthesis in plants, revealing its regulatory role in the flavonoid biosynthesis pathway in plants. Compared with the prior art, the present invention provides new targets and strategies for the study of the regulatory mechanism of flavonoid biosynthesis in plants, helps to deeply understand the function of the AeC4H gene in plant flavonoid metabolism, and provides a theoretical basis and application prospects for increasing the flavonoid content and quality of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0041] Figure 1 It is the PCR amplification result diagram of the AeC4H gene. Figure 1Among them, M is Marker D2000; the other lanes are the amplification products of the AeC4H gene.

[0042] Figure 2 It is the analysis chart of the hydrophilicity and hydrophobicity of the AeC4H protein.

[0043] Figure 3 It is the predicted tertiary structure chart of the AeC4H protein.

[0044] Figure 4 It is the predicted transmembrane structure chart of the AeC4H protein.

[0045] Figure 5 It is the phylogenetic tree based on the C4H gene.

[0046] Figure 6 It is the analysis chart of the expression pattern of the AeC4H gene in different tissues of okra.

[0047] Figure 7 It is the double digestion verification chart of the recombinant vector pBA-C4H-YFP. Figure 7 Among them, M is Marker D12000; lane 1 is the pBA-C4H-YFP plasmid; lane 2 is the double digestion of pBA-C4H-YFP.

[0048] Figure 8 It is the result chart of the resistance screening of transgenic Arabidopsis thaliana.

[0049] Figure 9 It is the result chart of the PCR identification of transgenic Arabidopsis thaliana.

[0050] Figure 10 It is the result chart of the determination of the total flavonoid content of transgenic Arabidopsis thaliana.

[0051] Figure 11 It is the expression chart of the AeC4H gene in transgenic Arabidopsis thaliana.

[0052] Figure 12 It is the intracellular distribution of pBA-C4H-YFP under the YFP fluorescent protein channel.

[0053] Figure 13 It is the intracellular distribution of pBA-C4H-YFP under DAPI. Specific implementation manners

[0054] The following is an illustration in combination with specific embodiments.

[0055] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed present invention, but merely represents the selected embodiments of the present invention.

[0056] In the present invention, unless otherwise specified, all devices and raw materials can be purchased from the market or are commonly used in this industry. The methods in the following embodiments, unless otherwise specified, are conventional methods in this field.

[0057] This embodiment synchronously describes the primer pair for cloning the AeC4H gene of okra, the method for cloning the AeC4H gene of okra, the recombinant expression vector pBA-C4H-YFP, the method for transforming plants using the recombinant expression vector, the method for increasing the flavonoid content of plants, and the application of the AeC4H gene.

[0058] In this embodiment, the okra materials were collected from the Sichuan Academy of Agricultural Special Plants, located at the Pidu Experimental Base in Chengdu (30.818°N, 103.834°E). After the samples were collected, they were quickly frozen in liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator for later use. Arabidopsis thaliana was available in this laboratory and was grown in an artificial climate incubator (culture conditions: light intensity 60%, darkness for 8 h, temperature 23°C; light for 16 h, temperature 25°C). Arabidopsis thaliana growing for about 4 weeks was selected for the experiment.

[0059] The pMD19-T vector was purchased from Beijing Polymerase Biotechnology Co., Ltd.; the competent cells of Escherichia coli DH5α and the competent cells of Agrobacterium tumefaciens EHA105 were both purchased from Beijing Bomaide Gene Technology Co., Ltd.; the vector pBA-YFP was available in this laboratory; the RNA extraction kit was purchased from FOREGENE Co., Ltd.; the reverse transcription cDNA kit, high-fidelity DNA polymerase, restriction endonuclease, and T4 DNA Ligase were all purchased from TaKaRa Co., Ltd.; the agarose gel DNA recovery kit and the plasmid extraction kit were purchased from Kangwei Century Biotechnology Co., Ltd.

[0060] Table 1 Primer sequences used Primer name

[0061] Primer Name Primer Sequence (5‘–3’) C4H-F TAATCCCAATCTCCACCCT C4H-R AATCAGAACATACGAGGCTTG C4HYFP-F CCGCTCGAGATGGACCTTCTCCTCCTTGAG(Xoh I) C4HYFP-R CGCGGATCCGAACATACGAGGCTTGGCA(BamH I) eIF4A-F ATGCATATGGTTTTGAGAAGCC eIF4A-R AAAGTTGCAGTCTTCCCAGTTC qC4H-F CAAGCAGCAAGAGAAGCGAC qC4H-R TGGACCATAAGGTTGTTTCA YFP-F GCGACGTAAACGGCCACAAGT YFP-R CAGCTCGTCCATGCCGAGAGT qAtEFIα-F ATTGACAGGCGTTCTGGTAAG qAtEFIα-R CAGCAACGGTCTGCCTCAT

[0062] 1. Cloning of the AeC4H gene of okra

[0063] Total RNA of okra fruits was extracted using an RNA extraction kit, and cDNA was obtained by reverse transcription with a reverse transcription cDNA kit. According to the transcriptome data obtained by the research group in the early stage, primers for AeC4H (C4H-F / C4H-R in Table 1) were designed. Using cDNA as a template, the expression sequence of the AeC4H gene was cloned by polymerase chain reaction (PCR). The total amplification volume was 25 μL, including 12.5 μL of Max, 0.6 μL of each 10 μmol / L primer F / R, 1 μL of cDNA, and 10.3 μL of ddH2O. The amplification program was: pre-denaturation at 98 °C for 30 s; denaturation at 98 °C for 10 s, annealing at 54 °C for 15 s, extension at 72 °C for 20 s, for 32 cycles; extension at 72 °C for 10 min, and storage at 10 °C. After electrophoresis of the PCR products, the target fragment was recovered, ligated to the pMD19-T vector, and transformed into Escherichia coli DH5α competent cells. Monoclonal colonies with positive colony PCR were selected and sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0064] Using okra cDNA as a template, C4H-F and C4H-R as primers, the AeC4H gene was amplified, and the results are as Figure 1 shown. Figure 1 The first lane in Figure 1 is the Marker, which shows DNA fragments of different sizes and is used to determine the size of the PCR products. The bands of the Marker are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp from top to bottom.

[0065] From Figure 1 it can be seen that the PCR product band in the C4H lane is located near 1500 bp, which is consistent with the expected size of the okra AeC4H gene (about 1500 bp). This indicates that the full-length CDS sequence of the AeC4H gene was successfully amplified using the designed primer pair C4H-F and C4H-R.

[0066] There is only one obvious band in the C4H lane, indicating that the PCR amplification has high specificity and no non-specific amplification products are generated. This further verifies the specificity and effectiveness of the primer pair C4H-F and C4H-R.

[0067] The brightness of the band is moderate, indicating that the PCR amplification has high efficiency and can generate sufficient amounts of PCR products for subsequent cloning and sequencing.

[0068] 2 Bioinformatics analysis of okra AeC4H

[0069] Use the online tools ProtParam (https: / / www.expasy.org / resources / protparam) and ProtScale (https: / / www.expasy.org / resources / protscale) in the ExPASy database to analyze the physicochemical properties of the AeC4H gene;

[0070] Use SWISS MODEL (https: / / swissmodel.expasy.org / interactive) to predict the protein tertiary structure;

[0071] Use TMHMM (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) to predict the protein transmembrane structure;

[0072] Construct a phylogenetic tree using the Neighbor-Joining method in MEGA 11.

[0073] The full length of the coding sequence of the AeC4H gene is 1506 bp, as shown in SEQ ID NO:1; it encodes 501 amino acids, as shown in SEQ ID NO:2.

[0074] Use the online tools ProtParam and ProtScale in the ExPASy database to analyze the physicochemical properties of the AeC4H gene. The results show that the molecular formula of AeC4H is C2636H4160N716O715S16, the relative molecular mass is 57.84 kD, and the theoretical isoelectric point is 9.19; the instability coefficient is 44.87, so it is an unstable protein, and AeC4H is a hydrophilic protein ( Figure 2 ); Use SWISS MODEL to predict the protein tertiary structure ( Figure 3 ), the homology of the template sequence with the protein sequence of Abelmoschus esculentus AeC4H is 91.02%, and the global model quality estimate (GMQE) value is about 0.95, so the modeling result has a high credibility; Use TMHMM to predict the protein transmembrane structure ( Figure 4), there is a transmembrane region between the 5th and 24th amino acids. By aligning the C4H genes of okra with those of 11 other plants at the amino acid level, it was found that the sequence similarities of okra with Gossypium hirsutum (XP_016677259.1), Althaea officinalis (UOI87840.1), Theobroma cacao (EOY20175.1), Quillaja saponaria (KAJ7959943.1), and Saraca asoca (XBR96853.1) are 94.84%, 93.47%, 92.28%, 88.91%, and 90.10% respectively. The similarity with Hibiscus trionum (GMI80261.1) is the highest, reaching 96.63%, while the similarity with Osmanthus fragrans (ANF04753.1) is the lowest, with a value of 88.32%. A phylogenetic tree was constructed using MEGA11, as Figure 5 shown. The protein encoded by the okra C4H gene was first clustered with Hibiscus trionum, showing the closest genetic relationship (confidence level 90%). It has a relatively close genetic relationship with Gossypium hirsutum and Althaea officinalis, while the genetic relationship with Osmanthus fragrans and Striga asiatica is relatively distant.

[0075] 3 Analysis of the expression pattern of the AeC4H gene in Abelmoschus esculentus

[0076] Using the cDNA of the young roots, young stems, and young leaves of the seedling stage of Abelmoschus esculentus, the mature roots, mature leaves, buds, flowers, pericarp 6 days after flowering, and seeds 6 days after flowering, as well as the seeds at the mature stage as templates, and using eIF4A as an internal reference gene (see eIF4A-F / eIF4A-R in Table 1), the fluorescence quantitative PCR reaction system is as follows: TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×) 6 μL, each of the upstream and downstream primers (see eIF4A-F / eIF4A-R in Table 1) 0.2 μL, cDNA template 1.6 μL, ddH2O 4 μL. The reaction conditions are: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing at 60°C for 30 s, for 39 cycles.

[0077] In this example, the qPCR technique was used to analyze the tissue expression levels of the AeC4H gene in Abelmoschus esculentus at different growth stages. The results are as Figure 6 shown. The expression level of the AeC4H gene in the pericarp 6 days after flowering is extremely low, with the highest expression in the young roots, followed by the seeds 6 days after flowering and the young stems at the seedling stage, which are 66.46, 56.16, and 54.57 times the expression level in the pericarp 6 days after flowering, respectively. The expression level in the mature seeds is the lowest.

[0078] Construction and Genetic Transformation of the AeC4H Expression Vector of Abelmoschus esculentus

[0079] Based on the obtained full-length AeC4H sequence, primers containing Xoh I and BamH I restriction sites were designed (C4HYFP-F / C4HYFP-R in Table 1). The pBA-YFP vector was double-digested with Xoh I and BamH I to establish a 40 μL digestion system. The digestion reaction system was as follows: 1 μg DNA, 1 μL Xoh I, 1 μL BamH I, 4 μL 10×K Buffer, and ddH2O was added to make up the total reaction system of 40 μL. After digestion at 30 °C for 1 h and 37 °C for 1 h, the digested products were detected by 1.0% agarose gel electrophoresis. The target gene fragment of AeC4H and the pBA-YFP vector were recovered by cutting the gel using a gel extraction kit. The obtained target gene fragment of AeC4H and the pBA-YFP vector were ligated with T4 DNA ligase at 16 °C for 5 h. The resulting ligation product was transformed into Escherichia coli competent cells, and positive colonies were screened to extract plasmids. After verification by PCR and digestion, the recombinant plasmid pBA-C4H-YFP was transformed into Agrobacterium tumefaciens EHA105, and the inflorescences of Arabidopsis thaliana were infected by the floral dip method (Clough & Bent, 1998).

[0080] The plasmid of the recombinant vector pBA-C4H-YFP was extracted using the plasmid extraction kit of ComWin Biotech Co., Ltd., and the results were as Figure 7 shown. Figure 7 In it, two main bands were shown in both Lane 1 and Lane 2. One band was located near 1500 bp, and the other band was located near 12000 bp.

[0081] The size of the recombinant vector pBA-C4H-YFP was approximately 12000 bp. It could be seen from Figure 7 that the band in Lane 1 was consistent with the size of the recombinant vector pBA-C4H-YFP, indicating that the plasmid extraction of the recombinant vector pBA-C4H-YFP was successful. Then the recombinant vector was verified by double digestion, and the results were as Figure 7 shown. After double digestion of the recombinant vector pBA-C4H-YFP, a single band appeared near 1500 bp, and the fragment size was consistent with the expected size of the AeC4H coding frame, indicating that the recombinant vector pBA-C4H-YFP was successfully constructed and the AeC4H gene had been correctly inserted into the pBA-YFP vector. The double digestion verification results were clear, indicating that the digestion reaction had strong specificity and high efficiency, providing a reliable vector for subsequent transformation and functional research.

[0082] 5 Screening and Identification of Transgenic Arabidopsis thaliana

[0083] The obtained T1 generation transgenic seeds were cultured in 1 / 2 MS medium containing 100 μg / mL Basta at 23 - 25°C under the condition of 16 h light / 8 h darkness. The survived seedlings were transplanted into nutrient soil and continued to be placed at 23 - 25°C with 16 h / 8 h light / darkness culture. After continuous screening for 2 generations, the T3 generation homozygous seeds were obtained.

[0084] Using Arabidopsis DNA as a template, YFP(F,R) as primers (see YFP - F / YFP - R in Table 1), pBA - YFP plasmid as a positive control, wild - type Arabidopsis and ddH2O as negative controls, PCR was used to verify the positive transgenic Arabidopsis plants. The total volume of the PCR reaction amplification was 25 μL, including 12.5 μL of Max, 0.6 μL each of 10 μmol / L primers F / R, 1 μL of template cDNA, and made up with deionized water (ddH2O). The amplification program was: pre - denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 58°C for 15 s, extension at 72°C for 20 s, for 32 cycles; extension at 72°C for 10 min, and preservation at 10°C.

[0085] The obtained T1 generation seeds were respectively subjected to preliminary positive screening on 1 / 2 MS medium containing Basta, as Figure 8 shown. After about 14 days, the positive plants grew normally, while the wild - type plants gradually turned yellow and died. Using Arabidopsis genomic DNA as a template and YFP - F and YFP - R as primers (see YFP - F / YFP - R in Table 1), PCR amplification was carried out, and the results were as Figure 9 shown. From Figure 9 this, it can be seen that the right - most one in the Marker is the positive control, the second - right one is the negative control, the third - right one is the water control. Specific bands with the same size as the positive control fragment can be amplified in lanes 1 - 12. However, no bands were found in the wild - type Arabidopsis plants as the negative control and the water control. Combining with the antibiotic screening results, it indicates that the AeC4H gene has been integrated into the Arabidopsis genome.

[0086] 6 Determination of total flavonoid content in transgenic Arabidopsis

[0087] The above - ground parts of 40 - day - old Arabidopsis plants (T3 generation) under normal growth conditions (23 - 25°C, 16 h light / 8 h darkness) were cut. Three plants were taken from each line and ground into powder with liquid nitrogen. The total flavonoid content was determined by the aluminum nitrate colorimetric method (Yang Feiyun et al., 2017), with 3 biological replicates.

[0088] Taking rutin concentration (mg / L) as the X - axis and absorbance (Abs) as the Y - axis, a rutin standard curve was drawn, and the total flavonoid content of transgenic Arabidopsis was calculated accordingly. As Figure 10As shown, the total flavonoid content of the transgenic positive plant pBA-C4H-YFP was 0.85 mg / g, which was 2.83 times that of the wild type (0.30 mg / g). The total flavonoid content of the transgenic positive plant was significantly higher than that of the wild type, indicating that overexpression of the AeC4H gene could significantly increase the total flavonoid content in Arabidopsis thaliana.

[0089] 7 Expression analysis of the AeC4H gene in transgenic positive plants

[0090] Using the cDNA of transgenic positive plants and wild type plants of Arabidopsis thaliana as templates, and using AtEFIα as the internal reference gene (see qAtEFIα-F / qAtEFIα-R in Table 1), the fluorescence quantitative PCR reaction system was as follows: 5 μL of 2×SYBR Premix Ex TaqII (TliRNaseH Plus, TaKaRa), 0.15 μL of each upstream and downstream primer (see qC4H-F / qC4H-R in Table 1), 2.7 μL of ddH2O, and 2 μL of the cDNA template diluted 10-fold. The reaction conditions were: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, annealing at 60°C for 30 s, for 39 cycles.

[0091] The qPCR technique was used to compare the expression of the AeC4H gene in transgenic pBA-C4H-YFP and wild type plants, and the results were as Figure 11 shown. The expression level of the AeC4H gene in positive plants was 10 times that in wild type plants.

[0092] 8 Subcellular localization of AeC4H

[0093] After sterilizing the T1 generation transgenic Arabidopsis thaliana seeds, they were cultured on 1 / 2 MS medium for about 1 week under the conditions of 23-25°C, 16 h light / 8 h darkness. Then, the root tips were taken and lysed in 0.5 mol / L EDTA for 5 min, rinsed with clear water, and stained in DAPI staining solution for 5 min. A temporary mount was made and the fluorescence in the cells was observed under a fluorescence microscope.

[0094] After culturing the T1 generation seeds of the obtained pBA-C4H-YFP positive transgenic plants in an artificial incubator for about one week, the root tips were taken, lysed, stained with DAPI, and then observed under a fluorescence microscope. The results were as Figures 12 - 13 shown. Figure 12 This is the intracellular distribution of pBA-C4H-YFP under the YFP fluorescent protein channel, Figure 13 and this is the intracellular distribution of pBA-C4H-YFP under DAPI. It can be seen from Figures 12 - 13 this that the fluorescence is mainly concentrated in the nucleus, indicating that AeC4H is localized in the nucleus.

[0095] In the description of the present invention, it should be understood that "-" and "~" represent the range between two numerical values, and this range includes the endpoints. For example, "A - B" represents a range greater than or equal to A and less than or equal to B. "A ~ B" represents a range greater than or equal to A and less than or equal to B.

[0096] In the description of the present invention, the term "and / or" herein is merely an associative relationship describing associated objects, indicating that there can be three relationships. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone.

[0097] In the description of the invention, numerical values such as time, temperature, ratio, and mass can be based on actual measurements, equipment standard parameters, simplified rounding results, or within an acceptable error range, ensuring the practicability and reproducibility of the invention.

[0098] In the description of the present invention, the term "about" or "approximately" is used to express an approximate value of a numerical value or interval, allowing for a certain error to ensure the flexibility and practicability of the description, while remaining within an acceptable error range, and the maximum error range does not exceed 10% of the corresponding numerical value or numerical range.

[0099] The above are only the preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limitations on the present invention. The protection scope of the present invention should be subject to the scope defined by the claims. For those of ordinary skill in the art of this technology, within the spirit and scope of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as within the protection scope of the present invention.

Claims

1. A method for increasing the flavonoid content in plants, characterized in that, Comprising overexpressing in a target plant a gene as shown in SEQ ID NO:1 AeC4H ; The plant is Arabidopsis thaliana or Abelmoschus esculentus.

2. Use of overexpressing the gene shown in SEQ ID NO: 1 or its encoded protein in enhancing flavonoid biosynthesis in plants, wherein the plants are Arabidopsis thaliana or Abelmoschus esculentus. AeC4H ​

Images