Plasmid elimination module based on multi-input cascade reaction

Abstract

The invention relates to the field of gene engineering, in particular to a plasmid elimination module based on multiple input cascade reaction, which comprises an antisense RNA expression region, an antisense RNA, a constitutive promoter of the antisense RNA and a terminator of the antisense RNA; the antisense RNA is the antisense RNA of mRNA (messenger ribonucleic acid) of a gene capable of influencing microbial growth; the first antisense neutralizing RNA expression region comprises an inducible promoter of first antisense neutralizing RNA or a fragment containing a constitutive promoter and repressor protein binding site, a first antisense neutralizing RNA sequence, a first linker sequence and a terminator; the second antisense neutralizing RNA expression region comprises an inducible promoter of second antisense neutralizing RNA or a fragment containing a constitutive promoter and repressor protein binding site, a second linker sequence, a second antisense neutralizing RNA sequence and a terminator; and the repressor protein gene / transcription factor expression region comprises a constitutive promoter, a ribosome binding site, a repressor protein translation region / transcription factor translation region and a terminator of the repressor protein gene. The method is high in elimination efficiency, elimination objects can be freely set according to needs, and selective or synchronous elimination of various plasmids can be realized.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, in particular to a plasmid elimination module based on multiple input cascade reactions. Background Art

[0002] When free plasmids are used to achieve the purpose of genome editing or gene circuit design, the genome editing tools or gene circuits carried on the plasmids become unstable factors in the cell genome, and the plasmids need to be eliminated at this time.

[0003] The efficiency of temperature-sensitive replicon plasmid elimination is low, and serving multiple plasmids may aggravate the spontaneous loss of plasmids, which is not conducive to the development of related experiments or production work; sacB gene-based plasmid elimination can serve multiple plasmids at the same time, but cannot accurately eliminate specific types of plasmids, and its tolerance to mutations is weak, which is prone to failure; CRISPR protein-related plasmid elimination. The plasmid elimination technology based on CRISPR protein has the risk of CRISPR protein gene mutation failure or CRISPR protein off-target cutting, and the gene sequence of CRISPR-related protein elements is long, which is not conducive to use in chassis microorganisms that are difficult to transfer large plasmids. When there is no natural CRISPR protein available in the chassis cells, additional plasmids with CRISPR proteins need to be transferred, and the failure rate of self-targeted elimination of plasmids with CRISPR proteins is high. Summary of the invention

[0004] The present invention proposes a plasmid elimination technology based on antisense RNA, designs a plasmid elimination module, which can promote the loss of free plasmids with low spontaneous loss rate in cells, can efficiently achieve the selective elimination or synchronous elimination of multiple free plasmids, can be applied to the selective elimination or synchronous elimination of different types (copy numbers) of free plasmids in eukaryotic and prokaryotic cells, and has better tolerance to sequence mutations than the plasmid elimination technology based on CRISPR protein. The gene sequence length of the related protein element is smaller than that of CRISPR, and it is still applicable to chassis cells that are difficult to transfer large plasmids.

[0005] Antisense RNA designed for key metabolic genes can reduce the expression of key metabolic genes, thereby affecting the cell growth rate. During cell amplification and passage, plasmids are randomly distributed to offspring. The number of offspring cells containing the plasmids of this elimination module will decrease, while the number of offspring cells without the plasmids of this elimination module will increase due to rapid growth, thereby achieving the purpose of enriching plasmid-free cells and achieving plasmid elimination.

[0006] The plasmid elimination module designed by the present invention can be deployed in the cell where the plasmid to be eliminated is located, except for the antisense RNA expression region which must be deployed on the plasmid to be eliminated. After the deployment is completed, the plasmid elimination module designed by the present invention can efficiently achieve plasmid elimination within the deployment range.

[0007] The significance of the present invention lies in proposing a universal plasmid elimination module construction idea that is convenient, usable, programmable, widely adaptable, highly stable, and requires a shorter sequence. Under the condition that the prerequisites are met, the plasmid elimination module can be used for the elimination of constructed plasmids after the construction of genetically engineered bacteria, the elimination of artificially constructed plasmids, and can also be used in conjunction with sequence editing tools to achieve the elimination of natural plasmids in cells.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] According to an embodiment of the present invention, four types of independent expression regions are included. The first type of region is an antisense RNA expression region, including antisense RNA, a constitutive promoter and terminator of the antisense RNA; the antisense RNA is an antisense RNA of a metabolic key gene mRNA, which can bind to the metabolic key gene mRNA to hinder the translation of the metabolic key gene mRNA; the second type of region is a first antisense neutralizing RNA expression region, including an inducible promoter of the first antisense neutralizing RNA or a fragment containing a constitutive promoter and a repressor protein binding site, a first antisense neutralizing RNA sequence, a first linker sequence and a terminator; the third type of region is a second antisense neutralizing RNA expression region, including an inducible promoter of the second antisense neutralizing RNA or a fragment containing a constitutive promoter and a repressor protein binding site a fragment, a second linker sequence, a second antisense neutralizing RNA sequence and a terminator; the first antisense neutralizing RNA and the second antisense neutralizing RNA can be non-covalently linked through a linker to form a complete antisense neutralizing RNA and can bind to the antisense RNA, so that it cannot bind to the mRNA of the key metabolic gene and inhibit the antisense RNA from producing translation-hindering RNA fragments on the mRNA of the key metabolic gene; the fourth type of region is the repressor protein gene / transcription factor expression region, including the constitutive promoter of the repressor protein gene, which includes an RNA polymerase binding site and a transcription start site, a ribosome binding site, a repressor protein translation region / a constitutive promoter of the transcription factor, which includes an RNA polymerase binding site and a transcription start site, a ribosome binding site, a transcription factor translation region, and a terminator.

[0010] According to an embodiment of the present invention, the antisense RNA is transcribed using a constitutive promoter; the constitutive promoter includes T7, tet, trc, trp, J23119 promoter, tac, and constitutive promoters related to chloramphenicol and kanamycin resistance genes commonly used antibiotics in Bacillus glutamicum; the terminator is rrnB T1, rrnB T2 or cyc1 terminator.

[0011] According to an embodiment of the present invention, the inducible transcription factor is a protein that can induce transcription of genes downstream of the binding site after binding to a specific compound; or a protein that can induce transcription of downstream genes before binding to a specific compound, but cannot induce transcription of genes downstream of the binding site after binding to the specific compound.

[0012] According to an embodiment of the present invention, the antisense neutralizing RNA inducible promoter fragment is an arabinose transcription factor and an arabinose transcription factor promoter, which includes an arabinose transcription factor promoter and an arabinose transcription factor binding site.

[0013] According to an embodiment of the present invention, the promoters of the first antisense neutralizing RNA and the second antisense neutralizing RNA include T7, TEF1, J23119 promoter, tet, trc, trp, tac, and constitutive promoters related to chloramphenicol and kanamycin resistance genes commonly used antibiotics for glutamicum Bacillus, MET17, and arabinose promoters; the terminators of the first antisense neutralizing RNA and the second antisense neutralizing RNA include CYC1, rrnB T1 or T7 terminators; and the transcription initiation conditions of the first antisense neutralizing RNA and the second antisense neutralizing RNA are different.

[0014] According to an embodiment of the present invention, the repressor protein is a repressor protein that can bind to a specific DNA sequence, inhibit downstream DNA transcription after binding, can be activated or release binding activity by specific compounds, and does not affect the growth of chassis cells. The repressor protein binding site binds to the repressor protein and hinders the RNA polymerization reaction from passing through or crossing the binding site to transcribe the DNA sequence downstream of the binding site.

[0015] According to an embodiment of the present invention, the repressor protein gene is a LacI gene, and the repressor protein binding site is a LacI protein binding site.

[0016] According to an embodiment of the present invention, the plasmid to be eliminated includes any one of pET28a, pEC-XK99E, and yeast 2μ.

[0017] According to an embodiment of the present invention, the key metabolic genes are TCA cycle related genes, protein synthesis related genes, aerobic respiration related genes, anaerobic respiration related genes, lipid synthesis related genes, cell wall synthesis related genes, sugar transport pathway related genes, amino acid transport pathway related genes, ATP synthesis related genes, cytoskeleton synthesis related genes, NADPH / NADP + Synthesis-related genes, NADH / NAD +Synthesis-related genes, vitamin synthesis-related genes, one-carbon transport system-related genes, carbon dioxide fixation-related genes, DNA / RNA synthesis-related genes, amino acid synthesis-related genes, ribose synthesis-related genes, ribosome synthesis-related genes, ribosome assembly-related genes, aminoacyl-tRNA synthetase-related genes and isoenzyme genes of the above genes.

[0018] According to an embodiment of the present invention, the objects of elimination of the plasmid elimination module are all microorganisms, animals or plant cells that have stable free plasmids, free plasmids that have a certain probability of not being distributed to daughter cells, and free plasmids that will not cause cell death or proliferation failure after elimination.

[0019] E. coli related sequences:

[0020] The complete sequence of the interference region of the Escherichia coli acnB gene:

[0021] ACTATGACAATGAGAGCGAGGAGAACCGTCGTGCTAGAAGAATACCGTAAGCACG (omitted here, see the sequence listing for details)

[0022] GAAAAAGCCGATGGGGTGATTTTCCAGACTGCGGTTTAA (SEQ ID NO: 1)

[0023] pET28a plasmid full sequence:

[0024] TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA (omitted here, see the sequence list for details)

[0025] GTTTTTTGCTGAAAGGAGGAACTATATCCGGAT (SEQ ID NO: 2)

[0026] Arabinose promoter sequence (arrow indicates the direction of transcription initiation):

[0027] AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGC (omitted here, see the sequence list for details)

[0028] GCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT→(SEQ ID NO: 3)

[0029] T7 terminator sequence (arrow indicates the direction of transcription termination):

[0030] →CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO: 4)

[0031] Arabinose transcription factor expression frame (including promoter, CDS region, terminator):

[0032] GGATTTCTGTTCATGGGGGTAATGATACCGATGGCGCACATTTCCCCGAAAAGTGCC (omitted here, see the sequence list for details)

[0033] GACAAAAACGCGTAACAAAAGTGTCT (SEQ ID NO: 5)

[0034] J23119 Promoter:

[0035] TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC→(SEQ ID NO: 6)

[0036] Tet promoter:

[0037] TTGACAGCTTATCATCGATTAGCTTTAAT→(SEQ ID NO: 7)

[0038] rrnB T1 terminator:

[0039] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC (SEQ ID NO: 8)

[0040] LacI protein expression cassette (including promoter, CDS region, terminator):

[0041] GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGA (omitted here, see the sequence list for details)

[0042] TAAGTTAGCTCACTCATTAGGCACCGGGATCTCGACCGATGCCCTTGAGAGCC (SEQ ID NO: 9)

[0043] The complete sequence of the CDS region of the acn gene of Corynebacterium glutamicum:

[0044] TTGGAGCTCACTGTGACTGAAAGCAAGAACTCCTTCAATGCTAAGAGCACCCTTGA (omitted here, see the sequence list for details)

[0045] CAGATGGCTGCTTCTTCTAAGTAA (SEQ ID NO: 10)

[0046] Corynebacterium glutamicum pEC-XK99E plasmid sequence:

[0047] GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCT (omitted here, see the sequence list for details)

[0048] GATAACAATTTCACACAGGAAACAGACCATG (SEQ ID NO: 11)

[0049] Arabinose promoter sequence (arrow indicates the direction of transcription initiation):

[0050] AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGC (omitted here, see the sequence list for details)

[0051] GCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT→(SEQ ID NO: 12)

[0052] T7 terminator sequence (arrow indicates the direction of transcription termination):

[0053] →CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO: 13)

[0054] Arabinose transcription factor expression frame (including promoter, CDS region, terminator):

[0055] AGACACTTTTGTTACGCGTTTTTGTCATGGCTTTGGTCCCGCTTTGTTACAGAATGC (omitted here, see the sequence list for details)

[0056] CCCCCATGAACAGAAATCC (SEQ ID NO: 14)

[0057] LacI protein expression cassette (including promoter, CDS region, terminator)

[0058] GACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGA (omitted here, see the sequence list for details)

[0059] GATAATGTTTTTTGCGCCGACATCATAACGGTTCTG (SEQ ID NO: 15)

[0060] Trc Promoter:

[0061] TTGACAATTAATCATCCGGCTCGTATAATG→(SEQ ID NO: 16)

[0062] rrnB 1 terminator:

[0063] →

[0064] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTC GGTGACGTCTCCTGAGTAGGACAAAT (SEQ ID NO: 17)

[0065] rrnB T2 terminator:

[0066] →AGAAGGCCATCCTGACGGATGGCCTTTT (SEQ ID NO: 18)

[0067] Saccharomyces cerevisiae related sequences:

[0068] The complete sequence of the CDS region of the Saccharomyces cerevisiae ACO1 / GLU1 gene:

[0069] ATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGCGACAGTC (omitted here, see the sequence list for details)

[0070] GGCCGATGAGAAGAAATAA (SEQ ID NO: 19)

[0071] Saccharomyces cerevisiae 2U shuttle plasmid sequence:

[0072] CAACTTTGTATAGAAAAGTTGACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTC (omitted here, see the sequence list for details)

[0073] CCGCTACAGGGCGCGTGGGGATCGATCCACTAGT (SEQ ID NO: 20)

[0074] Saccharomyces cerevisiae neomycin sulfate resistance gene sequence (including promoter, expression cassette, terminator):

[0075] GTGAGTTGAGTATACATGCATTTACTTATAATACAGTTTTTCAGAAGAACTCGTCAA (omitted here, see the sequence list for details)

[0076] GTCTGTGCTCCTTCCTTCGTTCTTCCTTCTG (SEQ ID NO: 21)

[0077] Shuttle vector E. coli replicon sequence:

[0078] TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGA (omitted here, see the sequence list for details)

[0079] GCAGAAAAAAAGGATCTCAA (SEQ ID NO: 22)

[0080] Shuttle vector ampicillin resistance gene expression cassette (including promoter, expression cassette, terminator):

[0081] GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT (omitted here, see the sequence list for details)

[0082] AGCTCTAATTTGTGAGTTGAGTATACATGC (SEQ ID NO: 23)

[0083] Saccharomyces cerevisiae inducible promoter MET17 sequence:

[0084] TTATTTTTTGCTTTTTCTCTTGAGGTCACATGATCGCAAAATGGCAAATGGCACGTGAAG (omitted here, see the sequence list for details)

[0085] TCGTCAGATACATAGATACAATTCTATTACCCCCATCCATACA→(SEQ ID NO: 24) Yeast terminator CYC1 sequence:

[0086] →

[0087] ATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCG (omitted here, see the sequence list for details)

[0088] CTCGAAGGCTTTAATTTGCAAGCT (SEQ ID NO: 25)

[0089] LacI protein CDS region sequence for Saccharomyces cerevisiae:

[0090] ATGAAACCAGTTACTTTGTATGATGTTGCTGAATATGCTGGTGTTTCTTATCAAACTGTTT (omitted here, see the sequence list for details)

[0091] ATGCAATTGGCTAGACAAGTTTCTAGATTGGAATCTGGTCAATGA (SEQ ID NO: 26) Saccharomyces cerevisiae constitutive promoter TEF1 sequence:

[0092] CCACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGAC (omitted here, see the sequence list for details)

[0093] CTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAG→(SEQ ID NO: 27)

[0094] Saccharomyces cerevisiae constitutive promoter Gap sequence:

[0095] TTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATATCTGGC (omitted here, see the sequence list for details)TTGTCCCTATTTCAATCAATTGAACAACTAT→(SEQ ID NO: 28)

[0096] The beneficial effects of the present invention are as follows: the present invention designs a modular plasmid elimination technology based on antisense RNA, the elements required for constructing the plasmid elimination module are simple and easy to obtain, the plasmid module elimination efficiency is high, the elimination object can be freely set according to the needs, and the selective or synchronous elimination of multiple plasmids can be achieved. And the present invention has a wide range of applications, and the technology can be applied to both eukaryotic and prokaryotic organisms. The genes related to the central metabolic pathway can all be combined with antisense RNA for plasmid elimination. The antisense RNA of the metabolic-related genes such as amino acids, nucleic acids, lipid synthesis pathways, transcription and translation, DNA replication, cell walls, cell membranes, endoplasmic reticulum, etc. outside the central metabolic pathway can also be applied to this technology. If the elimination effect is not good, the elimination effect can be enhanced by increasing the types of antisense RNAs, extending the length of antisense RNAs, and other strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1This is the interference result diagram of Example 4.

[0098] Figure 2 This is the interference result diagram of Example 5.

[0099] Figure 3 This is the interference result diagram of Example 6. DETAILED DESCRIPTION

[0100] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0101] The purpose of setting up antisense neutralizing RNA is that the antisense neutralizing RNA sequence can be complementary to the antisense RNA sequence, can bind to the antisense RNA so that it cannot bind to the mRNA of the key metabolic gene and inhibit the obstruction of the antisense RNA on the translation of the mRNA of the key metabolic gene, so that the plasmid can be stably present in the cell when there is no need to eliminate the plasmid.

[0102] The principle of antisense RNA plasmid elimination is: we place antisense RNA that can specifically bind to the mRNA of key metabolic genes downstream of the inducible promoter, and control the transcription of antisense RNA of key metabolic genes by adding / not adding inducers. When antisense RNA is transcribed, it can bind to the mRNA of key metabolic genes in the form of hydrogen bond pairing, thereby inhibiting the translation of key metabolic genes, making the growth rate of cells expressing antisense RNA significantly lower than that of cells not expressing antisense RNA. Since plasmids are spontaneously lost, plasmid-free cells can be enriched by subculture to achieve plasmid elimination.

[0103] The multiple cascade reaction controls the expression of several antisense neutralizing RNAs that can bind to each other to form a complete antisense neutralizing RNA, thereby neutralizing the antisense RNA to eliminate the inhibition of cell growth by the antisense RNA expressed by the plasmid to be eliminated, thereby achieving controllable plasmid-free cell enrichment and plasmid elimination.

[0104] Biomaterials:

[0105] EP001:CAGCATCCTGCGATGCAGATCCGGAAC (SEQ ID NO: 29)

[0106] EP002:CAATCCGGATATAGTTCCTCCTTTCAGC (SEQ ID NO: 30)

[0107] EP003: GGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGC (SEQ ID NO: 31) EP004: CTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTAC (SEQ ID NO: 32) EP005: GGAAGGGAAGAAAGCGAAAGGAGC (SEQ ID NO: 33)

[0108] EP006:GGAACGTTGTGAGGGTAAACAACTGGC (SEQ ID NO: 34)

[0109] Gene sequences synthesized by the client:

[0110] CAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGAGAGCGTTCACCGACAAA (omitted here, see the sequence list for details)

[0111] CGGCTGGCTGCGGCACGACACGCGTCTGAGCAGTATTTTGCGCGC (SEQ ID NO: 42) SP001: TGGCGAGAAAGGAAGGGAAGAAAGC (SEQ ID NO: 43)

[0112] SP002:TGGCCGATTCATTAATGCAGGGCC (SEQ ID NO: 44)

[0113] SP003:CCCTTCCTTTCTCCGCCACGTTCGCCGGCTTTCCCCGTCAAGCT (SEQ ID NO: 45) SP004: GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGG (SEQ ID NO: 46)

[0114] SP005: CCGTAAAGCACTAAATCGGAACCC (SEQ ID NO: 47)

[0115] SP006:CTCACATGTTCTTTCCTGCGTTATCC (SEQ ID NO: 48)

[0116] Delegated Synthesis Sequence

[0117] TGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGA (omitted here, see the sequence listing for details)

[0118] GGACGCTCGAAGGCTTTAATTTGCAAGCTGCGGCCCTGCATTAATGAATCGGCCA (SEQ ID NO: 49)

[0119] PCR system and procedure

[0120] system:

[0121]

[0122]

[0123] PCR procedure:

[0124]

[0125] Example 1 Construction of Escherichia coli Arabinose Promoter Plasmid Elimination Module

[0126] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0127] 1. Primers EP001 and EP002 were used to amplify the synthesized sequence according to the following system and PCR procedure. Primers EP003 and EP004 were used to amplify the plasmid template pet28a plasmid according to the same system and PCR procedure.

[0128] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products EP001-EP002 and EP003-EP004 according to the instructions of the purification kit.

[0129] 3. Connect the two fragments of the purified product EP001-EP002 / EP003-EP004 according to the operation flow in the instruction manual of the ready-to-use seamless cloning kit.

[0130] 4. Follow the steps below to convert 5αChemicallyCompetentCell after overnight culture:

[0131] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0132] 2) Heat shock in a 42°C water bath for 45-60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0133] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0134] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0135] (2) Construction result sequencing verification experiment:

[0136] The single colony obtained from the coated plate was sent for sequencing using primers EP005 and EP006 to verify the construction results.

[0137] Plasmid construction results:

[0138] TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA (omitted here, see the sequence list for details)

[0139] ACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT (SEQ ID NO: 50)

[0140] The antisense RNA sequence:

[0141] GGCTTCGCCTTTAGCGATAGCAGCCAGGAAGCCTGCTTTGACATAGGCGGCTTC G(SEQ IDNO: 51)

[0142] Antisense RNA neutralizing sequence:

[0143] CCCCAGGCGTCGATGAAGCCGCCTATGTCAAAGCAGGCTTCCTGGCTGCTATCGCTAAAGGCGAAGCCAAATCCCC (SEQ ID NO: 52)

[0144] (3) Plasmid extraction experiment:

[0145] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected to inoculate 5 mL of LB-kan liquid culture medium for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0146] Example 2 Construction of the Corynebacterium glutamicum Arabinose Promoter Plasmid Elimination Module

[0147] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0148] 1. Design primers GP001 and GP002 to amplify the synthesized fragment according to the following system and PCR procedure; design primers GP003 and GP004 to amplify the pEC-XK99E plasmid according to the following system and PCR procedure.

[0149] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products GP001-GP002 / GP003-GP004 according to the instructions of the purification kit.

[0150] 3. Connect the purified products GP001-GP002 / GP003-GP004 according to the instructions of the ready-to-use seamless cloning kit.

[0151] 4. Follow the steps below to convert 5αChemicallyCompetentCell after overnight culture:

[0152] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0153] 2) Heat shock in a 42°C water bath for 45-60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0154] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0155] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0156] (2) Construction result sequencing verification experiment:

[0157] Take a single colony obtained from the coated plate and send it for sequencing with GP007 / GP008 primers to verify the construction result.

[0158] Plasmid construction results:

[0159] CCCACTGAACCCAGCCGAGATGGTCATTGACCACTCCGTCATCGTGGAGGCTTTCG (omitted here, see the sequence list for details)

[0160] TTATCGCAACTCTCTACTGTTTCTCCAT (SEQ ID NO: 53)

[0161] The antisense RNA sequence:

[0162] CCCAACGCAGGAACTGGTAACGCTCCTCGTTGCGCTCGTACTCGATCTCAACGTTC TTAGCCAGTGCATCTGGGCGGCCGAAAGCCTCCACGATGACGGAGTGGTCAATGACCAT CTCGG (SEQ ID NO: 54)

[0163] Antisense RNA neutralizing sequence:

[0164] CCCACTGAACCCAGCCGAGATGGTCATTGACCACTCCGTCATCGTGGAGGCTTTCG GCCGCCCAGATGCACTGGCTAAGAACGTTGAGATCGAGTACGAGCGCAACGAGGAGCG TTACCAGTTCCTGCGTTGGGGTTCCGAGTCCTTCTCC (SEQ ID NO: 55)

[0165] (3) Plasmid extraction experiment:

[0166] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected to inoculate 5 mL of LB-kan liquid culture medium for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0167] Example 3 Construction of Saccharomyces cerevisiae inducible GAL1 promoter plasmid elimination module

[0168] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0169] 1. Design primers SP001-SP002 to amplify the synthesized fragment according to the following system and PCR program; primers SP003-SP004 amplify the yeast 2um plasmid.

[0170] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column-based PCR product purification kit, and purify the PCR products SP001-SP002 / SP003-SP004 according to the instructions of the purification kit.

[0171] 3. Connect the purified products SP001-SP002 / SP003-SP004 respectively according to the operation procedures in the instructions of the ready-to-use seamless cloning kit.

[0172] 4. Follow the steps below to convert 5αChemicallyCompetentCell after overnight culture:

[0173] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0174] 2) Heat shock in a 42°C water bath for 45-60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0175] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0176] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on the LB solid culture medium containing 100ug / mL AMP antibiotics, and culture it upside down in a 37℃ incubator overnight.

[0177] (2) Construction result sequencing verification experiment:

[0178] Single colonies obtained from two coated plates were sent for sequencing with primers SP003 / SP004 to verify the construction results and obtain the correct plasmid for sequencing.

[0179] Plasmid construction results:

[0180] CAACTTTGTATAGAAAAGTTGACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTC (omitted here, see the sequence list for details)

[0181] CGCTTAATGCGCCGCTACAGGGCGCGTGGGGATCGATCCACTAGT (SEQ ID NO: 56)

[0182] Antisense RNA sequences involved:

[0183] GGAGCCTTCAATTCCCATGGACGACCTGCCATAACATCAACGGCATCAGCACCACCAACACCAATAGCCAATTGAC (SEQ ID NO: 57)

[0184] Antisense RNA neutralizing sequence:

[0185] GGTGGTTTAGGTCAATTGGCTATTGGTGTTGGTGGTGCTGATGCCGTTGATGTTATG GCAGGTCGTCCATGGGAATTGAAGGCTCCAAAGATCTTAGG. (SEQ ID NO: 58)

[0186] (3) Plasmid extraction experiment:

[0187] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected and inoculated into 5 mL of LB liquid culture medium containing 100 ug / mL AMP antibiotic for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0188] Example 4 Plasmid elimination using the E. coli cascade reaction plasmid elimination module

[0189] 1. Make the E. coli to be transformed competent according to the process described in the super competent cell preparation kit.

[0190] 2. Take 100 μL of competent cells melted on ice, add the plasmid described in the technical solution "Construction experiment of Escherichia coli cascade reaction plasmid elimination module", gently mix (gently blow or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0191] 3. Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes (do not shake the sample during standing on ice, otherwise it will reduce the transformation efficiency).

[0192] 4. Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics but containing 1% arabinose to the centrifuge tube and mix well.

[0193] 5. Take an appropriate volume of the recovery solution and evenly spread it on the LB solid culture medium containing 50ug / mL kanamycin and 1% arabinose, and culture it upside down in a 37℃ incubator overnight.

[0194] 6. Add the E. coli constructed in "5" or the frozen E. coli containing the building blocks in "5" into LB liquid medium containing no more than 1 / 5 of the volume of the conical flask, at 37°C, 220rpm. After overnight culture (12h), streak on an antibiotic-free LB solid medium plate.

[0195] 7. Take the single colony obtained in "6" and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference.

[0196] Specific results such as Figure 1 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmids could be obtained.

[0197] Example 5

[0198] 1. Activate the Corynebacterium glutamicum ATCC13032 strain overnight with 5 ml of brain heart infusion liquid culture medium.

[0199] 2. Inoculate all activated Corynebacterium glutamicum bacterial liquid into 45 mL Epo liquid culture medium until the final OD600 reaches 0.2, and grow at 200 rpm and 30°C until OD600 reaches 0.9.

[0200] 3. Transfer the bacterial solution to a sterile 50 mL centrifuge tube and centrifuge to remove the supernatant. Wash 4 times with ice-cold 10% sterile glycerol. Dispense 100 ul / tube into sterile 1.5 mL centrifuge tubes and store at 70°C or use immediately.

[0201] 4. During electroporation, the competent cells were aliquoted and thawed on ice, and 5uL of the plasmid obtained in the "Construction of Plasmid Elimination Module for Cascade Reaction of Corynebacterium glutamicum" was added.

[0202] 5. Transfer the mixture to a cold electroporation cup (0.1 cm) and perform an electroporation at 1.8 kV and 5 ms pulses. Immediately after electroporation, add 1 mL of brain heart infusion medium containing 1% arabinose to the cuvette, mix well, and transfer to a 1.5 mL centrifuge tube.

[0203] 6. Incubate at 30°C for 1 hour.

[0204] 7. Finally, spread on brain heart infusion agar containing 50ug / mL kanamycin and 1% arabinose.

[0205] 8. Add the frozen bacteria / puncture bacteria of Corynebacterium glutamicum constructed in "7" or Corynebacterium glutamicum containing the building blocks in "7" to a liquid culture medium containing antibiotic-free heart infusion solution whose volume of culture medium does not exceed 1 / 5 of the volume of the conical flask, and culture overnight (18 h) at 30°C and 220 rpm.

[0206] 9. Streak on an antibiotic-free LB solid medium plate.

[0207] 10. Take the single colony obtained in "9" and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference).

[0208] 11. Specific results are as follows Figure 2 As shown in the figure, after plasmid elimination, most of the bacteria have lost their resistance to antibiotics and can no longer grow on antibiotic plates, indicating that the relevant resistance genes have been lost and the plasmid has been successfully eliminated. The corresponding strain with successful elimination can be inoculated to obtain the strain with successful plasmid elimination.

[0209] Example 6 Plasmid elimination using the Saccharomyces cerevisiae cascade reaction plasmid elimination module

[0210] Preparation of competent culture of Saccharomyces cerevisiae:

[0211] 1. Precool reagents.

[0212] 2. Take 30 μL of the Saccharomyces cerevisiae glycerol tube and inoculate it into 10 mL of liquid YPD medium. Culture it in a constant temperature shaker at 30°C for 24 h. Then take 100 μL of it and inoculate it into 100 mL of liquid YPD medium until the bacterial concentration OD600 grows to 1.3-1.5.

[0213] 3. Divide the bacterial solution into three pre-cooled 50 mL centrifuge tubes, centrifuge at 4°C, 5000 r×min-1 for 5 min, discard the supernatant and collect the bacteria.

[0214] 4. Use 4 mL of pre-cooled ddH2O to blow and aspirate the bacteria to resuspend them. Combine the three tubes into one tube and add 2 mL of pre-cooled 10*TE buffer, 2 mL of 100 mM LiAc buffer and 0.5 mL of 1 M DTT buffer. Mix by pipetting and aspirate. Place the centrifuge tube in a constant temperature water bath shaker at 30°C and 50 r×min-1 and culture for 45 min.

[0215] 5. Add 13.5 mL of pre-cooled ddH2O into a 50 mL centrifuge tube, centrifuge at 4°C, 5000 r×min-1 for 5 min, discard the supernatant and collect the bacteria.

[0216] 6. Add 25 mL of pre-cooled ddH2O into a 50 mL centrifuge tube, blow and aspirate the suspended bacteria, centrifuge at 5000 r×min-1 for 5 min, discard the supernatant, collect the bacteria, and then wash the bacteria twice with 1 mol·L-1 sorbitol (25 mL of sorbitol for the first time and 20 mL for the second time).

[0217] 7. Add 1 mL of pre-cooled sorbitol to the centrifuge tube to suspend the bacteria, and dispense into 1.5 mL EP tubes, 80 μL per tube, for immediate use.

[0218] 8. During electroporation, place the aliquoted competent cells on ice and add 5uL of the plasmid obtained in the "Saccharomyces cerevisiae cascade reaction plasmid elimination module construction experiment".

[0219] 9. Transfer the mixture to a cold electroporation cup (0.2 cm) and perform an electroporation at 1.5 kV, 200 Ω, 25 uF, and 5 ms pulses. Immediately after electroporation, add 1 mL of YPD medium containing 2% galactose without antibiotics to the cuvette, mix well, and transfer to a 1.5 mL centrifuge tube. Incubate at 30°C and 200 rpm on a shaker for 1 to 3 hours.

[0220] 10. Collect the bacteria by centrifugation. Spread 150ul of the bacterial solution on a 500ug / mL neomycin sulfate resistance plate containing 2% galactose and culture at 30℃ for 2-3 days.

[0221] 11. Add the Saccharomyces cerevisiae constructed in "10" or the frozen / punctured Saccharomyces cerevisiae containing the building blocks in "10" into an antibiotic-free YPD liquid culture medium containing a culture medium volume not exceeding 1 / 5 of the volume of the conical flask, culture at 30°C, 220 rpm for 48 h, and then streak on an antibiotic-free YPD solid culture medium plate.

[0222] 12. Take the single colony obtained in "11" and spot it on the YPD solid culture medium plate with or without antibiotics (neomycin sulfate 500ug / mL) (a single colony needs to be spotted twice to ensure the phenotypic difference).

[0223] 13. Specific results are as follows Figure 3 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmids could be obtained.

Claims

1. A plasmid elimination module based on multiple input cascade reaction, characterized in that: The invention comprises four types of independent expression regions. The first type of region is the antisense RNA expression region, including antisense RNA, a constitutive promoter and a terminator of the antisense RNA; the antisense RNA is the antisense RNA of the mRNA of the key metabolic gene, and can bind to the mRNA of the key metabolic gene to hinder the translation of the mRNA of the key metabolic gene; the second type of region is the first antisense neutralizing RNA expression region, including the inducible promoter of the first antisense neutralizing RNA or a fragment containing a constitutive promoter and a repressor protein binding site, the first antisense neutralizing RNA sequence, the first linker sequence and the terminator; the third type of region is the second antisense neutralizing RNA expression region, including the inducible promoter of the second antisense neutralizing RNA or a fragment containing a constitutive promoter and a repressor protein binding site, the first linker sequence and the terminator. A second linker sequence, a second antisense neutralizing RNA sequence and a terminator; the first antisense neutralizing RNA and the second antisense neutralizing RNA can form a complete antisense neutralizing RNA through a linker at non-covalent linkage and can bind to the antisense RNA, so that it cannot bind to the mRNA of the key metabolic gene and inhibit the antisense RNA from producing translation-hindering RNA fragments on the mRNA of the key metabolic gene; the fourth type of region is the repressor protein gene / transcription factor expression region, including the constitutive promoter of the repressor protein gene, which includes an RNA polymerase binding site and a transcription start site, a ribosome binding site, a repressor protein translation region / a constitutive promoter of the transcription factor, which includes an RNA polymerase binding site and a transcription start site, a ribosome binding site, a transcription factor translation region, and a terminator.

2. The plasmid elimination module according to claim 1, characterized in that The antisense RNA is transcribed using a constitutive promoter; the constitutive promoter includes T7, tet, trc, trp, J23119 promoter, tac and constitutive promoters related to chloramphenicol and kanamycin resistance genes commonly used antibiotics in glutamicum; the terminator is rrnB T1, rrnB T2 or cyc1 terminator.

3. The plasmid elimination module according to claim 1, characterized in that: The inducible transcription factor is a protein that can induce transcription of downstream genes of the binding site after binding to a specific compound; or a protein that can induce transcription of downstream genes before binding to a specific compound but cannot induce transcription of downstream genes of the binding site after binding to a specific compound.

4. The plasmid elimination module according to claim 1, characterized in that The antisense neutralizing RNA inducible promoter fragment is an arabinose transcription factor and an arabinose transcription factor promoter, which includes an arabinose transcription factor promoter and an arabinose transcription factor binding site.

5. The plasmid elimination module according to claim 1, characterized in that: The promoters of the first antisense neutralizing RNA and the second antisense neutralizing RNA include T7, TEF1, J23119 promoter, tet, trc, trp, tac, and constitutive promoters related to chloramphenicol and kanamycin resistance genes, MET17, and arabinose promoters of the commonly used antibiotics for Bacillus glutamicum; the terminators of the first antisense neutralizing RNA and the second antisense neutralizing RNA include CYC1, rrnB T1 or T7 terminators; and the transcription initiation conditions of the first antisense neutralizing RNA and the second antisense neutralizing RNA are different.

6. The plasmid elimination module according to claim 1, characterized in that: The repressor protein is a repressor protein that can bind to a specific DNA sequence, inhibit downstream DNA transcription after binding, can be activated or released from binding activity by specific compounds, and does not affect the growth of chassis cells. The repressor protein binding site binds to the repressor protein and prevents RNA polymerization from passing through or crossing the binding site to transcribe the DNA sequence downstream of the binding site.

7. The plasmid elimination module according to claim 1, characterized in that: The repressor protein gene is the LacI gene, and the repressor protein binding site is the LacI protein binding site.

8. The plasmid elimination module according to claim 1, characterized in that: The plasmid to be eliminated includes any one of pET28a, pEC-XK99E, and yeast 2μ.

9. The plasmid elimination module according to claim 1, characterized in that: The key metabolic genes are TCA cycle related genes, protein synthesis related genes, aerobic respiration related genes, anaerobic respiration related genes, lipid synthesis related genes, cell wall synthesis related genes, sugar transport pathway related genes, amino acid transport pathway related genes, ATP synthesis related genes, cytoskeleton synthesis related genes, NADPH / NADP + Synthesis-related genes, NADH / NAD + Synthesis-related genes, vitamin synthesis-related genes, one-carbon transport system-related genes, carbon dioxide fixation-related genes, DNA / RNA synthesis-related genes, amino acid synthesis-related genes, ribose synthesis-related genes, ribosome synthesis-related genes, ribosome assembly-related genes, aminoacyl-tRNA synthetase-related genes and isoenzyme genes of the above genes.

10. The plasmid elimination module according to any one of claims 1 to 9, characterized in that: The objects of elimination of the plasmid elimination module are all microorganisms, animals or plant cells that have stable free plasmids, free plasmids that have a certain probability of not being distributed to daughter cells, and free plasmids that will not cause cell death or proliferation failure after elimination.

Images