Branched-chain amino acid absorption expression system, recombinant vector, recombinant bacteria and applications

By constructing a branched chain amino acid absorption and expression system and modifying the recombinant strain of Streptocytica avulmonarya, the problem that avulmonary yield is limited by the absorption and utilization capacity of branched chain amino acids is solved, and a significant increase in avulmonary production is achieved.

CN119876217BActive Publication Date: 2025-06-06YANTAI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510363691.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-06-06
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

In Streptocytica, the absorption and utilization capacity of branched chain amino acids is insufficient, which affects the yield of avermectin. The metabolic pathways of branched chain amino acids are complex, making it difficult to accurately coordinate the expression of their absorption system.

Method used

A branched chain amino acid absorption and expression system is constructed that contains a specific promoter and a gene that absorbs branched chain amino acids, and a recombinant strain is constructed through genetic engineering to improve the strain's absorption and utilization ability of branched chain amino acids.

Benefits of technology

By improving the strain's absorption and utilization ability of branched chain amino acids, the unit yield of avermectin is significantly improved, and the yield efficiency and yield rate are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876217B_ABST
    Figure CN119876217B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of genetic engineering, and specifically relates to a branched-chain amino acid absorption expression system, a recombinant vector, a recombinant bacterium and its application. The branched-chain amino acid absorption expression system comprises a promoter and a gene for absorbing branched-chain amino acids; wherein the nucleotide sequence of the promoter is as shown in SEQ.ID.NO.1 or SEQ.ID.NO.2; the nucleotide sequence of the gene for absorbing branched-chain amino acids is as shown in SEQ.ID.NO.6 or SEQ.ID.NO.7. The present invention provides a branched-chain amino acid absorption expression system for increasing the yield of the polyketide compound avermectin, and constructs and prepares recombinant bacteria through genetic engineering transformation. In fermentation production, the absorption and utilization of branched-chain amino acid substrates by the strain is promoted, and the unit yield of avermectin is effectively increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a branched-chain amino acid absorption expression system, a recombinant vector, a recombinant bacterium and applications. Background Art

[0002] Streptomyces is an important producer of microbial natural product pesticides, which can produce active compounds with various structures such as polyketides, peptides and terpenes. Avermectins are produced by Streptomyces avermitilis ( Streptomyces avermitilis ) is a highly effective polyketone biopesticide produced by the plant, which has been widely used in agriculture, animal husbandry and pharmaceutical industries.

[0003] Compared with bulk chemicals, natural product pesticides, as secondary metabolites, generally have common problems such as low substrate conversion rate and low product yield. In addition to the sugar substrates that have attracted the attention of many researchers, the branched-chain amino acids remaining in the fermentation broth also have an important influence on the yield of this type of natural products. Especially in Streptomyces avermitilis, the degradation products of valine and isoleucine, isobutyryl-CoA and 2-methylbutyryl-CoA, are the starting units for the synthesis of avermectin products. Therefore, the host bacteria's ability to absorb and utilize branched-chain amino acids directly affects the final yield of avermectin. In addition, the metabolic pathways and regulatory networks involved in branched-chain amino acids in organisms are very complex. Therefore, accurately coordinating the expression of the branched-chain amino acid absorption system is of great significance for further improving the unit yield of avermectin. Summary of the invention

[0004] The present invention provides a branched-chain amino acid absorption expression system, a recombinant vector, a recombinant bacterium and applications. The branched-chain amino acid absorption expression system of the present invention comprises a promoter and a gene for absorbing branched-chain amino acids, and constructing a recombinant bacterium comprising the branched-chain amino acid absorption expression system can improve the absorption and utilization of branched-chain amino acid substrates by the strain, thereby increasing the unit yield of avermectin.

[0005] The specific technical solutions are as follows:

[0006] One of the purposes of the present invention is to provide a branched-chain amino acid absorption expression system, which comprises a promoter and a gene for absorbing branched-chain amino acids;

[0007] Wherein, the nucleotide sequence of the promoter is shown as SEQ.ID.NO.1 or SEQ.ID.NO.2;

[0008] The nucleotide sequence of the gene for absorbing branched-chain amino acids is shown as SEQ.ID.NO.6 or SEQ.ID.NO.7.

[0009] In the present invention, the promoter is PR (SEQ.ID.NO.1) or PF (SEQ.ID.NO.2); the gene for absorbing branched-chain amino acids is Livt3 (SEQ.ID.NO.6) or Livt4 (SEQ.ID.NO.7).

[0010] Furthermore, the optimal technical solution for the branched-chain amino acid absorption expression system is: the nucleotide sequence of the promoter is as shown in SEQ.ID.NO.1, and the nucleotide sequence of the gene for absorbing branched-chain amino acids is as shown in SEQ.ID.NO.7; or the nucleotide sequence of the promoter is as shown in SEQ.ID.NO.2, and the nucleotide sequence of the gene for absorbing branched-chain amino acids is as shown in SEQ.ID.NO.6.

[0011] The second object of the present invention is to provide a recombinant vector comprising the above-mentioned branched-chain amino acid absorption expression system.

[0012] Furthermore, the starting vector of the recombinant vector is preferably pSET152.

[0013] The third object of the present invention is to provide a recombinant bacterium comprising the above-mentioned branched-chain amino acid uptake expression system or recombinant vector.

[0014] Specifically, the starting strain of the recombinant bacteria is Streptomyces avermitilis ( Streptomyces avermitilis ).

[0015] The fourth object of the present invention is to provide the application of the branched-chain amino acid absorption and expression system in increasing the yield of polyketide compounds. Specifically, the polyketide compound is avermectin.

[0016] The fifth object of the present invention is to provide the use of the above recombinant vector in increasing the yield of polyketide compounds. Specifically, the polyketide compound is avermectin.

[0017] The sixth object of the present invention is to provide the use of the above recombinant bacteria in increasing the yield of polyketide compounds. Specifically, the polyketide compound is avermectin.

[0018] The beneficial effects of the present invention are as follows:

[0019] The present invention provides a branched-chain amino acid absorption and expression system for increasing the yield of the polyketide compound avermectin, and constructs a recombinant bacterium through genetic engineering transformation. In fermentation production, the absorption and utilization of branched-chain amino acid substrates by the strain is promoted, and the unit yield of avermectin is effectively increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the overexpression plasmid map of the branched-chain amino acid uptake expression system Livt3 controlled by promoter PF;

[0021] Figure 2 This is the overexpression plasmid map of the branched-chain amino acid uptake expression system Livt4 controlled by the promoter PR;

[0022] Figure 3 The effect of the branched-chain amino acid absorption expression system (Livt3 is the target gene) under the control of different promoters on the yield of avermectin in Example 2;

[0023] Figure 4 The effect of the branched-chain amino acid absorption expression system (Livt4 is the target gene) under the control of different promoters on the yield of avermectin in Example 2;

[0024] Figure 5 The relative content of each branched-chain amino acid outside the cells of strains WT and WTPRLivt4 after fermentation in Example 2;

[0025] Figure 6 The relative contents of each branched-chain amino acid in the cells of strains WT and WTPRLivt4 after fermentation in Example 2. DETAILED DESCRIPTION

[0026] The principles and features of the present invention are described below in conjunction with examples, which are only used to explain the present invention and are not used to limit the scope of the present invention. In the specific implementation mode, the test reagents and equipment used can be purchased through commercial channels, and the molecular biology experimental operations such as PCR amplification, enzyme ligation, and transformation involved are all routine experimental operations in the field or are performed in accordance with the product instructions of the corresponding reagents unless otherwise specified.

[0027] Definitions and abbreviations: The branched-chain amino acid uptake expression system specifically refers to an operon consisting of five genes controlled by a specific promoter, wherein the genes encode transmembrane proteins, ATP-binding proteins or substrate recognition proteins, respectively. Fine-tuning specifically refers to gene overexpression controlled by a non-constitutive strong promoter.

[0028] In the specific implementation mode: the solid culture medium, seed solution, fermentation solution formula and specific detection methods corresponding to the secondary metabolites used for bacterial growth and fermentation are all recorded in Jin et al. Synth Syst Biotechnol (2020) 5:214-221 DOI 10.1016 / j.synbio.2020.07.001.

[0029] In a specific embodiment, the Streptomyces avermitilis used is Streptomyces avermitilis) is Streptomyces avermitilis MA-4680, which is described in Dong et al. Applied Microbiology and Biotechnology (2024)108(1):72. DOI 10.1007 / s00253-023-12964-9. The above strains are available to the public through the School of Life Sciences of Yantai University.

[0030] In the specific implementation manner: the plasmids involved are shown in Table 1.

[0031] Table 1 Plasmids involved in the specific implementation

[0032] name describe pSET152 Integration of E. coli-Streptomyces shuttle vector, commercial plasmid. pPRLivt The plasmid of the branched-chain amino acid uptake expression system Livt3 or Livt4 controlled by the PR promoter, where n represents 3 or 4, is derived from pSET152. pPv The plasmid of the branched-chain amino acid uptake expression system Livt3 or Livt4 controlled by the PF promoter, where n represents 3 or 4, is derived from pSET152. pPSELF3Livtn The plasmid of the branched-chain amino acid uptake expression system Livt3 or Livt4 controlled by the PSELF3 promoter, where n represents 3 or 4, is derived from pSET152. pPSELF4Livtn The plasmid of the branched-chain amino acid uptake expression system Livt3 or Livt4 controlled by the PSELF4 promoter, where n represents 3 or 4, is derived from pSET152. pLivtn The plasmid of the branched-chain amino acid uptake expression system Livt3 or Livt4 controlled by the hrdB promoter, where n represents 3 or 4, is derived from pSET152.

[0033] In the specific implementation mode: the strains involved are shown in Table 2.

[0034] Table 2 Strains involved in the specific implementation

[0035] name describe Escherichia coli JM109 Served as host for all plasmid constructions. ET12567 (pUZ8002) Commercial strain used for conjugation and transfer of Streptomyces and Escherichia coli. Streptomyces avermitilis WT Streptomyces avermitilis MA-4680 WTPRL3 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt3 using the promoter PR. WTPRL4 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt4 using the promoter PR. WTPFL3 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt3 using promoter PF. WTPFL4 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt4 using promoter PF. WTPS3L3 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt3 using the promoter PSELF3. WTPS3L4 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt4 using the promoter PSELF3. WTPS4L3 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt3 using the promoter PSELF4. WTPS4L4 In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt4 using the promoter PSELF4. WTPhL In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt3 using the promoter hrdB. WTPhL In strain WT, a recombinant strain of Streptomyces avermitilis overexpressed the branched-chain amino acid uptake gene Livt4 using the promoter hrdB. Example 1

[0036] The steps for constructing a recombinant bacterium containing a branched-chain amino acid absorption expression system recombinant vector are as follows:

[0037] S1. Construction of branched-chain amino acid absorption expression system

[0038] Using the WT genome of Streptomyces avermitilis as a template, the promoter and the gene for absorbing branched-chain amino acids in the branched-chain amino acid absorption expression system were amplified. The promoter was promoter PR or promoter PF, and the gene for absorbing branched-chain amino acids was gene Livt3 or Livt4.

[0039] The promoter PR (P SAV_935 ) sequence, and the promoter PF (P SAV_936 ) sequence to obtain the promoter PR fragment and the promoter PF fragment. Among them, the nucleotide sequence of the promoter PR is shown in SEQ.ID.NO.1, and the nucleotide sequence of the promoter PF is shown in SEQ.ID.NO.2. Among them, the nucleotide sequence of the primer PR-F is shown in SEQ.ID.NO.8, the nucleotide sequence of the primer PR-R is shown in SEQ.ID.NO.9, the nucleotide sequence of the primer PF-F is shown in SEQ.ID.NO.10, and the nucleotide sequence of the primer PF-R is shown in SEQ.ID.NO.11; the sequences of the above primers are shown in Table 3.

[0040] The WT genome of Streptomyces avermitilis was used as a template, and the primer pair Livt3-F / Livt3-R was used to amplify the gene Livt3 fragment that absorbs branched-chain amino acids. The Livt3 gene contains 5 gene fragments, and the accession numbers of the 5 gene fragments on GenBank are Gene ID: 41543240 (encoding ATP binding protein), 41543241 (encoding ATP binding protein), 41543242 (encoding transmembrane protein), 41543243 (encoding transmembrane protein) and 41543244 (encoding substrate recognition protein). Among them, the nucleotide sequence of the gene Livt3 is shown in SEQ.ID.NO.6. Among them, the nucleotide sequence of primer Livt3-F is shown in SEQ.ID.NO.12, and the nucleotide sequence of primer Livt3-R is shown in SEQ.ID.NO.13; the sequences of the above primers are shown in Table 3.

[0041] The WT genome of Streptomyces avermitilis was used as a template, and the primer pair Livt4-F / Livt4-R was used to amplify the gene Livt4 fragment that absorbs branched-chain amino acids. The Livt4 gene contains 5 gene fragments, and the accession numbers of the 5 gene fragments on GenBank are Gene ID: 41543296 (encoding ATP binding protein), 41543297 (encoding ATP binding protein), 41543298 (encoding transmembrane protein), 41543299 (encoding transmembrane protein) and 41543300 (encoding substrate recognition protein). Among them, the nucleotide sequence of the gene Livt4 is shown in SEQ.ID.NO.7. Among them, the nucleotide sequence of primer Livt4-F is shown in SEQ.ID.NO.14, and the nucleotide sequence of primer Livt4-R is shown in SEQ.ID.NO.15; the sequences of the above primers are shown in Table 3.

[0042] S2. Construction of a recombinant vector containing a branched-chain amino acid uptake expression system

[0043] Using restriction enzymes EcoRⅠ and XbaⅠ The vector pSET152 was digested with enzymes and recovered by gel extraction to obtain the linear plasmid fragment LpSET152.

[0044] The promoter PR fragment obtained in step S1 was EcoRⅠ and SpeI The Livt3 fragment was digested with SpeI and XbaⅠ The double-enzyme-digested PR fragment, the double-enzyme-digested Livt3 fragment and the linear plasmid fragment LpSET152 were connected with T4 ligase to obtain the plasmid pPRLivt3 of the promoter PR controlled branched-chain amino acid absorption expression system.

[0045] The promoter PF fragment obtained in step S1 was EcoRⅠ and SpeI The Livt3 fragment was digested with SpeI and XbaⅠ The double-enzyme-digested PF fragment, the double-enzyme-digested Livt3 fragment and the linear plasmid fragment LpSET152 were connected with T4 ligase to obtain the plasmid pPFLivt3 of the promoter PF controlled branched-chain amino acid absorption expression system.

[0046] The Livt4 fragment obtained in step S1 and the plasmid pPRLivt3 obtained above were respectively SpeI and XbaⅠ Double enzyme digestion was performed, and the fragments were purified by gel recovery. The double enzyme digested Livt4 fragment and the linear plasmid fragment LpPRLivt3 were connected with T4 ligase to obtain the plasmid pPRLivt4 of the promoter PR controlled branched chain amino acid absorption expression system.

[0047] The Livt4 fragment obtained in step S1 and the plasmid pPFLivt3 obtained above were respectively SpeI and XbaⅠ Double enzyme digestion was performed, and the fragments were purified by gel recovery. The double enzyme digested Livt4 fragment and the linear plasmid fragment LpPFLivt3 were connected with T4 ligase to obtain the plasmid pPFLivt4 of the promoter PF controlled branched chain amino acid absorption expression system.

[0048] S3. Construction of recombinant bacteria containing a branched-chain amino acid uptake expression system recombinant vector

[0049] The recombinant vector pPRLivt3 prepared in step S2 is introduced into Streptomyces avermitilis WT by conjugation transfer to obtain the recombinant strain WTPRL3 for synthesizing avermectin;

[0050] The recombinant vector pPFLivt3 prepared in step S2 is introduced into Streptomyces avermitilis WT by conjugation transfer to obtain a recombinant strain WTPFL3 for synthesizing avermectin;

[0051] The recombinant vector pPRLivt4 prepared in step S2 is introduced into Streptomyces avermitilis WT by conjugation transfer to obtain the recombinant strain WTPRL4 for synthesizing avermectin;

[0052] The recombinant vector pPFLivt4 prepared in step S2 is introduced into Streptomyces avermitilis WT by conjugation transfer to obtain the recombinant strain WTPFL4 for synthesizing avermectin. Comparative Example 1

[0053] Referring to Example 1, the difference from Example 1 is that the promoter described in this comparative example is PSELF3 or PSELF4, which controls the expression of branched-chain amino acid absorption expression system Livt3 or Livt4 respectively; the promoter PSELF3 (P SAV_6164 ) sequence, and the promoter PSELF4 (P SAV_6224 )sequence.

[0054] The nucleotide sequence of the promoter PSELF3 is shown in SEQ.ID.NO.3, and the nucleotide sequence of the promoter PSELF4 is shown in SEQ.ID.NO.4. The nucleotide sequence of the primer PSELF3-F is shown in SEQ.ID.NO.16, the nucleotide sequence of the primer PSELF3-R is shown in SEQ.ID.NO.17, the nucleotide sequence of the primer PSELF4-F is shown in SEQ.ID.NO.18, and the nucleotide sequence of the primer PSELF4-R is shown in SEQ.ID.NO.19; the sequences of the above primers are shown in Table 3.

[0055] Recombinant vectors were constructed according to the method of Example 1 to obtain plasmids pPSELF3Livt3 (promoter SELF3 / branched-chain amino acid absorption gene Livt3), pPSELF3Livt4 (promoter SELF3 / branched-chain amino acid absorption gene Livt4), pPSELF4Livt3 (promoter SELF4 / branched-chain amino acid absorption gene Livt3) and pPSELF4Livt4 (promoter SELF4 / branched-chain amino acid absorption gene Livt4). The above plasmids were introduced into Streptomyces avermitilis WT by conjugation transfer, and recombinant strains WTPS3L3, WTPS3L4, WTPS4L3 and WTPS4L4 were obtained respectively. Comparative Example 2

[0056] Referring to Example 1, the difference from Example 1 is that the promoter described in this comparative example is a constitutive promoter. hrdB , respectively controlling the expression of branched-chain amino acid uptake expression system Livt3 or Livt4; using plasmid pSET152:PhrdBmilR (Zhang et al. Microb Cell Fact (2016) 15:152 DOI 10.1186 / s12934-016-0552-1) as template, using primer pair PhrdB -F / PhrdB -R amplification promoter hrdB Fragment.

[0057] Among them, the promoter hrdB The nucleotide sequence is shown in SEQ.ID.NO.5. PhrdB -F nucleotide sequence is shown in SEQ.ID.NO.20, primer PhrdB The nucleotide sequence of -R is shown in SEQ.ID.NO.21; the sequences of the above primers are shown in Table 3.

[0058] The recombinant vector was constructed according to the method of Example 1 to obtain plasmid pPhLivt3 (promoter hrdB / branched-chain amino acid uptake gene Livt3) and pPhLivt4 (promoter hrdB / branched-chain amino acid absorption gene Livt4). The above plasmids were introduced into Streptomyces avermitilis WT by conjugation transfer, and recombinant strains WTPhL3 and WTPhL4 were obtained respectively.

[0059] Table 3 Primers involved in the specific implementation method

[0060] name Serial Number Sequence (5'-3') PR-F SEQ.ID.NO.8 <![CDATA[CG GAATTC TCCTGCGCCGACGGGACG]]> PR-R SEQ.ID.NO.9 <![CDATA[GG ACTAGT GATGTTCTTATTTCTCCTTTTTCCA]]> PF-F SEQ.ID.NO.10 <![CDATA[CG GAATTC TCTCGGCGGCCGTCCTGG]]> PF-R SEQ.ID.NO.11 <![CDATA[GG ACTAGT GATGAAATTCCCCTTTTCGGAAAGC]]> Livt3-F SEQ.ID.NO.12 <![CDATA[GG ACTAGT ATGCCCTCTTTGTCATCGGACGGC]]> Livt3-R SEQ.ID.NO.13 <![CDATA[GC TCTAGA TCACTTCTTGCGGGAGTCCAGGAAC]]> Livt4-F SEQ.ID.NO.14 <![CDATA[GG ACTAGT GTGCGACACCGTTCCTTGCTGATAC]]> Livt4-R SEQ.ID.NO.15 <![CDATA[GC TCTAGA TCAGTCCTCGCCCAGGTACGC]]> PSELF3-F SEQ.ID.NO.16 <![CDATA[CG GAATTC GCCCGGCGGCTCCTCGGG]]> PSELF3-R SEQ.ID.NO.17 <![CDATA[GG ACTAGT CACAACTCCTCGGTTCCGCACGACG]]> PSELF4-F SEQ.ID.NO.18 <![CDATA[CG GAATTC CTGATCCTGCGCACCCCACAAG]]> PSELF4-R SEQ.ID.NO.19 <![CDATA[GG ACTAGT GATCAATCCTCTCCCTGGCGCG]]> PhrdB-F SEQ.ID.NO.20 <![CDATA[CG GAATTC CCGCCTTCCGCCGGAACG]]> PhrdB-R SEQ.ID.NO.21 <![CDATA[GG ACTAGT GAACAACCTCTCGGAACGTTGAAA]]>

[0061] In Table 3, underlined characters indicate restriction endonuclease sites. Example 2

[0062] The polyketide compound avermectin was produced by fermentation and the yield changes of different recombinant bacteria were verified by HPLC.

[0063] The recombinant strains WTPRL3, WTPFL3, WTPRL4 and WTPFL4 prepared in Example 1, the recombinant strains WTSELF3L3, WTSELF3L4, WTSELF4L3 and WTSELF4L4 prepared in Comparative Example 1, and the recombinant strains WTPhL3 and WTPhL4 prepared in Comparative Example 2 were used to ferment and produce avermectin. The fermentation method is as follows: after culturing the above-mentioned recombinant strains on MS medium at 28°C for 7 days, scraping about 1 square centimeter of spores and inoculating them into the avermectin seed medium, culturing at 28°C and 250 rpm for 40 hours, inoculating the fermentation medium with an inoculum amount of 6%, culturing at 28°C and 250 rpm for 10 days, taking 0.5 mL of the fermentation liquid, soaking and rotating with 1.5 mL of methanol overnight, and centrifuging the supernatant to detect the avermectin content by HPLC. The HPLC analysis conditions are as follows: the chromatographic column uses an Agilent SB-C18 column (4.6 mm×250 mm, 5 μm); the mobile phase is 90% methanol; and the absorption wavelength is 246 nm. Test results are shown in Figure 3 , Figure 4 , showing the improvement effect of fine-tuning the expression level of the branched-chain amino acid absorption expression system on the potency of avermectin. Figure 3The effect of branched-chain amino acid uptake expression system on avermectin production under the control of different promoters with Livt3 as the target gene; Figure 4 This study is to show the effect of the branched-chain amino acid absorption expression system controlled by different promoters with Livt4 as the target gene on the production of avermectin.

[0064] Example 1, Comparative Example 1, and Comparative Example 2 constructed five promoters of different strengths (including the constitutive promoter PhrdB and four promoters of different strengths in Streptomyces avermitilis) to control the expression of two groups of branched-chain amino acid absorption expression systems. The test results show that plasmids pWTPFLivt3 and pWTPRLivt4 can better improve the ability of the strain to produce avermectin. Plasmid pWTPFLivt3 Figure 1 As shown, plasmid pWTPRLivt4 Figure 2 The fermentation results showed that the highest avermectin production of the engineered strains obtained by fine-tuning the branched-chain amino acid uptake expression systems Livt3 and Livt4 with different promoters in S. avermitilis WT was 316.4 mg / L and 389.4 mg / L, respectively, which was 48.3% and 82.5% higher than that of S. avermitilis WT (see Figure 3 , Figure 4 ).

[0065] The concentrations of branched-chain amino acids inside and outside the cells of the engineered bacteria WTPRL4 and the starting strain WT were detected and compared after the fermentation. The concentrations of branched-chain amino acids outside the cells were shown in Figure 5 The concentration of each branched-chain amino acid in the cell is shown in Figure 6 The test results showed that after the fermentation of the engineered bacteria WTPRL4, the intracellular and extracellular isoleucine concentrations were 53.3% and 63.0% of those of the starting strain WT, respectively.

[0066] The results show that the branched-chain amino acid absorption and expression system proposed in the present invention can effectively improve the absorption efficiency of branched-chain amino acids, and increase the production and yield of avermectin; by fine-tuning the expression level of the target gene through promoters of different strengths, it can better adapt to different metabolic pathways in Streptomyces, thereby increasing the yield of microbial secondary metabolites.

[0067] The above is only one of the applications of the present invention. It should be pointed out that for ordinary technicians in this field, without departing from the principles of the present invention, the recombinant vector described in the present invention can also be used to increase the production of other similar polyketide compounds. These applications should also be regarded as the scope of protection of the present invention.

[0068] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A branched-chain amino acid absorption and expression system, characterized in that: Contains promoters and genes for absorbing branched-chain amino acids; Wherein, the nucleotide sequence of the promoter is as SEQ.ID.NO.1 or SEQ.ID.NO.2; The nucleotide sequence of the gene for absorbing branched-chain amino acids is shown as SEQ.ID.NO.6 or SEQ.ID.NO.

7.

2. The branched-chain amino acid absorption and expression system according to claim 1, characterized in that: The nucleotide sequence of the promoter is shown in SEQ.ID.NO.1, and the nucleotide sequence of the gene for absorbing branched-chain amino acids is shown in SEQ.ID.NO.7; or The nucleotide sequence of the promoter is shown in SEQ.ID.NO.2, and the nucleotide sequence of the gene for absorbing branched-chain amino acids is shown in SEQ.ID.NO.

6.

3. A recombinant vector, characterized in that: The invention comprises the branched-chain amino acid absorption and expression system as claimed in claim 1 or 2.

4. The recombinant vector according to claim 3, characterized in that The starting vector of the recombinant vector is pSET152.

5. A recombinant bacterium, characterized in that: A method comprising the branched-chain amino acid absorption and expression system according to claim 1 or 2; or a method comprising the recombinant vector according to claim 3 or 4; The starting strain of the recombinant bacteria is Streptomyces avermitilis.

6. Use of the branched-chain amino acid absorption and expression system as claimed in claim 1 or 2 in increasing the yield of avermectin.

7. Use of the recombinant vector as claimed in claim 3 or 4 in increasing the yield of avermectin.

8. Use of the recombinant bacteria as claimed in claim 5 in increasing the yield of avermectin.

Citation Information

Patent Citations

  • Carbon source absorption expression system, recombinant bacteria and application

    CN111607547A

  • Genetic engineering method for improving titer and proportion of abamectin B1a component

    CN116426454A