Function verification method of GA-induced cassava MYB transcription factor

Abstract

The invention belongs to the technical field of bioengineering, and discloses a GA-induced cassava MYB transcription factor function verification method which comprises the following steps: S1, cloning a MeGAMYB gene; performing amplification through a PCR (Polymerase Chain Reaction) method to obtain a cassava MeGAMYB gene containing a base sequence 1533bp fragment; s2, carrying out subcellular localization on the MeGAMYB gene; s3, carrying out yeast self-activation verification on the MeGAMYB gene; s4, a GA induction function of the MeGAMYB gene is verified; the gene function is verified in the eukaryotic yeast strain, the method has the advantages of rapidness and reliability, and a foundation is laid for further deep research on the gene function.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for verifying the function of cassava MeMYB gene and MYB transcription factor induced by GA. Background Art

[0002] Cassava (Manihot esculenta Crantz) is one of the three major tuber crops in the world. It originated in tropical America and is widely cultivated in tropical and some subtropical regions due to its strong adaptability, drought resistance, and barrenness resistance. It is the main food for low-income farmers in tropical wetlands. Since the establishment of the National Cassava Industry Technology System in 2008, more and more scientific researchers have devoted themselves to cassava research. The research on the entire cassava industry chain includes cassava germplasm resources, cassava genetic breeding, cassava cultivation, and cassava post-harvest processing. The discovery of key genes is of great significance to cassava breeding and even the research on the entire industry chain. MYB transcription factor is one of the most important transcriptional regulatory factors in the plant metabolic network, controlling plant growth and development, signal transduction, secondary metabolism, and also playing an important role in biotic and abiotic stresses. GAMYB is a MYB-type transcription factor regulated by gibberellin GA that encodes an R2R3-MYB DNA binding domain. It plays an important role in plant growth and development and is the first positive factor identified in the GA signal response pathway. GA is an important plant hormone that plays an important role in the induction of flowering, fruit development, and the synthesis of secondary metabolites. This study provides a MYB transcription factor regulated by GA, which plays an important role in the synthesis and regulation of cassava secondary metabolites such as anthocyanins and carotenoids.

[0003] Gene function verification generally uses the method of background genetic transformation, but it has the disadvantage of a long cycle, and some plants' own genetic transformation systems are not even mature yet. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides a method for verifying the function of MYB transcription factor induced by GA, which has the advantages of being fast and reliable by verifying the gene function in eukaryotic yeast species, and lays a foundation for further in-depth research on the function of the gene.

[0005] To achieve the above purpose, the following technical scheme is adopted: a method for verifying the function of MYB transcription factor induced by GA is provided, comprising the following steps:

[0006] Step S1. Cloning of the MeGAMYB gene: amplifying the cassava MeGAMYB gene containing a 1533 bp fragment of base sequence by PCR method;

[0007] Step S2. Subcellular localization of MeGAMYB gene;

[0008] Step S3. Verification of yeast self-activation of MeGAMYB gene;

[0009] Step S4. Verification of GA-inducible function of MeGAMYB gene;

[0010] The specific method of step S4 includes:

[0011] S4-1. The MeGAMYB gene was constructed into the yeast expression vector pDR196 by homologous recombination. The constructed recombinant vectors were named pDR196-MeGAMYB, and the recombinant plasmids were transformed into the yeast strain W303;

[0012] S4-2.pDR196-MeGAMYB yeast expression vector GA3 induced expression.

[0013] Preferably, in step S1, a PCR method is used, SC9 cassava leaf cDNA is used as a template, and specific primers are designed to amplify the MeGAMYB gene, the forward primer MeGAMYB-F of the full-length amplification primer is ATGAGCAAAATGG, and the reverse primer MeGAMYB-R is CTAGCATTCGCTATCAATAT.

[0014] Preferably, in step S2, the forward primer MeGAMYB-GFP-F of the subcellular localization primer of the MeGAMYB gene is

[0015] AGTGGTCTCTGTCCAGTCCTATGAGCAAAATGACAAAT, reverse primer MeGAMYB-GFP-R

[0016] GGTCTCAGCAGACCACAAGTCTAGCATTCGCTATCAATAT.

[0017] Preferably, in step S3, the forward primer MeGAMYB-BD-F of the yeast self-activation primer of the MeGAMYB gene is

[0018] ATGGAGGCCGAATTCATGAGCAAAATGACAAAT,

[0019] The reverse primer MeGAMYB-BD-R is

[0020] CGACGGATCCCCGGGCTAGCATTCGCTATCAATAT.

[0021] Preferably, the specific method of step S4-1 includes:

[0022] S4-1-1. Preparation of W303 competent cells

[0023] The preserved W303 strain was streaked on solid medium YPDA and cultured at 30°C for 3 days. A single colony was picked and inoculated into YPDA liquid medium. The OD 600 After reaching 0.4-0.5, centrifuge at 3000g for 5 minutes, discard the supernatant, resuspend the bacteria with 10mL solution A, centrifuge at 3000g for 5 minutes, discard the supernatant; add 1mL 1*TE / LiAc to the precipitate for resuspending to obtain yeast competent cells, and dispense 50μL into sterile cryovials for later use;

[0024] S4-1-2. Transformation of W303

[0025] Prepare the premix, take 360 ​​μL of the premix and add it to the competent cells W303, mix at high speed to completely suspend the yeast cells in the liquid; place in a 30°C water bath for heat shock for 45-60 minutes, mix every 10-15 minutes, centrifuge at 3000g for 3 minutes, discard the supernatant, resuspend with 0.9% NaCl, apply to SD+glucose solid plate, and culture at 30°C inverted for 2-3 days.

[0026] Preferably, the specific method of step S4-2 is: select positive clones and add them to SD / -Ura liquid culture medium, shake and culture at 30°C, 220rpm overnight, and adjust the OD 600 To 1.0, dilute 10 times, 100 times, 1000 times in sequence, take 5 μL and spot on SD / -Ura+10mM GA3 plate respectively, and culture in 30℃ incubator for 3 days after complete absorption; take normal culture as control, and compare the growth of yeast strains transformed with pDR196-MeGAMYB and pDR196 empty vector plasmids; it shows that MeGAMYB can grow better under GA3 conditions than the control.

[0027] Preferably, the forward primer MeGAMYB-pDR196-F of the yeast function verification primer of the MeGAMYB gene is

[0028] ATATACCCCAGCCTCGATGAGCAAAATGACAAAT, reverse primer MeGAMYB-pDR196-R

[0029] CGATAAGCTTGATATCCTAGCATTCGCTATCAAT.

[0030] Another object of the present invention is to provide a cassava MeGAMYB gene, wherein the cassava MeGAMYB gene whose nucleotide sequence is shown in SEQ ID NO: 1 is amplified by PCR method.

[0031] The present invention has the following beneficial effects:

[0032] 1. The present invention uses a PCR method to design full-length amplification primers to amplify and obtain the cassava MeGAMYB gene containing a 1533bp base sequence fragment.

[0033] 2. The present invention designs subcellular localization primers of MeGAMYB, and MeGAMYB is localized in the cell nucleus.

[0034] 3. The present invention designs self-activation primers of MeGAMYB and adopts the yeast self-activation verification method, which shows that pGBKT7(BD)-MeGAMYB has no activation function on pGADT7(AD), which is consistent with empty AD / BD and there is no interaction relationship, that is, MeGAMYB has no self-activation activity.

[0035] 4. The present invention designs the yeast function verification primers of MeGAMYB, adopts the GA induction function verification method, and compares the growth of yeast strains transformed with pDR196-MeGAMYB and pDR196 empty vector plasmids with normal culture as the control. The results show that pDR196-MeGAMYB grows better than the control under GA3 conditions, and MeGAMYB can be induced by GA. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 It is a MeGAMYB fragment PCR clone (1: Marker; 2.3: MeGAMYB fragment).

[0037] Figure 2 This is the result diagram of MeGAMYB subcellular localization.

[0038] Figure 3 This is the MeGAMYB self-activation verification diagram.

[0039] Figure 4 This is a diagram of GA3-induced yeast expression of pDR196-MeGAMYB.

[0040] Figure 5 The cassava MeGAMYB gene sequence SEQ ID NO: 1 contains a 1533 bp fragment of base sequence. DETAILED DESCRIPTION

[0041] The features and advantages of the present invention can be further understood by the following detailed description in conjunction with the accompanying drawings. The embodiments provided are merely illustrative of the present invention and are not intended to limit the remainder of the present invention in any way. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments are all commercially available unless otherwise specified.

[0042] 1. Cloning of MeGAMYB gene

[0043] (1) PCR was used to amplify the MeGAMYB gene (the cassava MeGAMYB gene sequence containing a 1533 bp fragment of base sequence SEQ ID NO: 1) using SC9 cassava leaf cDNA as a template and specific primers (Table 1) were designed to amplify the MeGAMYB gene (the cassava MeGAMYB gene sequence containing a 1533 bp fragment of base sequence SEQ ID NO: 1) Figure 5 As shown), connect the T vector and send it for sequencing. If it is consistent with the protein sequence of the genome alignment, save it for future use. Figure 1 Shown is the PCR clone of the MeGAMYB fragment (1: Marker; 2.3: MeGAMYB fragment).

[0044] Table 1 Primers for full-length amplification of cassava MeGAMYB gene

[0045]

[0046] 2. Subcellular localization of MeGAMYB gene

[0047] Homologous recombination method was used to design primers for homologous recombination (Table 2). The plasmid with correct sequencing was used as a template to amplify the adapter fragment. According to the instructions of the Nimble Cloning Mix kit, it was connected to the pNC-Green-SubN expression vector to construct the plant transient expression vector pNC-Green-SubN-MeGAMYB. The gene was injected into the back of the tobacco leaves with good growth through Agrobacterium GV3101-psoup, and the empty vector was used as a control. After 24 hours of pure dark culture and 2 days of normal light culture, the distribution of fluorescence signals in tobacco leaf cells was observed using a laser confocal microscope (TCS SP8, Leica). The results are shown in Figure 2 As shown, MeGAMYB is localized in the nucleus.

[0048] Table 2 Primers for subcellular localization of MeGAMYB

[0049]

[0050] 3. Verification of yeast self-activation of MeGAMYB gene

[0051] Homologous recombination method was used to design primers (Table 3). The plasmid with correct sequencing was used as a template to amplify the adapter fragment. The pGBKT7-BD vector was digested with HindIII. The vector fragment and the gene fragment were connected using homologous recombination enzymes and transformed to obtain positive strains. The plasmid was extracted and transferred into AH109 according to the yeast transformation method. The plasmid was plated on SD-Trp / -Leu plates. After the colonies grew, they were spotted on SD-Trp / -Leu / -His / -Ada plates. The empty vector was used as a control. The results showed that pGBKT7(BD)-MeGAMYB had no activation function on pGADT7(AD), which was consistent with empty AD / BD. There was no interaction relationship, that is, MeGAMYB had no self-activation activity. Figure 3 shown.

[0052] Table 3 Self-activation primers of MeGAMYB

[0053]

[0054] 4. Verification of GA-induced function of MeGAMYB gene

[0055] (1) Using the homologous recombination method, the pDR196 vector was digested with XmaI / SmaI or PstI or EcoRI, and specific primers (Table 4) were designed to amplify the homologous fragment of the MeGAMYB gene. The MeGAMYB gene was constructed into the yeast expression vector pDR196 using a homologous recombination kit. The constructed recombinant vector was named pDR196-MeGAMYB. The recombinant plasmid was transformed into the competent Escherichia coli DH5α, and the plasmid was extracted from DH5α for transformation into the yeast strain W303. The specific process is as follows:

[0056] (1-1) Preparation of W303 competent cells:

[0057] W303 competent cells were prepared according to the instructions of the Saccharomyces cerevisiae efficient competent cell preparation kit of Zhuangmeng Biotechnology (ZC135, Beijing). The preserved W303 strain was streaked on the solid medium YPDA and cultured at 30°C for 3 days. A single colony was picked and inoculated into the YPDA liquid medium. The OD 600 When the density reaches 0.4-0.5, centrifuge at 3000g for 5 minutes, discard the supernatant, resuspend the cells with 10mL solution A, centrifuge at 3000g for 5 minutes, and discard the supernatant. Add 1mL 1*TE / LiAc to the precipitate for resuspending to obtain yeast competent cells, and dispense 50μL into sterile cryovials for later use.

[0058] (1-2) Transformation of W303:

[0059] Prepare a premix (350 μL LiAc / PEG + 5 μL plasmid (200 ng / μL) + 5 μL sterile water). Take 360 ​​μL of the premix and add it to the competent cells W303. Mix at high speed to completely suspend the yeast cells in the liquid. Heat shock the cells in a 30°C water bath for 45 to 60 minutes, mix every 10-15 minutes, centrifuge at 3000g for 3 minutes, discard the supernatant, resuspend with 0.9% NaCl, and apply to SD+glucose solid plates. Incubate at 30°C for 2 to 3 days.

[0060] (2) pDR196-MeGAMYB yeast expression vector GA3 induced expression

[0061] Select positive clones and add them to SD / -Ura liquid medium. Cultivate overnight at 30°C and 220 rpm with shaking. Adjust the OD 600 To 1.0, dilute 10 times, 100 times, 1000 times, take 5 μL of each spot on SD / -Ura (+10mM GA3) plate, and culture in 30℃ incubator for 3 days after complete absorption. Using normal culture as control, compare the growth of yeast strains transformed with pDR196-MeGAMYB and pDR196 empty vector plasmids. The results show that pDR196-MeGAMYB grows better than the control under GA3 conditions. MeGAMYB can be induced by GA. Figure 4 shown.

[0062] Table 4 Yeast function verification primers of MeGAMYB

[0063]

[0064] The above disclosure is only the preferred embodiment of the present invention, which certainly cannot be used to limit the scope of the present invention. Therefore, equivalent changes made according to the claims of the present invention still fall within the scope covered by the present invention.

Claims

1. A method for verifying the function of cassava MYB transcription factor induced by GA, characterized in that: The following steps are involved: Step S1. Cloning of MeGAMYB gene; The cassava MeGAMYB gene containing a 1533 bp fragment of base sequence was amplified by PCR. Step S2. Subcellular localization of MeGAMYB gene; Step S3. Verification of yeast self-activation of MeGAMYB gene; Step S4. Verification of GA-inducible function of MeGAMYB gene; The specific method of step S4 includes: S4-1. The MeGAMYB gene was constructed into the yeast expression vector pDR196 by homologous recombination. The constructed recombinant vectors were named pDR196-MeGAMYB, and the recombinant plasmids were transformed into the yeast strain W303; S4-2.pDR196-MeGAMYB yeast expression vector GA3 induced expression.

2. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 1, characterized in that: In step S1, specific primers are designed to amplify the MeGAMYB gene, the forward primer MeGAMYB-F of the full-length amplification primer is ATGAGCAAAATGG, and the reverse primer MeGAMYB-R is CTAGCATTCGCTATCAATAT.

3. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 1, characterized in that: In step S2, the forward primer MeGAMYB-GFP-F of the subcellular localization primers of the MeGAMYB gene is AGTGGTCTCTGTCCAGTCCTATGAGCAAAATGACAAAT, and the reverse primer MeGAMYB-GFP-R is GGTCTCAGCAGACCACAAGTCTAGCATTCGCTATCAATAT.

4. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 1, characterized in that: In step S3, the forward primer MeGAMYB-BD-F of the yeast self-activation primer of the MeGAMYB gene is ATGGAGGCCGAATTCATGAGCAAAATGACAAAT, and the reverse primer MeGAMYB-BD-R is CGACGGATCCCCGGGCTAGCATTCGCTATCAATAT.

5. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 1, characterized in that: The specific method of step S4-1 includes: S4-1-1. Preparation of W303 competent cells The stored W303 strain was streaked on solid medium YPDA, cultured at 30°C for 3 days, and a single colony was picked and inoculated into YPDA liquid medium. After OD600 reached 0.4-0.5, the suspension was centrifuged at 3000g for 5 minutes, the supernatant was discarded, and the bacteria were resuspended with 10mL solution A, centrifuged at 3000g for 5 minutes, and the supernatant was discarded; 1mL 1*TE / LiAc was added to the precipitate for resuspending to obtain yeast competent cells, which were dispensed into sterile cryovials at 50μL for later use; S4-1-2. Transformation of W303 Prepare the premix, take 360 ​​μL of the premix and add it to the competent cells W303, mix at high speed to completely suspend the yeast cells in the liquid; place in a 30°C water bath for heat shock for 45-60 minutes, mix every 10-15 minutes, centrifuge at 3000g for 3 minutes, discard the supernatant, resuspend with 0.9% NaCl, apply to SD+glucose solid plate, and culture at 30°C inverted for 2-3 days.

6. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 1, characterized in that: The specific method of step S4-2 is: select positive clones and add them to SD / -Ura liquid culture medium, shake and culture at 30°C, 220rpm overnight, and adjust the OD 600 To 1.0, dilute 10 times, 100 times, 1000 times in sequence, take 5 μL and spot on SD / -Ura+10mM GA3 plate respectively, and culture in 30℃ incubator for 3 days after complete absorption; take normal culture as control, and compare the growth of yeast strains transformed with pDR196-MeGAMYB and pDR196 empty vector plasmids; it shows that MeGAMYB can grow better under GA3 conditions than the control.

7. The method for verifying the function of cassava MYB transcription factor induced by GA according to claim 6, characterized in that: The forward primer MeGAMYB-pDR196-F of the yeast function verification primers for the MeGAMYB gene is ATATACCCCAGCCTCGATGAGCAAAATGACAAAT, and the reverse primer MeGAMYB-pDR196-R is CGATAAGCTTGATATCCTAGCATTCGCTATCAAT.

8. A cassava MeGAMYB gene, characterized in that: The cassava MeGAMYB gene whose nucleotide sequence is shown in SEQ ID NO: 1 is amplified by the PCR method of claim 1.

Images