TaCBSX3 gene and the protein encoded by the gene are applied to improving transformation efficiency of wheat
By introducing the TaCBSX3 gene and its encoded protein into wheat and using Agrobacterium-mediated transformation, the problem of low wheat transformation efficiency was solved, efficient transformation of difficult-to-transform varieties was achieved, and the genotype range was broadened.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2023-10-23
- Publication Date
- 2026-05-01
AI Technical Summary
Wheat's complex allohexaploid characteristics result in low genetic transformation and regeneration efficiency and strong genotype dependence. The number of existing regeneration genes is insufficient, which limits the development of wheat bio-breeding.
The TaCBSX3 gene and its encoded protein were introduced and genetic transformation was carried out using Agrobacterium-mediated transformation to improve the efficiency of nucleic acid molecule introduction and embryo regeneration. The expression cassette of the TaCBSX3 gene and recombinant vector were used to promote plant transformation.
It significantly improved the transformation efficiency of the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204, broke through the genotype limitation, and provided new regeneration genes for wheat genetic transformation.
Smart Images

Figure CN119876227B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the TaCBSX3 gene and its encoded protein in improving wheat conversion efficiency. Background Technology
[0002] Genetic transformation is one of the most commonly used methods for studying wheat gene function and improving agronomic traits, and it has become a powerful tool for wheat biobreeding. Genetic transformation is an effective means of improving existing varieties, providing opportunities for targeted improvement of wheat materials with important superior traits.
[0003] Highly efficient regeneration of wheat is a crucial foundation for genetic transformation. However, due to wheat's allohexaploid nature and complex genetic characteristics, genetic transformation using transgenic technology is challenging. Wheat in vitro tissue culture commonly suffers from low regeneration efficiency and strong genotype and explant dependence, which have become major factors limiting the development of wheat biobreeding. Among Chinese wheat varieties (lines), only a few, such as Kenong 199 and CB037, have transformation efficiencies exceeding 20%, while varieties like Jimai 22, Aikang 58, Jing 411, Zhongmai 895, Yangmai 16, Chunmai 42, Shi 4185, Shilu 02-1, and Lunxuan 987 have transformation efficiencies below 10% (Wang et al., 2017).
[0004] To improve the efficiency of wheat genetic transformation, studies have found that introducing genes such as GRF4-GIF1 (Debernardi et al., 2020; Qiu et al., 2022), TaWOX5 (Wang et al., 2022), TaDOF3.4, and TaDOF5.6 (Liu et al., 2023) into different wheat varieties can significantly improve transformation efficiency, indicating that the use of regeneration-related genes can effectively overcome the genotype dependence of wheat genetic transformation. However, the number of regeneration genes isolated is still relatively small. Further isolation of new genes that can improve wheat regeneration and genetic transformation efficiency is of great significance for improving crop agronomic traits and promoting biotechnology breeding. Summary of the Invention
[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide the application of the TaCBSX3 gene and its encoded protein in improving wheat conversion efficiency.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides the application of the TaCBSX3 gene in promoting the introduction of nucleic acid molecules into target plants;
[0008] The TaCBSX3 gene is a DNA molecule as shown in i), ii), or iii) below:
[0009] i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;
[0010] ii) DNA molecules that have 80% or more homology with i) in nucleotide sequence and express the same or similar functional proteins, as well as the corresponding alleles, homologous genes, mutant genes and derived genes;
[0011] iii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO.2.
[0012] The term "homology" used here refers to sequence similarity to natural nucleic acid sequences. Homology can be evaluated using computer software, such as the BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).
[0013] In the aforementioned nucleic acid molecules, the 80% or more homology can be at least 80%, 85%, 90%, 95%, 96%, 98%, or 99% homology.
[0014] A second aspect of the invention provides the use of the protein encoded by the TaCBSX3 gene in either (1) or (2) below:
[0015] (1) Improve the transformation efficiency of nucleic acid molecules introduced into target plants;
[0016] (2) Improve the regeneration efficiency of target plant embryos.
[0017] Preferably, the protein encoded by the TaCBSX3 gene is any one of the following proteins: (A1), (A2), or (A3):
[0018] (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing;
[0019] (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).
[0020] (A3) encodes a protein similar to the protein shown in SEQ ID NO.2, or a protein obtained by substitution, deletion or insertion of one, several or dozens of amino acids.
[0021] The proteins described in (A1), (A2) and (A3) can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0022] In the aforementioned proteins, a protein tag refers to a polypeptide or protein expressed fused with the target protein using in vitro DNA recombination technology, facilitating the expression, detection, tracing, and / or purification of the target protein. Specifically, to facilitate the purification of the protein in (A1), a tag can be attached to the amino or carboxyl terminus of the protein in (A1). The tag can be Poly-Arg (typically 6 RRRRR), Poly-His (typically 6 HHHHHH), FLAG (DYKDDDDK), Strep-tagII (WSHPQFEK), or c-Myc (EQKLISEEDL).
[0023] A third aspect of the present invention provides the use of an expression cassette containing the TaCBSX3 gene, a recombinant expression vector, or a recombinant bacterium in promoting the introduction of nucleic acid molecules into a target plant.
[0024] In the above applications, the target plant is a monocotyledonous plant, including but not limited to wheat, corn, rice, barley, etc.
[0025] Preferably, the target plant is wheat; further, the wheat is the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204.
[0026] A fourth aspect of the present invention provides a method for improving the transformation efficiency of nucleic acid molecules introduced into target plants, comprising the following steps:
[0027] By transferring expression cassettes containing the TaCBSX3 gene and nucleic acid molecules into target plants, the transformation efficiency of nucleic acid molecules entering target plants can be improved.
[0028] In the above methods, the TaCBSX3 gene and nucleic acid molecules can be transferred into the target plant through a vector or through different vectors.
[0029] Preferably, the TaCBSX3 gene and nucleic acid molecules are transferred into the target plant via the pc186 expression vector.
[0030] In the above method, the target plant includes, but is not limited to, monocotyledonous plants such as wheat, corn, rice, and barley, and can also be applied to dicotyledonous plants such as soybean and rapeseed.
[0031] The beneficial effects of this invention are:
[0032] This invention cloned the wheat TaCBSX3 gene and introduced it into the difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204. The results showed that the TaCBSX3 gene can significantly improve the transformation efficiency of difficult-to-transform wheat varieties, solve the problem of wheat transformation genotype restriction, and provide a new regeneration gene for wheat genetic transformation. Attached Figure Description
[0033] Figure 1 A partial structural diagram of the plant expression vector pc186-TaCBSX3;
[0034] Figure 2 A partial structural diagram of the plant expression vector pc186-GUS.
[0035] Figure 3 This diagram illustrates the results of PCR-specific amplification of the bar gene in candidate transgenic plants obtained by transforming the plant expression vector pc186-TaCBSX3. In the diagram, PC represents the positive plasmid, NC represents the negative control, CK represents the wild-type control, M represents the 2000bp molecular weight marker, and 1-9 represent candidate transgenic plants. Detailed Implementation
[0036] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0037] As mentioned earlier, due to its large and complex genome, numerous repetitive DNA sequences, and low regeneration capacity, the application of transgenic technology in wheat lags far behind other major crops. Existing studies have found that utilizing regeneration genes can improve the regeneration efficiency and genetic transformation efficiency of wheat plants in in vitro tissue culture, broadening the range of convertible genotypes. However, the number of wheat regeneration genes isolated and identified is still very small, and some wheat genotypes cannot be successfully transformed. Therefore, in-depth research into the molecular basis of wheat regeneration and the discovery of wheat regeneration-related genes are crucial to overcoming the limitations imposed by wheat genotypes.
[0038] Cystathione β synthase (CBS) domain proteins constitute a large and important family of protein genes. Shi Youliang discovered that the expressed protein of CaCBSX3 is located on the cytoplasmic membrane. Transient overexpression of this gene in pepper leaves can activate cell necrosis in pepper leaves, correspondingly increasing the conductivity of pepper leaves, suggesting that this gene may be involved in plant immune responses (Isolation and Preliminary Functional Analysis of Full-Length cDNA of CaHB3 and CaCBSX3 in Pepper, Master's Thesis, Fujian Agriculture and Forestry University, 2013). Li Yan et al. found that CrCBSX3 can inhibit BAX-induced cell necrosis in leaves of Nicotiana benthamiana, suggesting that CrCBSX3 may play a role in the early interaction between periwinkle and wheat blue dwarf phytoplasma (Cloning and Preliminary Functional Study of the Periwinkle CrCBSX3 Gene, Proceedings of the 2016 Annual Meeting of the Chinese Society for Plant Pathology). Wang et al. (Glutathione S-transferase interactions enhance wheat resistance to powdery mildew but not wheat striperust, Plant Physiology, 2022) used proteomics sequencing to reveal the similarities and differences in wheat responses to stripe rust and powdery mildew infection. They further elucidated the molecular mechanism by which the glutathione S-transferase TaGSTU6 positively regulates wheat resistance to powdery mildew, but has no effect on stripe rust, through interaction with the protein TaCBSX3, which contains a cystathione β-synthetase (CBS) domain. However, the application of the TaCBSX3 gene in wheat genetic transformation has not yet been reported.
[0039] Based on this, the present invention conducts an in-depth study on the function of the wheat TaCBSX3 gene. The nucleotide sequence of the TaCBSX3 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the TaCBSX3 gene is shown in SEQ ID NO.2; specifically as follows:
[0040] TaCBSX3 gene:
[0041] ATGTATGATTTGACGCAGAACAAAATGCAGCGAGCAATTCAAGCTATCGGATCACATGGCAGTGTGCTCAAATCTGCTGTCCTGCAACACATCAGTGTTGTGAAGCCTGCTATGCTGCCTGCTGTGTTCCCGCGCTTCATGTCAGTATCACCTGCTCAAATAGAGGAGAGTGGATTTGAGAGCAGCACTGTTGCGGACATTTTGAAGTCCAAAGGGAAGAGTGCTGATGGATCATGGCTCTGGTGCACCACTGATGACAGTGTCTATGATGCTGTCAAATCGATGACACAGCACAATGTGGGAGCTTTGGTGGTTGTTAAACCCGGGGAAGATAAATCAATTGCTGGCATCGTCACAGAGAGAGATTATCTCCGGAAAATCATAGTGCAGGGTCGATCCTCCAAGTCAACCAAAGTTGGAGATATCATGACCGAAGAGAACAAGCTGATCACGGTGAAACCTGAAACCAGAGTCCTGAAAGCAATGCAGCTGATGACAGACAAGCGTATCAGGCACATCCCGGTGATCAGCGGCACCGAGATGATGGGGATGGTCTCCATCGGCGACGTGGTGCGCGCGGTGGTCAGCGAGCACAAGGAGGAGCTGAACCGGCTCAACGCCTACATCCAGGGTGGGTACTAG(SEQ ID NO.1)
[0042] Protein encoded by TaCBSX3 gene:
[0043] MYDLTQNKMQRAIQAIGSHGSVLKSAVLQHISVVKPAMLPAVFPRFMSVSPAQIEESGFESSTVADILKSKGKSADGSWLWCTTDDSVYDAVKSMTQHNVGALVVVKPGEDKSIAGIVTERDYLRKIIVQGRSSKSTKVGDIMTEENKLITVKPETRVLKAMQLMTDKRIRHIPVISGTEMMGMVSIGDVVRAVVSEHKEELNRLNAYIQGGY(SEQ IDNO.2)
[0044] This invention utilizes Agrobacterium-mediated transformation experiments on different wheat genotypes and found that the TaCBSX3 gene can improve the transformation efficiency of the extremely difficult-to-transform wheat varieties Yanda 1817 and Kenong 9204, demonstrating great application potential. This invention was proposed based on this finding.
[0045] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0046] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, they are generally performed under conventional conditions, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual (3rd Edition)*, Science Press, 2002; D.L. Spector et al., eds., *Cellular Laboratory Manual*, Science Press, 2001; or according to the conditions recommended by the manufacturer.
[0047] Example 1: Cloning and expression vector construction of the TaCBSX3 gene
[0048] Total RNA was extracted from the wheat variety Fielder using the Ultrapure RNA Kit (Kangwei Century, catalog number: CW0581M).
[0049] cDNA was reverse transcribed using the FastKing RT Kit (With gDNase) (Tiangen Biotech (Beijing) Co., Ltd., catalog number: KR116).
[0050] Using cDNA as a template, PCR amplification was performed using primer pairs (upstream primer: 5'-ATGTATGATTTGACGCAGAAC-3', SEQ ID NO. 3; downstream primer: 5'-CTAGTACCCACCCTGGATG-3', SEQ ID NO. 4). The amplification system consisted of 2 μl upstream primer (10 μmol / μl), 2 μl downstream primer (10 μmol / μl), 12.5 μl 2×Phanta Max Master Mix, 1 μl cDNA template, and ddH2O to bring the total volume to 25 μl. The amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 25 seconds, for 32 cycles; and 72℃ extension for 5 minutes.
[0051] The amplified PCR products, -Blunt3Cloning Kit (Beijing TransGen Biotech Co., Ltd., Product No.: CB301-01) Operation Steps Link The -Blunt3 vector was used to obtain the pEASY-Blunt3-TaCBSX3 vector, which was then sequenced.
[0052] Sequencing analysis revealed that the nucleotide sequence of the PCR amplification product is sequence 1 in the sequence listing, and the gene represented by the PCR product is named TaCBSX3; the protein encoded by this gene is named TaCBSX3, and the amino acid sequence of this protein is sequence 2 in the sequence listing.
[0053] Alternatively, sequence 1 can be artificially synthesized and linked to the pEASY-Blunt3 vector to obtain the pEASY-Blunt3-TaCBSX3 vector.
[0054] Using pEASY-Blunt3-TaCBSX3 as a template, primer pairs (upstream primer: 5'-CACCATGTATGATTTGACGCAG-3', SEQ ID NO.5; downstream primer: 5'-CTAGTACCCACCCTGGATG-3', SEQ ID NO.4) were designed for PCR amplification. The amplification system consisted of 2 μl upstream primer (10 μmol / μl), 2 μl downstream primer (10 μmol / μl), 12.5 μl 2×Phanta Max Master Mix, 1 μl DNA template, and ddH2O was added to bring the total volume to 25 μl. The amplification conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 25 s, for 32 cycles; and 72℃ extension for 5 min.
[0055] The amplified PCR product was then analyzed according to pENTR. TM Directional Cloning Kit (ThermoScientific) TM (Catalog No.: K2400-20SP) Operation steps: Ligation and sequencing. Successfully sequenced single clones are ligated into the pc186 expression vector via the LR reaction to obtain the pc186-TaCBSX3 vector. A partial structural diagram of the vector is shown below. Figure 1 As shown.
[0056] pc186-TaCBSX3 was transformed into Agrobacterium EHA105 competent cells to obtain an Agrobacterium strain suitable for transformation, named pc186-TaCBSX3 / EHA105.
[0057] Example 2: Construction of the control vector pc186-GUS
[0058] Refer to NCBI ( https: / / www.ncbi.nlm.nih.gov / Nucleotides 15108-16919 of the website Sequence ID: MN266288.1 were used for PCR amplification using primer pair (upstream primer: 5'-ATGTTACGTCCTGTAGAA-3', SEQ ID NO. 6; downstream primer: 5'-TCATTGTTTGCCTCCCTG-3', SEQ ID NO. 7). The amplification system consisted of 2 μl upstream primer (10 μmol / μl), 2 μl downstream primer (10 μmol / μl), 12.5 μl 2×Phanta Max Master Mix, 1 μl cDNA template, and ddH2O to bring the total volume to 25 μl. The amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 55 seconds, for 32 cycles; and 72℃ extension for 5 minutes.
[0059] The amplified PCR products, The Blunt3 Cloning Kit (catalog number: CB301-01, Beijing TransGen Biotech Co., Ltd.) was used to perform ligation to obtain pEASY-B3-GUS, which was then sequenced.
[0060] Sequencing analysis revealed that the gene represented by the PCR product was named the GUS gene.
[0061] The GUS gene can also be synthesized artificially and linked into the pEASY-Blunt3 vector to obtain pEASY-Blunt3-GUS.
[0062] Using pEASY-Blunt3-GUS as a template, primer pairs (upstream primer: 5'-CACCATGTTACGTCCTGTAGAA-3', SEQ ID NO.8; downstream primer: 5'-TCATTGTTTGCCTCCCTG-3', SEQ ID NO.7) were designed for PCR amplification. The amplification system consisted of 2 μl upstream primer (10 μmol / μl), 2 μl downstream primer (10 μmol / μl), 12.5 μl 2×Phanta Max Master Mix, 1 μl cDNA template, and ddH2O to bring the total volume to 25 μl. The amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 55 seconds, for 32 cycles; and 72℃ extension for 5 minutes.
[0063] The amplified PCR product was then analyzed according to pENTR. TM Directional Cloning Kit (Item No.: K2400-20SP, Thermo Scientific)TM The procedure involves ligation and sequencing. Successfully sequenced single clones are ligated into the pc186 expression vector via an LR reaction to obtain the pc186-GUS vector. A partial structural diagram of the vector is shown below. Figure 2 As shown.
[0064] The pc186-GUS strain was transformed into Agrobacterium EHA105 competent cells, and the Agrobacterium strain that could be used for transformation was named pc186-GUS / EHA105.
[0065] Example 3: Agrobacterium-mediated transformation of wheat embryos and identification of resistant plants
[0066] I. For detailed steps and methods of Agrobacterium-mediated transformation of wheat immature embryos, please refer to Wheat (Triticum aestivum L.) Transformation Using Immature Embryos (Ishida et al., 2015). The basic steps of genetic transformation are as follows:
[0067] 1. Three days before infection, Agrobacterium pc186-TaCBSX3 / EHA105 and Agrobacterium pc186-GUS / EHA105 were inoculated onto YEP solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, respectively, and incubated in the dark at 28°C for 2 days. Single colonies were picked and inoculated into YEP liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured overnight at 28°C and 220 rpm with shaking. The Agrobacterium solutions were transferred to 2 ml centrifuge tubes, centrifuged at 6000 rpm for 5 minutes, the supernatant was discarded, and the precipitate was resuspended with resuspension buffer to obtain Agrobacterium resuspensions of pc186-TaCBSX3 / EHA105 and pc186-GUS / EHA105, respectively.
[0068] 2. Immature embryos of different wheat genotypes (wheat varieties Yanda 1817 and Kenong 9204) approximately 14 days after flowering were infected with Agrobacterium resuspension of pc186-TaCBSX3 / EHA105 and pc186-GUS / EHA105, respectively. The embryos were laid flat with the scutellum side up on WLS-AS medium (1 / 10 MS basal medium, 1 / 10 MS vitamins, glucose 10 g / L, acetylsyl syringone 100 μM, agarose 8 g / L) and incubated in the dark at 23°C for 2 days.
[0069] 3. After co-culture, the immature embryos were transferred to WLS-Res medium (MS basal medium, MS vitamins, 2,4-D 0.5 mg / L, picloram 2.2 mg / L, glutamine 0.5 g / L, casein 0.1 g / L, MgCl2·6H2O 0.75 g / L, maltose 40 g / L, AgNO3 0.85 mg / L, vitamin C 100 mg / L, carbenicillin 250 mg / L, agarose 5 g / L) and incubated in the dark at 25°C for 5 days.
[0070] 4. Transfer the recovered callus to WLS-P5 medium (WLS-Res medium with 5 mg / L PPT added) and incubate in the dark at 25°C for 14 days.
[0071] 5. Then transfer the callus tissue to WLS-P10 medium (WLS-Res medium with 10 mg / L PPT added) and incubate in the dark at 25°C for 21 days.
[0072] 6. Transfer the above callus tissue to LSZ-P5 medium (MS basal medium, LS vitamins, zeatin 5 mg / L, sucrose 20 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, plant gel 3 g / L) and incubate at 25℃ under light for 2 weeks.
[0073] 7. Transfer the regenerated shoots of wheat callus tissue to LSF-P5 medium (MS basal medium, LS vitamins, IBA 0.2 mg / L, sucrose 15 g / L, carbenicillin 250 mg / L, PPT 5 mg / L, plant gel 3 g / L), and culture in a 25℃ incubator under light until the roots of the regenerated shoots are about 1-2 cm long.
[0074] 8. Transplant the robust seedlings with long roots into nutrient soil to obtain resistant seedlings of pc186-TaCBSX3 and pc186-GUS, respectively.
[0075] II. PCR detection of candidate transgenic plants
[0076] Genomic DNA was extracted from the leaves of wheat plants transfected with pc186-TaCBSX3 and pc186-GUS vectors in generation T0 using the CTAB method (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 2001).
[0077] Primers were designed to detect the bar gene. The primer pair sequences (upstream primer: 5'-GGCGGTCTGCACCATCGTCAACCACTAC-3', SEQ ID NO.9; downstream primer: 5'-AGTCCAGCTGCCAGAAACCCACGTCATG-3', SEQ ID NO.10) amplified a sequence length of 446 bp. The amplification system consisted of 1 μl upstream primer (10 μmol / μl), 1 μl downstream primer (10 μmol / μl), 10 μl 2×Rapid Taq Master Mix, 1 μl DNA template, and ddH2O to bring the total volume to 20 μl. The amplification conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 15 seconds, for 32 cycles; and 72℃ extension for 5 minutes.
[0078] PCR identification results as follows Figure 3 As shown, wild-type wheat does not contain the 446bp bar gene fragment.
[0079] III. Statistical analysis of conversion efficiency of different wheat genotypes
[0080] Wheat embryos 14-15 days after pollination were infected with Agrobacterium, and the induced callus tissue was screened using a selection agent. The number of resistant callus tissues was counted upon transfer to LSF-P5 medium. After PCR identification, the number of positive seedlings was counted. Finally, the resistant callus induction rate and transformation efficiency were calculated using the following formulas:
[0081] The induction rate of resistant callus (%) = (number of resistant callus ÷ total number of embryos) × 100%;
[0082] Conversion efficiency (%) = (Number of positive seedlings ÷ Total number of embryos) × 100%;
[0083] Compared with the control vector pc186-GUS, transformation of wheat with the pc186-TaCBSX3 vector can effectively improve the transformation efficiency, as shown in Table 1.
[0084] Table 1: Comparison of transformation efficiency between control vector and pc186-TaCBSX3 vector
[0085]
[0086] When using immature embryos of the wheat variety Yanda 1817 as explants for Agrobacterium transformation, the induction rates of resistant callus with the pc186-TaCBSX3 vector and the control vector pc186-GUS were 96.80% and 93.81%, respectively; the transformation efficiency of the pc186-TaCBSX3 vector was 45.60%, while the control vector pc186-GUS failed to produce transgenic plants. When using Kenong 9204 as the recipient for genetic transformation, the induction rate of resistant callus and the transformation efficiency of the pc186-TaCBSX3 vector were 90.71% and 27.86%, respectively, both higher than the 86.13% and 5.84% of the control vector pc186-GUS. These results indicate that the TaCBSX3 gene can significantly improve the transformation efficiency of difficult-to-transform wheat varieties.
[0087] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. TaCBSX3 The application of genes in promoting the introduction of nucleic acid molecules into target plants is characterized by, The TaCBSX3 Genes are DNA molecules as shown in i) or ii) below: i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO. 2; The target plant is either wheat variety Yanda 1817 or Kenong 9204.
2. TaCBSX3 Application of gene-encoded proteins in improving the transformation efficiency of nucleic acid molecules introduced into target plants: The TaCBSX3 The protein encoded by the gene is the protein shown in either (A1) or (A2) below: (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); The target plant is either wheat variety Yanda 1817 or Kenong 9204.
3. Contains TaCBSX3 The application of gene expression cassettes, recombinant expression vectors, or recombinant bacteria in promoting the introduction of nucleic acid molecules into target plants, characterized by: The TaCBSX3 Genes are DNA molecules as shown in i) or ii) below: i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO. 2; The target plant is either wheat variety Yanda 1817 or Kenong 9204.
4. A method for improving the transformation efficiency of nucleic acid molecules introduced into target plants, characterized in that, Includes the following steps: Will contain TaCBSX3 Gene expression cassettes and nucleic acid molecules are transferred into target plants to improve the transformation efficiency of nucleic acid molecule introduction into target plants; The TaCBSX3 Genes are DNA molecules as shown in i) or ii) below: i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) DNA molecules other than i) encoding the amino acid sequence shown in SEQ ID NO. 2; The target plant is either wheat variety Yanda 1817 or Kenong 9204.
5. The method according to claim 4, characterized in that, TaCBSX3 Genes and nucleic acid molecules are transferred into the target plant through a vector or through different vectors.
Citation Information
Patent Citations
KR20210063667A